MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 14:21 UTC based on data in: /tmp/nxf.D1JWxHOT6g

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	RNA contaminated	RNA contamination %	Unique Reads	Frac Antisense	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_1q-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	571228923	0.8618	130.8bp	118.0bp	0.03%	1.23%	0.81%	0.00%	0.06%	3.50%	1.09%	0.00%	0.00	591239618	0.01%	0.46%	321774584	0.94%	0.97%	0.05%	0.03%	303093411	152878058	15558836	5357108	560.01	243.00	0.71%	0.61%	0.97	0.000	9999000000	480850226				45.8%	89.4%	95.8%	283.2M	25.3%	97.0%	70109.4Mb	591.2M	53.1%	98.5%	63.8%
659_1q-T1-TRNA-1_B23MHV2LT4_1_1																																				130.8bp	98.3%	290.6M												86.4%	52%	151bp	151bp	27%	523.3M
659_1q-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.1%	53%	151bp	151bp	18%	523.3M
659_1q-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.3%	52%	122bp	127bp	27%	295.6M	83.3%	52%	122bp	127bp	27%	295.6M
659_1q-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.0%	53%	122bp	127bp	18%	295.6M	83.0%	53%	122bp	127bp	18%	295.6M
659_6i-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	408695482	0.9186	118.3bp	112.0bp	0.01%	1.45%	0.44%	0.00%	0.03%	4.28%	0.67%	0.00%	6.26	425325108	0.01%	0.63%	158404277	0.91%	0.94%	0.07%	0.06%	144692587	72703032	10773583	4541406	222.32	106.00	0.69%	0.51%	0.97	0.000	9999000000	136094442				63.2%	87.5%	95.2%	202.4M	35.9%	97.2%	47674.9Mb	425.3M	54.4%	98.6%	78.5%
659_6i-T1-TRNA-1_B23MHV2LT4_1_1																																				118.3bp	97.8%	208.0M												82.4%	53%	151bp	151bp	18%	215.8M
659_6i-T1-TRNA-1_B23MHV2LT4_1_2																																																		80.5%	54%	151bp	151bp	18%	215.8M
659_6i-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.4%	54%	115bp	117bp	9%	212.7M	82.4%	54%	115bp	117bp	9%	212.7M
659_6i-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.6%	54%	115bp	117bp	9%	212.7M	81.6%	54%	115bp	117bp	9%	212.7M
659_8h-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	8326	0.4628	88.7bp	33.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	74016	0.17%	0.63%	27117	0.02%	0.04%	0.51%	0.96%	555	275	13962	6688	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	41080				76.4%	1.6%	9.4%	0.0M	57.4%	91.0%	3.4Mb	0.1M	70.6%	13.0%	55.2%
659_8h-T1-TRNA-1_B23MHV2LT4_1_1																																				88.7bp	4.6%	0.0M												93.9%	73%	151bp	151bp	64%	0.3M
659_8h-T1-TRNA-1_B23MHV2LT4_1_2																																																		88.6%	93%	151bp	151bp	55%	0.3M
659_8h-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		62.3%	68%	49bp	37bp	45%	0.0M	62.3%	68%	49bp	37bp	45%	0.0M
659_8h-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		64.0%	73%	51bp	37bp	45%	0.0M	64.0%	73%	51bp	37bp	45%	0.0M
659_Dd-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573372761	0.9410	157.0bp	140.0bp	0.01%	0.94%	0.54%	0.00%	0.03%	3.04%	0.85%	0.00%	5.35	591172110	0.01%	0.42%	344683899	0.95%	0.98%	0.04%	0.02%	326148807	165201356	14818337	4054218	693.65	336.00	0.75%	0.66%	0.97	0.000	9999000000	620640001				42.0%	90.8%	96.0%	283.9M	26.5%	97.0%	75884.0Mb	591.2M	54.7%	98.5%	46.7%
659_Dd-T1-TRNA-1_B23MHV2LT4_1_1																																				157.0bp	97.9%	289.5M												87.0%	54%	151bp	151bp	27%	625.9M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.9%	54%	151bp	151bp	18%	625.9M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.9%	54%	132bp	151bp	27%	295.6M	82.9%	54%	132bp	151bp	27%	295.6M
659_Dd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.8%	55%	132bp	151bp	18%	295.6M	82.8%	55%	132bp	151bp	18%	295.6M
659_Dl-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	385146195	0.9065	119.0bp	111.0bp	0.02%	1.40%	0.46%	0.00%	0.05%	4.35%	0.73%	0.00%	0.01	406134418	0.01%	0.57%	174812883	0.92%	0.95%	0.06%	0.05%	160363394	80538758	11126435	4573490	257.36	120.00	0.69%	0.53%	0.97	0.000	9999000000	161286100				57.4%	84.5%	93.9%	190.7M	31.3%	97.0%	45755.9Mb	406.1M	54.6%	98.4%	75.7%
659_Dl-T1-TRNA-1_B23MHV2LT4_1_1																																				119.0bp	97.7%	198.3M												79.3%	53%	151bp	151bp	27%	206.4M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_2																																																		78.1%	54%	151bp	151bp	18%	206.4M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		79.4%	54%	116bp	117bp	18%	203.1M	79.4%	54%	116bp	117bp	18%	203.1M
659_Dl-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		79.4%	54%	116bp	117bp	9%	203.1M	79.4%	54%	116bp	117bp	9%	203.1M
659_Fr-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	568893304	0.8878	140.3bp	130.0bp	0.01%	1.10%	0.40%	0.00%	0.03%	3.73%	0.67%	0.00%	6.06	592668022	0.01%	0.54%	271248374	0.94%	0.96%	0.05%	0.04%	253960408	128217246	14012690	5017335	481.14	247.00	0.77%	0.65%	0.97	0.000	9999000000	272129214				54.5%	88.0%	95.2%	282.0M	33.5%	97.2%	73798.5Mb	592.7M	54.9%	98.8%	59.7%
659_Fr-T1-TRNA-1_B23MHV2LT4_1_1																																				140.3bp	98.3%	291.4M												85.1%	54%	151bp	151bp	18%	391.4M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.1%	54%	151bp	151bp	18%	391.4M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.1%	54%	128bp	137bp	18%	296.3M	83.1%	54%	128bp	137bp	18%	296.3M
659_Fr-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.9%	55%	128bp	137bp	9%	296.3M	82.9%	55%	128bp	137bp	9%	296.3M
659_Kh-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	5910751	0.8932	173.2bp	154.0bp	0.01%	0.94%	0.26%	0.00%	0.03%	2.94%	0.44%	0.00%	5.10	6186588	0.01%	0.83%	1060115	0.86%	0.92%	0.10%	0.08%	909457	461327	105440	38514	1.83	0.00	0.00%	0.00%	0.97	0.000	9999000000	1238895				83.5%	81.7%	94.6%	2.9M	62.8%	96.9%	796.2Mb	6.2M	54.0%	90.1%	44.9%
659_Kh-T1-TRNA-1_B23MHV2LT4_1_1																																				173.2bp	96.7%	3.0M												83.3%	55%	151bp	151bp	45%	3.4M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_2																																																		80.9%	58%	151bp	151bp	45%	3.4M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.9%	53%	133bp	151bp	18%	3.1M	81.9%	53%	133bp	151bp	18%	3.1M
659_Kh-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		80.9%	54%	133bp	151bp	9%	3.1M	80.9%	54%	133bp	151bp	9%	3.1M
659_Lx-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	518226911	0.9059	117.5bp	109.0bp	0.02%	1.11%	0.35%	0.00%	0.04%	3.44%	0.55%	0.00%	0.01	535799734	0.01%	0.51%	261276582	0.94%	0.96%	0.05%	0.04%	244860371	123014335	13721147	5393501	400.54	187.00	0.73%	0.60%	0.97	0.000	9999000000	343152179				51.5%	88.7%	95.8%	256.6M	23.9%	96.9%	59050.6Mb	535.8M	53.4%	98.5%	77.1%
659_Lx-T1-TRNA-1_B23MHV2LT4_1_1																																				117.5bp	98.2%	263.0M												79.7%	52%	151bp	151bp	27%	271.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_2																																																		78.5%	53%	151bp	151bp	18%	271.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		79.9%	53%	114bp	112bp	18%	267.9M	79.9%	53%	114bp	112bp	18%	267.9M
659_Lx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		79.7%	53%	114bp	112bp	9%	267.9M	79.7%	53%	114bp	112bp	9%	267.9M
659_Mt-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	566716626	0.8869	129.7bp	122.0bp	0.01%	0.87%	0.33%	0.00%	0.02%	2.71%	0.51%	0.00%	0.02	592735128	0.01%	0.60%	236843423	0.93%	0.95%	0.06%	0.05%	219093944	110371470	13980388	5501738	386.48	178.00	0.72%	0.60%	0.97	0.000	9999000000	216249019				60.4%	86.5%	94.8%	280.9M	36.1%	97.3%	71264.2Mb	592.7M	54.1%	98.8%	67.7%
659_Mt-T1-TRNA-1_B23MHV2LT4_1_1																																				129.7bp	97.8%	290.0M												84.8%	53%	151bp	151bp	27%	307.5M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.7%	53%	151bp	151bp	18%	307.5M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.7%	53%	124bp	127bp	27%	296.4M	84.7%	53%	124bp	127bp	27%	296.4M
659_Mt-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.4%	54%	124bp	127bp	9%	296.4M	84.4%	54%	124bp	127bp	9%	296.4M
659_On-T1-TRNA-2_B23MHV2LT4_1	No	0.00%	571656904	0.8736	140.5bp	128.0bp	0.02%	2.02%	0.60%	0.00%	0.04%	5.84%	0.91%	0.00%	6.38	591153756	0.00%	0.47%	312898864	0.94%	0.96%	0.05%	0.04%	293147797	148033187	16964901	5937717	560.82	233.00	0.70%	0.60%	0.97	0.000	9999000000	393848015				47.3%	89.7%	95.8%	283.2M	29.2%	97.0%	72723.9Mb	591.2M	54.4%	98.5%	57.8%
659_On-T1-TRNA-2_B23MHV2LT4_1_1																																				140.5bp	98.0%	289.8M												83.9%	53%	151bp	151bp	27%	336.3M
659_On-T1-TRNA-2_B23MHV2LT4_1_2																																																		82.9%	54%	151bp	151bp	18%	336.3M
