File Info

Filename
NTC_0001_0001_B23MHV2LT4_2.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__3b7a596a--20260604-122713/fastp/NTC_0001_0001_B23MHV2LT4_2.fastp.log
Size
1.5 KB
Published
Jun 04, 2026 1:15 PM
Detecting adapter sequence for read1...
No adapter detected for read1

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 260893
total bases: 39394843
Q20 bases: 33964189(86.2148%)
Q30 bases: 25984855(65.96%)

Read2 before filtering:
total reads: 260893
total bases: 39394843
Q20 bases: 36634572(92.9933%)
Q30 bases: 26870075(68.2071%)

Read1 after filtering:
total reads: 244434
total bases: 35464176
Q20 bases: 30944659(87.2561%)
Q30 bases: 24098235(67.9509%)

Read2 after filtering:
total reads: 244434
total bases: 34893706
Q20 bases: 33480638(95.9504%)
Q30 bases: 24891947(71.3365%)

Filtering result:
reads passed filter: 488868
reads failed due to low quality: 32418
reads failed due to too many N: 68
reads failed due to too short: 432
reads with adapter trimmed: 34702
bases trimmed due to adapters: 3520436

Duplication rate: 57.1411%

Insert size peak (evaluated by paired-end reads): 35

JSON report: NTC_0001_0001_B23MHV2LT4_2.fastp.json
HTML report: NTC_0001_0001_B23MHV2LT4_2.fastp.html

fastp --in1 NTC_0001_0001_B23MHV2LT4_2_1.fastq.gz --in2 NTC_0001_0001_B23MHV2LT4_2_2.fastq.gz --out1 NTC_0001_0001_B23MHV2LT4_2_1.fastp.fastq.gz --out2 NTC_0001_0001_B23MHV2LT4_2_2.fastp.fastq.gz --json NTC_0001_0001_B23MHV2LT4_2.fastp.json --html NTC_0001_0001_B23MHV2LT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 14 seconds