Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 72938869
total bases: 11013769219
Q20 bases: 10642713968(96.631%)
Q30 bases: 10107029983(91.7672%)

Read2 before filtering:
total reads: 72938869
total bases: 11013769219
Q20 bases: 10723748710(97.3667%)
Q30 bases: 10193892858(92.5559%)

Read1 after filtering:
total reads: 71753783
total bases: 7843482430
Q20 bases: 7805195528(99.5119%)
Q30 bases: 7632015198(97.3039%)

Read2 after filtering:
total reads: 71753783
total bases: 7860367915
Q20 bases: 7809651596(99.3548%)
Q30 bases: 7625430662(97.0111%)

Filtering result:
reads passed filter: 143507566
reads failed due to low quality: 1965860
reads failed due to too many N: 14300
reads failed due to too short: 390012
reads with adapter trimmed: 125194074
bases trimmed due to adapters: 6021174899

Duplication rate: 45.7015%

Insert size peak (evaluated by paired-end reads): 106

JSON report: 659_b4x-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_b4x-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_b4x-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_b4x-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_b4x-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_b4x-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_b4x-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_b4x-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 122 seconds