659_On-T1-TRNA-2_B23MHV2LT4_1_trimmed_1																																																		83.3%	54%	127bp	137bp	18%	295.6M	83.3%	54%	127bp	137bp	18%	295.6M
659_On-T1-TRNA-2_B23MHV2LT4_1_trimmed_2																																																		83.4%	54%	127bp	137bp	18%	295.6M	83.4%	54%	127bp	137bp	18%	295.6M
659_R1-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	12019	0.4089	113.7bp	49.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	139800	0.14%	0.72%	39590	0.02%	0.03%	0.50%	0.97%	714	335	19790	9396	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	56011				83.0%	1.1%	7.3%	0.0M	49.3%	91.5%	5.9Mb	0.1M	71.3%	14.0%	56.0%
659_R1-T1-TRNA-1_B23MHV2LT4_1_1																																				113.7bp	3.7%	0.0M												94.5%	72%	151bp	151bp	64%	0.5M
659_R1-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.9%	92%	151bp	151bp	55%	0.5M
659_R1-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		67.9%	69%	45bp	37bp	45%	0.1M	67.9%	69%	45bp	37bp	45%	0.1M
659_R1-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		69.0%	73%	48bp	37bp	45%	0.1M	69.0%	73%	48bp	37bp	45%	0.1M
659_SP-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	571940234	0.9253	134.4bp	126.0bp	0.01%	1.10%	0.41%	0.00%	0.03%	3.51%	0.64%	0.00%	0.01	592703444	0.01%	0.47%	311451650	0.94%	0.96%	0.05%	0.04%	292133356	147315519	15559950	5700000	537.97	293.00	0.77%	0.67%	0.97	0.000	9999000000	401778959				47.8%	89.5%	95.7%	283.5M	27.2%	97.3%	72258.4Mb	592.7M	53.5%	98.8%	63.5%
659_SP-T1-TRNA-1_B23MHV2LT4_1_1																																				134.4bp	98.0%	290.3M												83.4%	52%	151bp	151bp	18%	402.2M
659_SP-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.6%	53%	151bp	151bp	18%	402.2M
659_SP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.1%	53%	125bp	132bp	27%	296.4M	81.1%	53%	125bp	132bp	27%	296.4M
659_SP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.2%	53%	125bp	132bp	9%	296.4M	81.2%	53%	125bp	132bp	9%	296.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	6002	0.4661	94.8bp	31.0bp	0.00%	0.05%	0.00%	0.00%	0.00%	0.13%	0.00%	0.00%	0.00	60974	0.19%	0.63%	22517	0.02%	0.03%	0.46%	0.97%	361	172	10370	4902	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	40836				78.2%	1.3%	8.0%	0.0M	49.1%	88.1%	3.1Mb	0.1M	72.1%	8.4%	53.0%
659_Wm-T1-TRNA-1_B23MHV2LT4_1_1																																				94.8bp	6.6%	0.0M												95.7%	73%	151bp	151bp	55%	0.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_2																																																		90.0%	96%	151bp	151bp	55%	0.4M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		61.4%	68%	56bp	37bp	45%	0.0M	61.4%	68%	56bp	37bp	45%	0.0M
659_Wm-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		63.5%	75%	59bp	37bp	55%	0.0M	63.5%	75%	59bp	37bp	55%	0.0M
659_b4x-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	136571315	0.9276	109.7bp	106.0bp	0.01%	0.85%	0.40%	0.00%	0.02%	2.56%	0.65%	0.00%	5.67	143507566	0.01%	0.85%	21939939	0.81%	0.87%	0.13%	0.13%	17754026	8894362	2867590	1320413	23.29	7.00	0.21%	0.04%	0.97	0.000	9999000000	24943325				85.5%	83.3%	94.2%	67.6M	45.7%	97.2%	15257.4Mb	143.5M	57.7%	98.4%	85.8%
659_b4x-T1-TRNA-1_B23MHV2LT4_1_1																																				109.7bp	97.1%	69.7M												86.3%	55%	151bp	151bp	18%	72.9M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.0%	57%	151bp	151bp	27%	72.9M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.3%	57%	109bp	107bp	9%	71.8M	86.3%	57%	109bp	107bp	9%	71.8M
659_b4x-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		86.0%	57%	110bp	107bp	9%	71.8M	86.0%	57%	110bp	107bp	9%	71.8M
659_b6o-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	8235	0.4581	99.8bp	113.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	75922	0.19%	0.62%	28477	0.02%	0.04%	0.46%	0.96%	563	274	13188	6284	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	37526				77.5%	1.6%	9.4%	0.0M	49.7%	90.3%	3.6Mb	0.1M	72.0%	8.7%	53.3%
659_b6o-T1-TRNA-1_B23MHV2LT4_1_1																																				99.8bp	4.8%	0.0M												95.7%	74%	151bp	151bp	55%	0.4M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.7%	94%	151bp	151bp	55%	0.4M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		61.7%	68%	51bp	37bp	45%	0.0M	61.7%	68%	51bp	37bp	45%	0.0M
659_b6o-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		63.7%	75%	54bp	37bp	45%	0.0M	63.7%	75%	54bp	37bp	45%	0.0M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	566794985	0.9249	159.1bp	145.0bp	0.03%	1.25%	0.49%	0.00%	0.05%	3.57%	0.69%	0.00%	0.01	592611430	0.01%	0.44%	333576547	0.94%	0.97%	0.05%	0.03%	314606885	159517184	15085284	4435717	660.59	309.00	0.76%	0.66%	0.97	0.000	9999000000	480846144				44.0%	87.5%	94.8%	280.8M	29.5%	97.3%	77312.2Mb	592.6M	53.8%	98.8%	46.9%
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_1																																				159.1bp	98.2%	291.0M												87.4%	53%	151bp	151bp	18%	522.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.6%	53%	151bp	151bp	18%	522.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.0%	53%	134bp	151bp	18%	296.3M	84.0%	53%	134bp	151bp	18%	296.3M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.1%	54%	134bp	151bp	9%	296.3M	84.1%	54%	134bp	151bp	9%	296.3M
659_bCu-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	490635478	0.9659	119.5bp	113.0bp	0.00%	0.63%	0.27%	0.00%	0.00%	2.05%	0.43%	0.00%	0.16	510617944	0.01%	0.74%	130517564	0.88%	0.92%	0.09%	0.08%	115501519	58043218	11201465	4856999	178.36	48.00	0.57%	0.37%	0.97	0.000	9999000000	125736775				75.0%	87.3%	95.2%	242.9M	44.1%	97.1%	57811.6Mb	510.6M	59.1%	98.6%	77.3%
659_bCu-T1-TRNA-1_B23MHV2LT4_1_1																																				119.5bp	97.7%	249.4M												87.3%	57%	151bp	151bp	18%	258.8M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.0%	57%	151bp	151bp	18%	258.8M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		87.4%	58%	117bp	117bp	9%	255.3M	87.4%	58%	117bp	117bp	9%	255.3M
659_bCu-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		87.0%	59%	117bp	117bp	9%	255.3M	87.0%	59%	117bp	117bp	9%	255.3M
659_bGW-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	566502701	0.9552	126.8bp	115.0bp	0.04%	1.41%	0.67%	0.00%	0.09%	4.43%	0.98%	0.00%	0.01	591208932	0.01%	0.48%	307574947	0.95%	0.97%	0.04%	0.03%	290753249	146455890	13585183	4647272	520.76	237.00	0.74%	0.63%	0.97	0.000	9999000000	434048876				48.2%	87.5%	95.0%	280.7M	25.5%	97.0%	68498.8Mb	591.2M	54.8%	98.5%	68.0%
659_bGW-T1-TRNA-1_B23MHV2LT4_1_1																																				126.8bp	98.4%	291.0M												85.4%	53%	151bp	151bp	27%	467.5M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.2%	54%	151bp	151bp	18%	467.5M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.7%	54%	119bp	122bp	27%	295.6M	82.7%	54%	119bp	122bp	27%	295.6M
659_bGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.6%	55%	120bp	122bp	18%	295.6M	82.6%	55%	120bp	122bp	18%	295.6M
659_bGc-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	570847545	0.9325	117.8bp	109.0bp	0.02%	1.01%	0.39%	0.00%	0.04%	2.94%	0.57%	0.00%	0.09	590445544	0.01%	0.56%	259749431	0.93%	0.96%	0.05%	0.04%	242445636	121881178	13995478	5385239	397.66	197.00	0.75%	0.62%	0.97	0.000	9999000000	259949497				56.3%	89.6%	95.9%	283.1M	28.6%	97.0%	65719.8Mb	590.4M	54.5%	98.4%	75.0%
659_bGc-T1-TRNA-1_B23MHV2LT4_1_1																																				117.8bp	98.3%	290.2M												83.4%	53%	151bp	151bp	27%	340.7M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_2																																																		81.7%	54%	151bp	151bp	27%	340.7M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.4%	54%	115bp	117bp	18%	295.2M	82.4%	54%	115bp	117bp	18%	295.2M
659_bGc-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.0%	54%	115bp	117bp	18%	295.2M	82.0%	54%	115bp	117bp	18%	295.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1	Yes	0.07%	569589324	0.9568	153.5bp	141.0bp	0.02%	1.25%	0.75%	0.00%	0.04%	3.95%	1.11%	0.00%	0.18	592861926	0.01%	0.42%	343955966	0.95%	0.97%	0.04%	0.03%	326090245	165106639	14536742	4278911	679.61	301.00	0.74%	0.64%	0.97	0.000	9999000000	559712878				42.2%	88.5%	95.2%	282.2M	28.7%	97.3%	76686.7Mb	592.9M	54.4%	98.8%	49.2%
659_bIB-T1-TRNA-1_B23MHV2LT4_1_1																																				153.5bp	98.3%	291.4M												86.5%	53%	151bp	151bp	18%	373.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.7%	54%	151bp	151bp	18%	373.2M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.2%	54%	133bp	151bp	18%	296.4M	85.2%	54%	133bp	151bp	18%	296.4M
659_bIB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.3%	54%	133bp	151bp	9%	296.4M	85.3%	54%	133bp	151bp	9%	296.4M
659_bKP-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	565620644	0.9181	133.9bp	126.0bp	0.01%	1.33%	0.63%	0.00%	0.03%	3.76%	0.86%	0.00%	0.01	591932058	0.01%	0.60%	239523772	0.93%	0.96%	0.05%	0.04%	223093610	112443931	12792858	4789563	393.17	176.00	0.70%	0.58%	0.97	0.000	9999000000	220439499				59.9%	86.7%	94.6%	280.0M	37.1%	97.3%	72100.8Mb	591.9M	54.4%	98.7%	65.9%
659_bKP-T1-TRNA-1_B23MHV2LT4_1_1																																				133.9bp	97.4%	288.4M												83.6%	53%	151bp	151bp	18%	314.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.5%	54%	151bp	151bp	18%	314.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.3%	54%	125bp	132bp	18%	296.0M	83.3%	54%	125bp	132bp	18%	296.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.1%	54%	125bp	132bp	9%	296.0M	83.1%	54%	125bp	132bp	9%	296.0M
659_bMa-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	304590246	0.9484	114.9bp	110.0bp	0.01%	1.15%	0.49%	0.00%	0.03%	3.50%	0.74%	0.00%	4.75	323123520	0.01%	0.87%	41081533	0.78%	0.86%	0.14%	0.14%	31917795	16011739	5810347	2655133	44.64	15.00	0.35%	0.11%	0.97	0.000	9999000000	47925470				88.2%	81.9%	93.3%	150.8M	51.4%	97.0%	35799.0Mb	323.1M	57.5%	98.5%	81.0%
659_bMa-T1-TRNA-1_B23MHV2LT4_1_1																																				114.9bp	97.3%	157.2M												89.9%	55%	151bp	151bp	18%	164.1M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_2																																																		88.6%	56%	151bp	151bp	18%	164.1M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		90.0%	57%	114bp	112bp	9%	161.6M	90.0%	57%	114bp	112bp	9%	161.6M
659_bMa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		89.7%	57%	114bp	112bp	9%	161.6M	89.7%	57%	114bp	112bp	9%	161.6M
659_bNS-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	570213992	0.9380	137.1bp	126.0bp	0.02%	1.45%	0.57%	0.00%	0.04%	4.26%	0.85%	0.00%	5.92	590932886	0.01%	0.45%	322293685	0.94%	0.97%	0.05%	0.03%	303901814	153398161	15020949	4981889	581.30	287.00	0.77%	0.66%	0.97	0.000	9999000000	474984202				45.7%	89.6%	95.6%	282.3M	27.1%	97.0%	72197.8Mb	590.9M	54.7%	98.5%	59.8%
659_bNS-T1-TRNA-1_B23MHV2LT4_1_1																																				137.1bp	98.3%	290.5M												84.0%	53%	151bp	151bp	27%	398.4M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.5%	54%	151bp	151bp	18%	398.4M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.3%	54%	126bp	137bp	27%	295.5M	82.3%	54%	126bp	137bp	27%	295.5M
659_bNS-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.8%	55%	126bp	137bp	18%	295.5M	82.8%	55%	126bp	137bp	18%	295.5M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	567959375	0.9172	145.9bp	137.0bp	0.01%	1.53%	0.62%	0.00%	0.02%	4.61%	0.95%	0.00%	0.01	591911790	0.01%	0.55%	267623109	0.93%	0.97%	0.05%	0.03%	248856460	125759288	13302035	4555603	481.16	218.00	0.74%	0.62%	0.97	0.000	9999000000	268390510				55.3%	88.2%	95.0%	281.0M	36.0%	97.0%	75297.5Mb	591.9M	56.6%	98.7%	55.2%
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_1																																				145.9bp	97.9%	289.8M												86.4%	55%	151bp	151bp	18%	423.2M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.4%	56%	151bp	151bp	18%	423.2M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.8%	56%	131bp	142bp	18%	296.0M	83.8%	56%	131bp	142bp	18%	296.0M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.8%	56%	131bp	142bp	9%	296.0M	83.8%	56%	131bp	142bp	9%	296.0M
659_bR4-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	559127775	0.9147	135.8bp	125.0bp	0.01%	1.06%	0.56%	0.00%	0.01%	3.30%	0.80%	0.00%	6.02	581642334	0.01%	0.40%	347364543	0.93%	0.96%	0.06%	0.04%	324067234	163423144	19583253	7235467	603.49	361.00	0.81%	0.71%	0.97	0.000	9999000000	523947377				40.5%	88.0%	95.1%	276.5M	24.1%	96.9%	70484.0Mb	581.6M	54.9%	98.4%	61.2%
659_bR4-T1-TRNA-1_B23MHV2LT4_1_1																																				135.8bp	97.6%	283.8M												79.9%	53%	151bp	151bp	27%	295.5M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_2																																																		79.2%	54%	151bp	151bp	18%	295.5M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		80.1%	54%	125bp	132bp	18%	290.8M	80.1%	54%	125bp	132bp	18%	290.8M
659_bR4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		80.5%	55%	125bp	132bp	9%	290.8M	80.5%	55%	125bp	132bp	9%	290.8M
659_bTo-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	577970469	0.9258	143.7bp	131.0bp	0.01%	0.83%	0.77%	0.00%	0.02%	2.63%	1.13%	0.00%	0.01	592367586	0.00%	0.50%	294111318	0.95%	0.98%	0.04%	0.02%	279825009	141392178	11794080	3577473	550.32	206.00	0.71%	0.60%	0.97	0.000	9999000000	377731565				50.6%	92.7%	96.8%	286.6M	32.3%	97.3%	74009.7Mb	592.4M	55.1%	98.7%	56.9%
659_bTo-T1-TRNA-1_B23MHV2LT4_1_1																																				143.7bp	98.7%	292.3M												86.8%	54%	151bp	151bp	18%	343.1M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.7%	55%	151bp	151bp	18%	343.1M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.0%	54%	128bp	142bp	18%	296.2M	86.0%	54%	128bp	142bp	18%	296.2M
659_bTo-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.8%	55%	129bp	142bp	9%	296.2M	85.8%	55%	129bp	142bp	9%	296.2M
659_bTq-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	569598302	0.9535	146.6bp	129.0bp	0.03%	1.57%	0.58%	0.00%	0.08%	4.71%	0.87%	0.00%	0.02	591221520	0.01%	0.44%	330271462	0.94%	0.97%	0.05%	0.03%	309740610	156830583	16769237	5251770	623.95	291.00	0.76%	0.66%	0.97	0.000	9999000000	512868926				44.4%	88.7%	95.7%	282.8M	27.7%	97.1%	73433.3Mb	591.2M	52.9%	98.5%	53.4%
659_bTq-T1-TRNA-1_B23MHV2LT4_1_1																																				146.6bp	98.0%	289.6M												87.4%	52%	151bp	151bp	27%	554.7M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.8%	53%	151bp	151bp	18%	554.7M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.2%	52%	128bp	142bp	27%	295.6M	84.2%	52%	128bp	142bp	27%	295.6M
659_bTq-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.4%	53%	128bp	142bp	18%	295.6M	83.4%	53%	128bp	142bp	18%	295.6M
659_bUW-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	547688795	0.9296	142.2bp	128.0bp	0.03%	1.63%	0.64%	0.00%	0.06%	4.97%	0.99%	0.00%	0.00	591159996	0.01%	0.44%	333491962	0.95%	0.97%	0.04%	0.03%	316053800	159587480	13669662	4135657	633.21	248.00	0.71%	0.61%	0.97	0.000	9999000000	606053992				43.9%	80.3%	91.8%	271.2M	26.4%	97.0%	73181.0Mb	591.2M	54.0%	98.5%	56.0%
659_bUW-T1-TRNA-1_B23MHV2LT4_1_1																																				142.2bp	98.5%	291.3M												87.4%	53%	151bp	151bp	27%	771.7M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.6%	54%	151bp	151bp	18%	771.7M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.2%	53%	128bp	142bp	27%	295.6M	82.2%	53%	128bp	142bp	27%	295.6M
659_bUW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.8%	54%	128bp	142bp	9%	295.6M	82.8%	54%	128bp	142bp	9%	295.6M
659_bUs-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	576391900	0.9232	168.3bp	152.0bp	0.02%	1.76%	0.46%	0.00%	0.04%	5.33%	0.71%	0.00%	6.33	592285998	0.00%	0.41%	350578199	0.95%	0.98%	0.04%	0.02%	332529954	168713020	15404178	4249274	731.41	339.00	0.77%	0.67%	0.97	0.000	9999000000	572926786				41.0%	91.6%	96.4%	285.4M	29.1%	97.2%	78564.8Mb	592.3M	53.3%	98.7%	41.4%
659_bUs-T1-TRNA-1_B23MHV2LT4_1_1																																				168.3bp	98.4%	291.5M												87.9%	52%	151bp	151bp	18%	474.9M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.7%	53%	151bp	151bp	18%	474.9M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.4%	52%	136bp	151bp	18%	296.1M	85.4%	52%	136bp	151bp	18%	296.1M
659_bUs-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.1%	53%	136bp	151bp	9%	296.1M	85.1%	53%	136bp	151bp	9%	296.1M
659_bhK-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573969382	0.9323	139.6bp	128.0bp	0.01%	0.65%	0.40%	0.00%	0.03%	2.37%	0.71%	0.00%	5.80	590560028	0.01%	0.52%	281777818	0.94%	0.97%	0.05%	0.03%	264742682	133629311	13495551	4503451	514.36	231.00	0.74%	0.63%	0.97	0.000	9999000000	468261063				52.6%	91.2%	96.2%	284.2M	31.6%	97.0%	72616.5Mb	590.6M	55.5%	98.4%	57.7%
659_bhK-T1-TRNA-1_B23MHV2LT4_1_1																																				139.6bp	98.4%	290.4M												86.3%	54%	151bp	151bp	27%	504.7M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.3%	55%	151bp	151bp	18%	504.7M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.3%	55%	127bp	137bp	27%	295.3M	83.3%	55%	127bp	137bp	27%	295.3M
659_bhK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.5%	55%	127bp	137bp	18%	295.3M	83.5%	55%	127bp	137bp	18%	295.3M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	570422751	0.9408	133.5bp	123.0bp	0.02%	0.61%	0.48%	0.00%	0.04%	2.05%	0.75%	0.00%	5.83	591173518	0.01%	0.46%	319819884	0.94%	0.96%	0.05%	0.04%	299739552	151074733	16035857	5692883	561.49	284.00	0.77%	0.66%	0.97	0.000	9990000000	476023298				46.2%	89.3%	95.7%	282.8M	26.1%	96.9%	71208.4Mb	591.2M	54.4%	98.5%	62.7%
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_1																																				133.5bp	98.2%	290.3M												82.5%	53%	151bp	151bp	27%	355.2M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_2																																																		81.2%	54%	151bp	151bp	18%	355.2M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.5%	54%	124bp	132bp	18%	295.6M	81.5%	54%	124bp	132bp	18%	295.6M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.1%	54%	124bp	132bp	18%	295.6M	81.1%	54%	124bp	132bp	18%	295.6M
659_buD-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	571324665	0.9165	130.2bp	119.0bp	0.03%	1.17%	0.61%	0.00%	0.06%	3.53%	0.91%	0.00%	0.01	591474434	0.01%	0.43%	339248595	0.94%	0.97%	0.05%	0.03%	318956908	160775338	16431641	5798906	582.78	304.00	0.77%	0.67%	0.97	0.000	9999000000	526347461				42.9%	89.2%	95.5%	282.4M	23.6%	97.1%	70265.6Mb	591.5M	53.8%	98.6%	64.7%
659_buD-T1-TRNA-1_B23MHV2LT4_1_1																																				130.2bp	98.2%	290.3M												82.2%	52%	151bp	151bp	27%	404.9M
659_buD-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.1%	53%	151bp	151bp	18%	404.9M
659_buD-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		80.1%	53%	122bp	127bp	27%	295.7M	80.1%	53%	122bp	127bp	27%	295.7M
659_buD-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.0%	54%	122bp	127bp	18%	295.7M	81.0%	54%	122bp	127bp	18%	295.7M
659_bua-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	575633346	0.9480	134.6bp	125.0bp	0.01%	0.80%	0.60%	0.00%	0.02%	2.55%	0.88%	0.00%	0.01	592130070	0.00%	0.51%	290332565	0.94%	0.97%	0.05%	0.03%	273432581	138011964	13961666	4911418	507.46	196.00	0.69%	0.59%	0.97	0.000	9999000000	362255676				51.2%	91.4%	96.4%	285.3M	31.7%	97.2%	71888.6Mb	592.1M	54.2%	98.7%	62.7%
659_bua-T1-TRNA-1_B23MHV2LT4_1_1																																				134.6bp	98.3%	291.0M												86.7%	53%	151bp	151bp	18%	470.4M
659_bua-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.9%	54%	151bp	151bp	18%	470.4M
659_bua-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.9%	53%	125bp	132bp	18%	296.1M	83.9%	53%	125bp	132bp	18%	296.1M
659_bua-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.0%	54%	125bp	132bp	9%	296.1M	84.0%	54%	125bp	132bp	9%	296.1M
659_buj-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	7595	0.4444	96.8bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	78966	0.14%	0.69%	24798	0.02%	0.03%	0.53%	0.97%	420	212	13169	6266	0.00	0.00	0.00%	0.00%	0.92	0.000	9999000000	52902				79.9%	1.2%	7.3%	0.0M	38.4%	89.2%	3.7Mb	0.1M	69.6%	12.4%	55.0%
659_buj-T1-TRNA-1_B23MHV2LT4_1_1																																				96.8bp	5.3%	0.0M												94.6%	72%	151bp	151bp	45%	0.3M
659_buj-T1-TRNA-1_B23MHV2LT4_1_2																																																		87.4%	93%	151bp	151bp	55%	0.3M
659_buj-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		66.5%	67%	52bp	37bp	45%	0.0M	66.5%	67%	52bp	37bp	45%	0.0M
659_buj-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		67.6%	71%	54bp	37bp	45%	0.0M	67.6%	71%	54bp	37bp	45%	0.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1	Yes	0.28%	570376357	0.9073	139.8bp	128.0bp	0.03%	1.06%	0.47%	0.00%	0.06%	3.23%	0.70%	0.00%	0.11	591419316	0.01%	0.43%	334469192	0.94%	0.97%	0.05%	0.03%	314457959	158848041	16328799	5444629	609.93	305.00	0.75%	0.66%	0.97	0.000	9999000000	551228615				43.7%	88.6%	95.5%	282.4M	26.2%	97.1%	72684.9Mb	591.4M	53.9%	98.6%	57.5%
659_c95-T1-TRNA-1_B23MHV2LT4_1_1																																				139.8bp	97.9%	289.6M												84.4%	52%	151bp	151bp	27%	450.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.7%	53%	151bp	151bp	18%	450.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.9%	53%	127bp	137bp	27%	295.7M	81.9%	53%	127bp	137bp	27%	295.7M
659_c95-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.2%	54%	127bp	137bp	18%	295.7M	82.2%	54%	127bp	137bp	18%	295.7M
659_cAa-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	6022	0.4429	109.9bp	91.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	41874	0.29%	0.50%	20838	0.02%	0.06%	0.39%	0.94%	515	258	8123	3858	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	26431				70.9%	2.5%	12.7%	0.0M	78.5%	92.0%	2.6Mb	0.0M	69.9%	6.3%	52.0%
659_cAa-T1-TRNA-1_B23MHV2LT4_1_1																																				109.9bp	9.6%	0.0M												96.4%	73%	151bp	151bp	55%	0.3M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_2																																																		92.1%	96%	151bp	151bp	55%	0.3M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		56.1%	66%	66bp	37bp	45%	0.0M	56.1%	66%	66bp	37bp	45%	0.0M
659_cAa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		58.2%	73%	68bp	37bp	55%	0.0M	58.2%	73%	68bp	37bp	55%	0.0M
659_cAd-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	562368663	0.9192	125.9bp	119.0bp	0.02%	1.21%	0.76%	0.00%	0.04%	3.65%	1.10%	0.00%	0.01	584760110	0.01%	0.58%	248129618	0.93%	0.96%	0.05%	0.04%	230752663	116194401	13134930	5027991	395.31	166.00	0.71%	0.58%	0.97	0.000	9999000000	237685914				58.0%	88.2%	95.3%	278.6M	34.3%	97.2%	68710.5Mb	584.8M	55.0%	98.7%	71.1%
659_cAd-T1-TRNA-1_B23MHV2LT4_1_1																																				125.9bp	98.2%	287.1M												84.5%	54%	151bp	151bp	18%	296.2M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.1%	54%	151bp	151bp	18%	296.2M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.6%	54%	121bp	122bp	9%	292.4M	84.6%	54%	121bp	122bp	9%	292.4M
659_cAd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.0%	55%	121bp	122bp	9%	292.4M	84.0%	55%	121bp	122bp	9%	292.4M
659_cB6-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	560051709	0.9399	158.3bp	143.0bp	0.01%	0.42%	0.20%	0.00%	0.02%	1.53%	0.37%	0.00%	5.95	589016434	0.01%	0.89%	64580434	0.82%	0.90%	0.12%	0.10%	52985153	26801167	7724358	2995275	104.36	44.00	0.58%	0.30%	0.97	0.000	9999000000	62703850				89.6%	84.0%	94.3%	277.7M	65.7%	96.8%	76035.1Mb	589.0M	58.2%	98.2%	45.9%
659_cB6-T1-TRNA-1_B23MHV2LT4_1_1																																				158.3bp	97.4%	286.9M												91.9%	56%	151bp	151bp	36%	302.6M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_2																																																		89.2%	58%	151bp	151bp	18%	302.6M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		92.1%	57%	133bp	151bp	18%	294.5M	92.1%	57%	133bp	151bp	18%	294.5M
659_cB6-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		90.8%	58%	133bp	151bp	9%	294.5M	90.8%	58%	133bp	151bp	9%	294.5M
659_cGW-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	179701138	0.9513	134.1bp	126.0bp	0.00%	1.62%	0.55%	0.00%	0.00%	5.16%	0.99%	0.00%	3.38	188870482	0.01%	0.83%	31573576	0.86%	0.92%	0.09%	0.08%	27241088	13687927	2822496	1182131	45.71	12.00	0.33%	0.11%	0.97	0.000	9999000000	35753944				84.0%	83.7%	94.0%	88.8M	55.7%	96.8%	22923.1Mb	188.9M	60.3%	98.2%	65.3%
659_cGW-T1-TRNA-1_B23MHV2LT4_1_1																																				134.1bp	97.6%	92.1M												88.3%	58%	151bp	151bp	18%	96.2M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.7%	59%	151bp	151bp	18%	96.2M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		88.4%	60%	125bp	132bp	9%	94.4M	88.4%	60%	125bp	132bp	9%	94.4M
659_cGW-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		87.9%	60%	125bp	132bp	9%	94.4M	87.9%	60%	125bp	132bp	9%	94.4M
659_cIX-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	577328886	0.9663	143.2bp	132.0bp	0.01%	1.08%	0.61%	0.00%	0.02%	3.53%	0.91%	0.00%	0.01	592555218	0.00%	0.49%	301060478	0.94%	0.97%	0.05%	0.03%	284151229	143549244	14130423	4776821	550.59	231.00	0.72%	0.62%	0.97	0.000	9999000000	379900997				49.4%	91.8%	96.6%	286.1M	30.3%	97.2%	73879.8Mb	592.6M	54.3%	98.8%	57.8%
659_cIX-T1-TRNA-1_B23MHV2LT4_1_1																																				143.2bp	98.3%	291.4M												87.0%	53%	151bp	151bp	18%	439.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.0%	54%	151bp	151bp	18%	439.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.6%	54%	128bp	137bp	18%	296.3M	84.6%	54%	128bp	137bp	18%	296.3M
659_cIX-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.5%	54%	128bp	137bp	9%	296.3M	84.5%	54%	128bp	137bp	9%	296.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	362139225	0.9427	120.7bp	115.0bp	0.02%	1.12%	0.65%	0.00%	0.04%	3.62%	0.97%	0.00%	6.08	374062200	0.01%	0.65%	132336934	0.93%	0.95%	0.06%	0.05%	122550328	61627605	7551277	3045126	198.20	86.00	0.66%	0.47%	0.97	0.000	9999000000	116209919				65.0%	89.6%	95.9%	179.3M	38.4%	97.3%	43173.3Mb	374.1M	54.7%	98.8%	75.4%
659_cRB-T1-TRNA-1_B23MHV2LT4_1_1																																				120.7bp	98.4%	184.0M												83.5%	53%	151bp	151bp	18%	189.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.0%	54%	151bp	151bp	27%	189.3M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.6%	54%	119bp	122bp	9%	187.0M	83.6%	54%	119bp	122bp	9%	187.0M
659_cRB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.9%	54%	119bp	122bp	9%	187.0M	82.9%	54%	119bp	122bp	9%	187.0M
659_cRa-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	572736110	0.9422	132.6bp	120.0bp	0.01%	0.88%	0.54%	0.00%	0.03%	3.05%	0.87%	0.00%	0.02	590692572	0.01%	0.50%	292873212	0.94%	0.97%	0.05%	0.03%	275334178	138813135	13911383	4797310	522.95	258.00	0.75%	0.65%	0.97	0.000	9999000000	431801876				50.7%	90.6%	96.0%	283.6M	29.8%	97.0%	71064.8Mb	590.7M	55.6%	98.4%	61.4%
659_cRa-T1-TRNA-1_B23MHV2LT4_1_1																																				132.6bp	98.3%	290.4M												87.3%	54%	151bp	151bp	27%	535.5M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.3%	55%	151bp	151bp	18%	535.5M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.0%	55%	124bp	132bp	36%	295.3M	84.0%	55%	124bp	132bp	36%	295.3M
659_cRa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.2%	55%	124bp	132bp	27%	295.3M	84.2%	55%	124bp	132bp	27%	295.3M
659_cTi-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	570049839	0.9537	131.4bp	119.0bp	0.02%	0.96%	0.52%	0.00%	0.04%	2.90%	0.79%	0.00%	0.01	590653212	0.01%	0.45%	326348503	0.94%	0.97%	0.04%	0.03%	307963946	155230017	14612263	4960487	570.50	302.00	0.79%	0.68%	0.97	0.000	9999000000	491592590				45.0%	89.3%	95.5%	281.9M	24.8%	96.8%	70151.1Mb	590.7M	54.3%	98.4%	63.5%
659_cTi-T1-TRNA-1_B23MHV2LT4_1_1																																				131.4bp	98.2%	290.0M												84.5%	53%	151bp	151bp	27%	475.6M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.2%	54%	151bp	151bp	18%	475.6M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.5%	54%	123bp	127bp	27%	295.3M	81.5%	54%	123bp	127bp	27%	295.3M
659_cTi-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.5%	54%	123bp	132bp	18%	295.3M	82.5%	54%	123bp	132bp	18%	295.3M
659_cVw-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	568613077	0.9505	162.3bp	149.0bp	0.01%	1.29%	0.53%	0.00%	0.03%	4.11%	0.84%	0.00%	5.13	592465090	0.01%	0.43%	340423454	0.94%	0.97%	0.05%	0.03%	320781889	162522288	15726565	4787190	684.20	325.00	0.76%	0.66%	0.97	0.000	9999000000	489776502				42.8%	88.4%	95.2%	282.0M	29.9%	97.1%	77886.2Mb	592.5M	55.3%	98.7%	45.0%
659_cVw-T1-TRNA-1_B23MHV2LT4_1_1																																				162.3bp	98.1%	290.7M												88.1%	54%	151bp	151bp	18%	495.8M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_2																																																		87.1%	55%	151bp	151bp	18%	495.8M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.1%	55%	135bp	151bp	18%	296.2M	85.1%	55%	135bp	151bp	18%	296.2M
659_cVw-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.0%	55%	135bp	151bp	9%	296.2M	85.0%	55%	135bp	151bp	9%	296.2M
659_cWx-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	567597517	0.9491	146.6bp	135.0bp	0.01%	1.33%	0.53%	0.00%	0.03%	4.06%	0.85%	0.00%	0.00	591440224	0.01%	0.52%	283115354	0.93%	0.96%	0.05%	0.04%	264159621	133629029	15172448	5197629	511.77	200.00	0.73%	0.61%	0.97	0.000	9999000000	301614044				52.5%	87.4%	95.0%	281.1M	34.6%	97.0%	74864.4Mb	591.4M	59.2%	98.6%	54.8%
659_cWx-T1-TRNA-1_B23MHV2LT4_1_1																																				146.6bp	97.6%	288.6M												86.6%	58%	151bp	151bp	18%	363.3M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.6%	58%	151bp	151bp	18%	363.3M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.4%	58%	130bp	142bp	18%	295.7M	85.4%	58%	130bp	142bp	18%	295.7M
659_cWx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.4%	59%	131bp	142bp	9%	295.7M	85.4%	59%	131bp	142bp	9%	295.7M
659_cYf-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	565598240	0.8234	123.8bp	116.0bp	0.00%	1.72%	0.49%	0.00%	0.01%	5.24%	0.80%	0.00%	0.02	589130454	0.01%	0.56%	260210466	0.93%	0.95%	0.06%	0.05%	241317738	121220474	15462371	6104248	412.26	124.00	0.68%	0.53%	0.97	0.000	9990000000	270772170				56.2%	87.3%	94.9%	279.5M	30.6%	96.7%	68038.9Mb	589.1M	59.7%	98.2%	70.7%
659_cYf-T1-TRNA-1_B23MHV2LT4_1_1																																				123.8bp	98.1%	288.9M												85.4%	57%	151bp	151bp	27%	436.9M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.3%	58%	151bp	151bp	27%	436.9M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.9%	59%	119bp	122bp	27%	294.6M	82.9%	59%	119bp	122bp	27%	294.6M
659_cYf-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.3%	59%	120bp	122bp	18%	294.6M	83.3%	59%	120bp	122bp	18%	294.6M
659_cfy-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573188274	0.9423	135.8bp	124.0bp	0.04%	1.02%	0.67%	0.00%	0.09%	2.98%	0.94%	0.00%	0.01	590638862	0.00%	0.45%	326582048	0.95%	0.97%	0.05%	0.03%	309113207	155910553	14722451	4862809	587.40	263.00	0.73%	0.63%	0.97	0.000	9999000000	481884076				44.9%	90.7%	96.1%	283.8M	26.1%	96.9%	71594.5Mb	590.6M	55.1%	98.4%	60.8%
659_cfy-T1-TRNA-1_B23MHV2LT4_1_1																																				135.8bp	98.3%	290.4M												85.2%	54%	151bp	151bp	27%	448.4M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.2%	54%	151bp	151bp	18%	448.4M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.7%	54%	125bp	132bp	27%	295.3M	82.7%	54%	125bp	132bp	27%	295.3M
659_cfy-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.9%	55%	125bp	132bp	18%	295.3M	82.9%	55%	125bp	132bp	18%	295.3M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	569427462	0.9019	142.7bp	129.0bp	0.01%	0.91%	0.44%	0.00%	0.03%	2.74%	0.67%	0.00%	0.01	590367902	0.01%	0.41%	349952011	0.94%	0.97%	0.05%	0.03%	328375997	166010986	17660535	5798044	639.22	324.00	0.79%	0.68%	0.97	0.000	9999000000	555512314				41.0%	89.0%	95.4%	281.7M	24.3%	96.9%	72939.8Mb	590.4M	56.3%	98.4%	56.1%
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_1																																				142.7bp	97.7%	288.4M												82.8%	55%	151bp	151bp	27%	392.5M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.2%	55%	151bp	151bp	18%	392.5M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.0%	56%	127bp	142bp	27%	295.2M	81.0%	56%	127bp	142bp	27%	295.2M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.6%	56%	128bp	142bp	18%	295.2M	81.6%	56%	128bp	142bp	18%	295.2M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	541376691	0.9263	127.8bp	121.0bp	0.02%	1.94%	0.68%	0.00%	0.03%	5.54%	0.97%	0.00%	4.39	563329290	0.01%	0.68%	182154846	0.92%	0.95%	0.06%	0.05%	167845409	84511066	10907281	4295640	278.26	116.00	0.68%	0.53%	0.97	0.000	9999000000	145087037				68.1%	88.1%	95.2%	268.1M	43.4%	97.2%	67114.7Mb	563.3M	53.3%	98.8%	71.1%
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_1																																				127.8bp	98.3%	276.8M												86.1%	52%	151bp	151bp	18%	285.1M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.6%	53%	151bp	151bp	27%	285.1M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.2%	53%	122bp	127bp	9%	281.7M	86.2%	53%	122bp	127bp	9%	281.7M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.5%	53%	123bp	127bp	9%	281.7M	85.5%	53%	123bp	127bp	9%	281.7M
659_cq5-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	6627	0.4635	74.8bp	32.0bp	0.00%	0.24%	0.00%	0.00%	0.00%	0.61%	0.00%	0.00%	0.00	68426	0.16%	0.65%	23863	0.02%	0.04%	0.53%	0.96%	491	231	12555	5979	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	43717				77.4%	1.3%	8.3%	0.0M	48.0%	89.8%	3.1Mb	0.1M	70.5%	11.7%	54.8%
659_cq5-T1-TRNA-1_B23MHV2LT4_1_1																																				74.8bp	4.8%	0.0M												94.3%	74%	151bp	151bp	55%	0.3M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_2																																																		90.6%	94%	151bp	151bp	55%	0.3M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		61.6%	68%	49bp	37bp	45%	0.0M	61.6%	68%	49bp	37bp	45%	0.0M
659_cq5-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		64.5%	72%	51bp	37bp	45%	0.0M	64.5%	72%	51bp	37bp	45%	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	4770	0.4395	60.3bp	31.0bp	0.00%	0.51%	0.00%	0.00%	0.00%	1.64%	0.00%	0.00%	0.00	44638	0.17%	0.62%	16749	0.02%	0.04%	0.52%	0.96%	314	155	8630	4096	0.00	0.00	0.00%	0.00%	0.90	0.000	9999000000	37318				75.7%	1.4%	8.6%	0.0M	54.0%	88.3%	2.3Mb	0.0M	68.5%	11.6%	54.4%
659_cuO-T1-TRNA-1_B23MHV2LT4_1_1																																				60.3bp	8.0%	0.0M												94.2%	74%	151bp	151bp	64%	0.2M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_2																																																		90.5%	94%	151bp	151bp	55%	0.2M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		62.1%	66%	58bp	37bp	45%	0.0M	62.1%	66%	58bp	37bp	45%	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		63.6%	70%	60bp	37bp	45%	0.0M	63.6%	70%	60bp	37bp	45%	0.0M
659_cwv-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	570369145	0.9569	135.9bp	123.0bp	0.04%	1.79%	0.71%	0.00%	0.08%	5.04%	1.03%	0.00%	0.01	591618360	0.01%	0.43%	339729081	0.95%	0.97%	0.04%	0.03%	321728618	162321009	14872321	4835368	620.40	268.00	0.74%	0.63%	0.97	0.000	9999000000	625631690				42.8%	89.0%	95.7%	282.9M	23.7%	97.1%	71588.8Mb	591.6M	55.6%	98.6%	59.8%
659_cwv-T1-TRNA-1_B23MHV2LT4_1_1																																				135.9bp	98.2%	290.6M												85.7%	54%	151bp	151bp	27%	542.4M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.1%	55%	151bp	151bp	18%	542.4M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.4%	55%	125bp	132bp	27%	295.8M	82.4%	55%	125bp	132bp	27%	295.8M
659_cwv-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.8%	55%	125bp	137bp	18%	295.8M	82.8%	55%	125bp	137bp	18%	295.8M
659_d01-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	567993452	0.9192	125.6bp	116.0bp	0.01%	1.07%	0.43%	0.00%	0.02%	3.29%	0.66%	0.00%	0.01	590369440	0.01%	0.47%	314739608	0.93%	0.96%	0.06%	0.04%	293504563	147756088	17565272	6670599	506.18	278.00	0.77%	0.66%	0.97	0.000	9999000000	390107868				47.0%	88.3%	95.4%	281.5M	24.6%	97.0%	68433.4Mb	590.4M	54.6%	98.4%	69.1%
659_d01-T1-TRNA-1_B23MHV2LT4_1_1																																				125.6bp	97.7%	288.5M												80.3%	53%	151bp	151bp	27%	341.4M
659_d01-T1-TRNA-1_B23MHV2LT4_1_2																																																		78.9%	54%	151bp	151bp	18%	341.4M
659_d01-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		79.4%	54%	119bp	122bp	18%	295.2M	79.4%	54%	119bp	122bp	18%	295.2M
659_d01-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		79.0%	54%	120bp	122bp	18%	295.2M	79.0%	54%	120bp	122bp	18%	295.2M
659_d0M-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	8734	0.4644	89.8bp	37.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	78386	0.21%	0.60%	31354	0.02%	0.04%	0.45%	0.96%	577	277	14048	6664	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	54472				76.3%	1.6%	9.3%	0.0M	75.1%	91.5%	4.0Mb	0.1M	70.0%	9.9%	53.7%
659_d0M-T1-TRNA-1_B23MHV2LT4_1_1																																				89.8bp	5.3%	0.0M												95.3%	73%	151bp	151bp	55%	0.4M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_2																																																		91.1%	95%	151bp	151bp	55%	0.4M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		62.0%	66%	55bp	37bp	45%	0.0M	62.0%	66%	55bp	37bp	45%	0.0M
659_d0M-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		63.7%	72%	57bp	37bp	45%	0.0M	63.7%	72%	57bp	37bp	45%	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	9755	0.4562	72.7bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	89564	0.16%	0.65%	31265	0.02%	0.03%	0.52%	0.97%	590	272	16279	7747	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	54314				77.6%	1.5%	9.2%	0.0M	54.7%	90.4%	4.0Mb	0.1M	70.6%	12.2%	55.0%
659_d0V-T1-TRNA-1_B23MHV2LT4_1_1																																				72.7bp	4.4%	0.0M												94.6%	72%	151bp	151bp	55%	0.4M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_2																																																		91.4%	95%	151bp	151bp	55%	0.4M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		64.3%	67%	48bp	37bp	45%	0.0M	64.3%	67%	48bp	37bp	45%	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		66.0%	73%	51bp	37bp	45%	0.0M	66.0%	73%	51bp	37bp	45%	0.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1	Yes	0.01%	567167264	0.9069	126.4bp	117.0bp	0.03%	1.35%	0.41%	0.00%	0.06%	4.00%	0.66%	0.00%	0.02	591367314	0.01%	0.44%	332161845	0.93%	0.96%	0.05%	0.04%	310245244	156162695	17809072	6750750	550.80	277.00	0.76%	0.65%	0.97	0.000	9999000000	499627174				44.1%	87.4%	95.0%	280.7M	23.7%	96.9%	68999.6Mb	591.4M	53.1%	98.6%	68.4%
659_dES-T1-TRNA-1_B23MHV2LT4_1_1																																				126.4bp	98.1%	290.0M												81.5%	52%	151bp	151bp	27%	313.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1_2																																																		80.9%	52%	151bp	151bp	18%	313.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.3%	52%	120bp	122bp	18%	295.7M	81.3%	52%	120bp	122bp	18%	295.7M
659_dES-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.7%	53%	120bp	127bp	9%	295.7M	81.7%	53%	120bp	127bp	9%	295.7M
659_dHy-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	573078892	0.9157	151.7bp	141.0bp	0.01%	0.92%	0.43%	0.00%	0.02%	3.00%	0.71%	0.00%	0.05	592491334	0.01%	0.43%	336828902	0.94%	0.97%	0.05%	0.03%	316232497	160084200	16568552	5427691	642.88	342.00	0.77%	0.68%	0.97	0.000	9999000000	489983683				43.4%	89.7%	95.8%	283.9M	29.4%	97.2%	76500.4Mb	592.5M	54.3%	98.7%	50.5%
659_dHy-T1-TRNA-1_B23MHV2LT4_1_1																																				151.7bp	97.9%	289.9M												83.9%	53%	151bp	151bp	18%	349.6M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.2%	54%	151bp	151bp	18%	349.6M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.9%	54%	133bp	147bp	18%	296.2M	82.9%	54%	133bp	147bp	18%	296.2M
659_dHy-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.1%	54%	133bp	151bp	9%	296.2M	83.1%	54%	133bp	151bp	9%	296.2M
659_dKM-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573651539	0.9168	135.7bp	126.0bp	0.03%	2.34%	0.70%	0.00%	0.05%	6.20%	0.97%	0.00%	0.01	592124676	0.00%	0.52%	286786750	0.94%	0.97%	0.05%	0.03%	269769038	136312238	14224182	4891657	497.81	214.00	0.70%	0.60%	0.97	0.000	9999000000	317763893				51.8%	89.7%	95.8%	283.8M	32.3%	97.3%	72566.4Mb	592.1M	53.2%	98.7%	62.6%
659_dKM-T1-TRNA-1_B23MHV2LT4_1_1																																				135.7bp	98.3%	290.9M												85.0%	53%	151bp	151bp	27%	328.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.8%	53%	151bp	151bp	18%	328.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.4%	52%	126bp	132bp	27%	296.1M	84.4%	52%	126bp	132bp	27%	296.1M
659_dKM-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.2%	53%	126bp	132bp	9%	296.1M	84.2%	53%	126bp	132bp	9%	296.1M
659_dQk-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	5341	0.4216	89.4bp	91.0bp	0.00%	0.22%	0.00%	0.00%	0.00%	0.68%	0.00%	0.00%	0.00	73070	0.40%	0.43%	41653	0.01%	0.03%	0.29%	0.97%	333	164	12082	5782	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	49210				71.7%	1.2%	5.5%	0.0M	45.7%	92.2%	5.1Mb	0.1M	63.5%	10.3%	53.4%
659_dQk-T1-TRNA-1_B23MHV2LT4_1_1																																				89.4bp	3.8%	0.0M												95.4%	72%	151bp	151bp	64%	0.4M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_2																																																		92.2%	94%	151bp	151bp	55%	0.4M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		64.3%	61%	74bp	47bp	45%	0.0M	64.3%	61%	74bp	47bp	45%	0.0M
659_dQk-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		65.6%	65%	76bp	57bp	45%	0.0M	65.6%	65%	76bp	57bp	45%	0.0M
659_dRe-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	522309803	0.9400	147.4bp	136.0bp	0.02%	1.85%	0.45%	0.00%	0.04%	5.79%	0.74%	0.00%	0.01	543605460	0.01%	0.47%	286383252	0.94%	0.97%	0.05%	0.03%	269648872	136452273	13768685	4487084	543.37	234.00	0.75%	0.63%	0.97	0.000	9999000000	430660614				47.6%	88.9%	95.3%	259.2M	30.8%	97.2%	68869.2Mb	543.6M	54.7%	98.8%	54.2%
659_dRe-T1-TRNA-1_B23MHV2LT4_1_1																																				147.4bp	98.3%	267.1M												84.5%	53%	151bp	151bp	18%	275.1M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.3%	54%	151bp	151bp	18%	275.1M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.6%	54%	130bp	142bp	18%	271.8M	84.6%	54%	130bp	142bp	18%	271.8M
659_dRe-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.2%	54%	130bp	142bp	18%	271.8M	84.2%	54%	130bp	142bp	18%	271.8M
