Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

Read1 before filtering:
total reads: 179938
total bases: 27170638
Q20 bases: 23178307(85.3065%)
Q30 bases: 16970117(62.4576%)

Read2 before filtering:
total reads: 179938
total bases: 27170638
Q20 bases: 25479253(93.775%)
Q30 bases: 19932289(73.3597%)

Read1 after filtering:
total reads: 23560
total bases: 1134035
Q20 bases: 1094927(96.5514%)
Q30 bases: 1016293(89.6174%)

Read2 after filtering:
total reads: 23560
total bases: 2117979
Q20 bases: 2044170(96.5151%)
Q30 bases: 1859514(87.7966%)

Filtering result:
reads passed filter: 47120
reads failed due to low quality: 18408
reads failed due to too many N: 0
reads failed due to too short: 294348
reads with adapter trimmed: 191846
bases trimmed due to adapters: 8947493

Duplication rate: 42.1606%

Insert size peak (evaluated by paired-end reads): 36

JSON report: NTC_0001_0001_B23MHV2LT4_1.fastp.json
HTML report: NTC_0001_0001_B23MHV2LT4_1.fastp.html

fastp --in1 NTC_0001_0001_B23MHV2LT4_1_1.fastq.gz --in2 NTC_0001_0001_B23MHV2LT4_1_2.fastq.gz --out1 NTC_0001_0001_B23MHV2LT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_B23MHV2LT4_1_2.fastp.fastq.gz --json NTC_0001_0001_B23MHV2LT4_1.fastp.json --html NTC_0001_0001_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds