Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 137505451
total bases: 20763323101
Q20 bases: 20222852543(97.397%)
Q30 bases: 19159651548(92.2764%)

Read2 before filtering:
total reads: 137505451
total bases: 20763323101
Q20 bases: 20286972631(97.7058%)
Q30 bases: 19271795806(92.8165%)

Read1 after filtering:
total reads: 135600507
total bases: 14004881963
Q20 bases: 13932733538(99.4848%)
Q30 bases: 13611320879(97.1898%)

Read2 after filtering:
total reads: 135600507
total bases: 14045595845
Q20 bases: 13953923823(99.3473%)
Q30 bases: 13614705697(96.9322%)

Filtering result:
reads passed filter: 271201014
reads failed due to low quality: 3570736
reads failed due to too many N: 29330
reads failed due to too short: 209822
reads with adapter trimmed: 237403216
bases trimmed due to adapters: 13006624469

Duplication rate: 24.4008%

Insert size peak (evaluated by paired-end reads): 87

JSON report: 659_eu1-T1-TRNA-1_B23MHV2LT4_1.fastp.json
HTML report: 659_eu1-T1-TRNA-1_B23MHV2LT4_1.fastp.html

fastp --in1 659_eu1-T1-TRNA-1_B23MHV2LT4_1_1.fastq.gz --in2 659_eu1-T1-TRNA-1_B23MHV2LT4_1_2.fastq.gz --out1 659_eu1-T1-TRNA-1_B23MHV2LT4_1_1.fastp.fastq.gz --out2 659_eu1-T1-TRNA-1_B23MHV2LT4_1_2.fastp.fastq.gz --json 659_eu1-T1-TRNA-1_B23MHV2LT4_1.fastp.json --html 659_eu1-T1-TRNA-1_B23MHV2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 208 seconds