659_dXa-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	564852219	0.9002	130.1bp	118.0bp	0.00%	0.82%	0.33%	0.00%	0.01%	2.63%	0.55%	0.00%	5.94	588966436	0.01%	0.85%	90470685	0.86%	0.91%	0.10%	0.09%	77702099	39106676	9152130	3730746	129.55	40.00	0.55%	0.32%	0.97	0.000	9999000000	80301499				85.2%	86.8%	95.0%	279.9M	53.0%	96.7%	69110.0Mb	589.0M	60.4%	98.2%	65.0%
659_dXa-T1-TRNA-1_B23MHV2LT4_1_1																																				130.1bp	98.0%	288.6M												91.4%	58%	151bp	151bp	27%	360.3M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_2																																																		89.0%	59%	151bp	151bp	18%	360.3M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		90.7%	60%	121bp	127bp	18%	294.5M	90.7%	60%	121bp	127bp	18%	294.5M
659_dXa-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		89.7%	60%	121bp	127bp	18%	294.5M	89.7%	60%	121bp	127bp	18%	294.5M
659_dc8-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	570876761	0.9556	145.1bp	133.0bp	0.03%	1.78%	0.54%	0.00%	0.06%	5.24%	0.82%	0.00%	5.00	591885582	0.01%	0.50%	296851306	0.94%	0.96%	0.05%	0.04%	278266592	140782894	15270988	5144184	541.42	279.00	0.76%	0.65%	0.97	0.000	9999000000	328988219				50.1%	89.3%	95.6%	282.9M	33.3%	97.2%	74649.8Mb	591.9M	54.8%	98.6%	55.3%
659_dc8-T1-TRNA-1_B23MHV2LT4_1_1																																				145.1bp	97.8%	289.5M												88.1%	53%	151bp	151bp	18%	473.8M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.8%	54%	151bp	151bp	18%	473.8M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.3%	54%	130bp	142bp	18%	295.9M	85.3%	54%	130bp	142bp	18%	295.9M
659_dc8-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.8%	55%	130bp	142bp	9%	295.9M	84.8%	55%	130bp	142bp	9%	295.9M
659_dcz-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	304616329	0.8978	110.3bp	107.0bp	0.01%	1.22%	0.29%	0.00%	0.03%	3.64%	0.48%	0.00%	6.09	320533036	0.01%	0.82%	57894998	0.82%	0.87%	0.13%	0.13%	47333232	23720151	7604199	3514690	64.15	25.00	0.47%	0.18%	0.97	0.000	9999000000	62363610				82.7%	84.3%	94.0%	150.7M	45.0%	97.3%	34322.9Mb	320.5M	55.1%	98.6%	85.4%
659_dcz-T1-TRNA-1_B23MHV2LT4_1_1																																				110.3bp	97.1%	155.7M												86.0%	54%	151bp	151bp	18%	162.6M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.7%	54%	151bp	151bp	27%	162.6M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.1%	54%	110bp	107bp	9%	160.3M	86.1%	54%	110bp	107bp	9%	160.3M
659_dcz-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.7%	55%	110bp	112bp	9%	160.3M	85.7%	55%	110bp	112bp	9%	160.3M
659_dfA-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573763722	0.9380	152.2bp	136.0bp	0.03%	1.09%	0.39%	0.00%	0.07%	3.27%	0.61%	0.00%	6.30	592143200	0.01%	0.37%	370160633	0.95%	0.97%	0.05%	0.03%	349866469	176877213	17203303	5365417	722.76	354.00	0.78%	0.68%	0.97	0.000	9999000000	709559715				37.7%	90.1%	95.9%	283.8M	23.1%	97.2%	74966.3Mb	592.1M	53.6%	98.7%	50.1%
659_dfA-T1-TRNA-1_B23MHV2LT4_1_1																																				152.2bp	98.2%	290.9M												85.0%	52%	151bp	151bp	27%	508.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.0%	53%	151bp	151bp	18%	508.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.9%	53%	130bp	151bp	27%	296.1M	81.9%	53%	130bp	151bp	27%	296.1M
659_dfA-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.0%	53%	130bp	151bp	18%	296.1M	83.0%	53%	130bp	151bp	18%	296.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573163363	0.8974	128.5bp	120.0bp	0.03%	1.89%	0.61%	0.00%	0.06%	5.52%	0.91%	0.00%	0.02	593390308	0.01%	0.59%	242027758	0.93%	0.96%	0.06%	0.04%	224887212	113300504	13549593	5243697	389.81	166.00	0.70%	0.58%	0.97	0.000	9999000000	227193125				59.6%	89.5%	95.8%	284.3M	35.3%	97.4%	70419.4Mb	593.4M	53.2%	98.9%	70.1%
659_djb-T1-TRNA-1_B23MHV2LT4_1_1																																				128.5bp	98.3%	291.6M												85.2%	52%	151bp	151bp	27%	321.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.2%	53%	151bp	151bp	27%	321.1M
659_djb-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.8%	53%	122bp	127bp	27%	296.7M	84.8%	53%	122bp	127bp	27%	296.7M
659_djb-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.5%	53%	122bp	127bp	9%	296.7M	84.5%	53%	122bp	127bp	9%	296.7M
659_dkd-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	5413	0.4799	96.1bp	88.0bp	0.00%	0.00%	0.15%	0.00%	0.00%	0.00%	0.39%	0.00%	0.00	56056	0.13%	0.68%	17726	0.02%	0.04%	0.58%	0.96%	432	218	10199	4853	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	34773				78.3%	1.3%	8.3%	0.0M	42.5%	91.5%	2.4Mb	0.1M	72.1%	15.2%	56.5%
659_dkd-T1-TRNA-1_B23MHV2LT4_1_1																																				96.1bp	4.9%	0.0M												93.0%	75%	151bp	151bp	55%	0.2M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_2																																																		90.8%	94%	151bp	151bp	55%	0.2M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		62.8%	70%	45bp	37bp	45%	0.0M	62.8%	70%	45bp	37bp	45%	0.0M
659_dkd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		63.8%	74%	48bp	37bp	45%	0.0M	63.8%	74%	48bp	37bp	45%	0.0M
659_dm4-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	360696957	0.9224	116.7bp	111.0bp	0.02%	1.26%	0.30%	0.00%	0.04%	3.76%	0.48%	0.00%	6.14	378162192	0.01%	0.77%	86003193	0.87%	0.91%	0.10%	0.09%	74651176	37468723	8565191	3839345	108.86	44.00	0.57%	0.31%	0.97	0.000	9999000000	87835397				77.8%	85.7%	94.5%	178.7M	45.3%	97.3%	42172.3Mb	378.2M	54.7%	98.8%	80.2%
659_dm4-T1-TRNA-1_B23MHV2LT4_1_1																																				116.7bp	97.5%	184.3M												85.5%	53%	151bp	151bp	18%	191.5M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.0%	54%	151bp	151bp	27%	191.5M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.5%	54%	115bp	117bp	9%	189.1M	85.5%	54%	115bp	117bp	9%	189.1M
659_dm4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.9%	54%	115bp	117bp	9%	189.1M	84.9%	54%	115bp	117bp	9%	189.1M
659_dts-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	566559778	0.9115	122.2bp	112.0bp	0.01%	0.92%	0.47%	0.00%	0.02%	2.77%	0.72%	0.00%	5.99	590550610	0.01%	0.47%	310810378	0.94%	0.96%	0.05%	0.04%	290891095	146324357	15591914	5800629	494.58	265.00	0.77%	0.66%	0.97	0.000	9999000000	395892902				47.7%	87.4%	94.9%	280.3M	24.9%	96.9%	67182.0Mb	590.6M	55.2%	98.4%	72.3%
659_dts-T1-TRNA-1_B23MHV2LT4_1_1																																				122.2bp	98.1%	289.7M												81.9%	54%	151bp	151bp	27%	351.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_2																																																		80.6%	55%	151bp	151bp	18%	351.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		80.8%	54%	117bp	117bp	18%	295.3M	80.8%	54%	117bp	117bp	18%	295.3M
659_dts-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		80.7%	55%	118bp	117bp	18%	295.3M	80.7%	55%	118bp	117bp	18%	295.3M
659_dwi-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	15296	0.4646	67.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	163198	0.16%	0.69%	50760	0.02%	0.04%	0.47%	0.96%	971	463	23867	11341	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	77803				81.9%	1.3%	8.0%	0.0M	73.7%	92.5%	6.9Mb	0.2M	71.0%	15.0%	56.4%
659_dwi-T1-TRNA-1_B23MHV2LT4_1_1																																				67.9bp	2.7%	0.0M												94.2%	72%	151bp	151bp	55%	0.5M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_2																																																		90.7%	94%	151bp	151bp	55%	0.5M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		67.4%	68%	45bp	37bp	45%	0.1M	67.4%	68%	45bp	37bp	45%	0.1M
659_dwi-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		68.8%	73%	47bp	37bp	45%	0.1M	68.8%	73%	47bp	37bp	45%	0.1M
659_e0S-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	3198	0.4647	73.0bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	24444	0.33%	0.45%	13503	0.01%	0.04%	0.39%	0.96%	197	103	5252	2525	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	20703				66.8%	2.2%	10.1%	0.0M	56.8%	89.4%	1.7Mb	0.0M	68.4%	5.2%	51.4%
659_e0S-T1-TRNA-1_B23MHV2LT4_1_1																																				73.0bp	9.7%	0.0M												96.7%	74%	151bp	151bp	55%	0.2M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_2																																																		93.9%	97%	151bp	151bp	55%	0.2M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		55.8%	65%	75bp	42bp	55%	0.0M	55.8%	65%	75bp	42bp	55%	0.0M
659_e0S-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		58.1%	71%	77bp	42bp	55%	0.0M	58.1%	71%	77bp	42bp	55%	0.0M
659_eGK-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	573396572	0.9406	145.2bp	132.0bp	0.02%	1.62%	0.47%	0.00%	0.05%	4.98%	0.73%	0.00%	0.01	591869786	0.00%	0.41%	352153340	0.94%	0.97%	0.05%	0.03%	331855331	167654216	17518401	5862403	664.87	341.00	0.76%	0.67%	0.97	0.000	9999000000	603967282				40.7%	90.3%	96.0%	284.0M	25.3%	97.1%	74262.5Mb	591.9M	53.6%	98.6%	53.1%
659_eGK-T1-TRNA-1_B23MHV2LT4_1_1																																				145.2bp	97.9%	289.9M												84.3%	53%	151bp	151bp	27%	421.6M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.5%	53%	151bp	151bp	18%	421.6M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.3%	53%	129bp	147bp	27%	295.9M	82.3%	53%	129bp	147bp	27%	295.9M
659_eGK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.3%	53%	129bp	147bp	18%	295.9M	82.3%	53%	129bp	147bp	18%	295.9M
659_eHw-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	575015343	0.9109	144.8bp	135.0bp	0.00%	0.57%	0.71%	0.00%	0.01%	2.00%	1.15%	0.00%	0.01	591289140	0.01%	0.60%	237053789	0.94%	0.97%	0.05%	0.03%	222967340	112502034	11017756	3771070	431.54	124.00	0.70%	0.54%	0.97	0.000	9999000000	236054701				60.2%	90.5%	96.2%	284.3M	42.8%	97.0%	74934.0Mb	591.3M	60.6%	98.5%	56.2%
659_eHw-T1-TRNA-1_B23MHV2LT4_1_1																																				144.8bp	98.5%	291.1M												92.4%	59%	151bp	151bp	18%	908.7M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_2																																																		91.1%	59%	151bp	151bp	18%	908.7M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.7%	60%	131bp	142bp	18%	295.6M	86.7%	60%	131bp	142bp	18%	295.6M
659_eHw-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		86.7%	60%	131bp	142bp	9%	295.6M	86.7%	60%	131bp	142bp	9%	295.6M
659_eKx-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	8988	0.4871	72.8bp	32.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	77326	0.21%	0.59%	31638	0.02%	0.04%	0.46%	0.96%	615	291	14670	6948	0.00	0.00	0.00%	0.00%	0.95	0.000	9999000000	43703				74.9%	1.7%	10.0%	0.0M	69.8%	91.1%	3.8Mb	0.1M	71.1%	9.7%	53.7%
659_eKx-T1-TRNA-1_B23MHV2LT4_1_1																																				72.8bp	5.1%	0.0M												95.0%	73%	151bp	151bp	64%	0.4M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_2																																																		89.4%	95%	151bp	151bp	55%	0.4M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		59.5%	67%	52bp	37bp	45%	0.0M	59.5%	67%	52bp	37bp	45%	0.0M
659_eKx-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		61.3%	74%	55bp	37bp	45%	0.0M	61.3%	74%	55bp	37bp	45%	0.0M
659_ePR-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	574221065	0.9688	143.3bp	133.0bp	0.01%	1.00%	0.32%	0.00%	0.02%	3.26%	0.53%	0.00%	0.01	591826662	0.01%	0.54%	274558017	0.94%	0.96%	0.05%	0.04%	257554690	130040033	13883636	4909915	490.37	219.00	0.73%	0.62%	0.97	0.000	9999000000	288789265				53.9%	90.5%	96.1%	284.4M	35.1%	97.2%	74282.9Mb	591.8M	55.1%	98.6%	57.9%
659_ePR-T1-TRNA-1_B23MHV2LT4_1_1																																				143.3bp	98.2%	290.7M												86.3%	54%	151bp	151bp	18%	442.8M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.0%	54%	151bp	151bp	18%	442.8M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.6%	54%	129bp	137bp	18%	295.9M	83.6%	54%	129bp	137bp	18%	295.9M
659_ePR-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.3%	55%	129bp	142bp	9%	295.9M	83.3%	55%	129bp	142bp	9%	295.9M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	532785084	0.9397	151.1bp	137.0bp	0.03%	1.31%	0.39%	0.00%	0.07%	3.84%	0.57%	0.00%	6.25	553987468	0.01%	0.42%	322910099	0.94%	0.97%	0.05%	0.03%	304324474	153967637	15793382	4976065	620.18	281.00	0.74%	0.64%	0.97	0.000	9999000000	544740151				41.9%	88.5%	95.4%	264.1M	25.3%	96.9%	69636.4Mb	554.0M	52.9%	98.6%	51.3%
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_1																																				151.1bp	98.2%	271.9M												81.3%	52%	151bp	151bp	27%	281.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_2																																																		81.4%	53%	151bp	151bp	18%	281.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.4%	52%	130bp	147bp	18%	277.0M	81.4%	52%	130bp	147bp	18%	277.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		82.6%	53%	130bp	147bp	9%	277.0M	82.6%	53%	130bp	147bp	9%	277.0M
659_ecd-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	571140727	0.9075	138.4bp	124.0bp	0.03%	0.81%	0.36%	0.00%	0.06%	2.49%	0.54%	0.00%	6.04	591149182	0.01%	0.43%	336906120	0.94%	0.97%	0.05%	0.03%	317023071	160113219	16677694	5590663	608.75	301.00	0.77%	0.66%	0.97	0.000	9999000000	542471892				43.2%	89.6%	95.8%	283.2M	24.8%	96.8%	71772.0Mb	591.1M	53.7%	98.5%	58.9%
659_ecd-T1-TRNA-1_B23MHV2LT4_1_1																																				138.4bp	98.2%	290.2M												84.7%	52%	151bp	151bp	27%	475.5M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.6%	53%	151bp	151bp	18%	475.5M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		81.9%	53%	125bp	137bp	27%	295.6M	81.9%	53%	125bp	137bp	27%	295.6M
659_ecd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.7%	54%	125bp	137bp	18%	295.6M	81.7%	54%	125bp	137bp	18%	295.6M
659_eeB-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	4055	0.4758	98.7bp	115.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	38332	0.19%	0.60%	15361	0.02%	0.03%	0.51%	0.97%	245	122	7773	3690	0.00	0.00	0.00%	0.00%	0.91	0.000	9999000000	31715				74.1%	1.4%	8.5%	0.0M	48.3%	88.0%	2.0Mb	0.0M	69.6%	9.3%	53.4%
659_eeB-T1-TRNA-1_B23MHV2LT4_1_1																																				98.7bp	7.3%	0.0M												95.1%	74%	151bp	151bp	55%	0.2M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_2																																																		92.3%	96%	151bp	151bp	55%	0.2M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		60.7%	67%	59bp	37bp	45%	0.0M	60.7%	67%	59bp	37bp	45%	0.0M
659_eeB-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		62.7%	71%	61bp	37bp	45%	0.0M	62.7%	71%	61bp	37bp	45%	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1	Skipped	N/A%	1949	0.4929	78.6bp	31.0bp	0.00%	0.00%	0.74%	0.00%	0.00%	0.00%	1.94%	0.00%	0.00	23940	0.23%	0.55%	10829	0.02%	0.04%	0.46%	0.96%	191	93	5014	2397	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	19117				71.6%	1.1%	6.5%	0.0M	53.4%	87.5%	1.3Mb	0.0M	73.5%	6.1%	52.0%
659_egp-T1-TRNA-1_B23MHV2LT4_1_1																																				78.6bp	4.5%	0.0M												96.2%	74%	151bp	151bp	45%	0.2M
659_egp-T1-TRNA-1_B23MHV2LT4_1_2																																																		94.3%	97%	151bp	151bp	55%	0.2M
659_egp-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		57.4%	69%	60bp	37bp	55%	0.0M	57.4%	69%	60bp	37bp	55%	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		60.4%	77%	62bp	37bp	55%	0.0M	60.4%	77%	62bp	37bp	55%	0.0M
659_end-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	574592533	0.9440	149.0bp	137.0bp	0.01%	0.64%	0.68%	0.00%	0.02%	2.05%	0.96%	0.00%	0.01	592793960	0.01%	0.45%	328093036	0.94%	0.97%	0.04%	0.03%	310027131	156830226	14255715	4422891	622.90	259.00	0.71%	0.62%	0.97	0.000	9999000000	512991129				44.9%	91.3%	96.1%	285.0M	29.5%	97.2%	75152.4Mb	592.8M	53.7%	98.8%	54.1%
659_end-T1-TRNA-1_B23MHV2LT4_1_1																																				149.0bp	98.2%	291.1M												87.5%	52%	151bp	151bp	18%	410.2M
659_end-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.2%	54%	151bp	151bp	18%	410.2M
659_end-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		85.7%	53%	130bp	142bp	18%	296.4M	85.7%	53%	130bp	142bp	18%	296.4M
659_end-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		85.2%	54%	130bp	142bp	9%	296.4M	85.2%	54%	130bp	142bp	9%	296.4M
659_epG-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	559086152	0.8880	140.0bp	130.0bp	0.02%	1.31%	0.34%	0.00%	0.04%	4.33%	0.61%	0.00%	6.38	591824690	0.01%	0.45%	322572098	0.94%	0.96%	0.05%	0.04%	301900221	152312777	16610163	6083594	572.69	277.00	0.76%	0.66%	0.97	0.000	9999000000	430295723				45.8%	83.9%	93.7%	277.2M	29.1%	97.2%	73132.8Mb	591.8M	53.9%	98.6%	60.4%
659_epG-T1-TRNA-1_B23MHV2LT4_1_1																																				140.0bp	98.2%	290.5M												85.6%	53%	151bp	151bp	18%	405.5M
659_epG-T1-TRNA-1_B23MHV2LT4_1_2																																																		84.6%	53%	151bp	151bp	18%	405.5M
659_epG-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.6%	53%	127bp	137bp	18%	295.9M	83.6%	53%	127bp	137bp	18%	295.9M
659_epG-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.6%	54%	127bp	137bp	9%	295.9M	83.6%	54%	127bp	137bp	9%	295.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	563989503	0.9298	157.1bp	147.0bp	0.01%	0.78%	0.39%	0.00%	0.01%	2.54%	0.62%	0.00%	0.01	591545128	0.01%	0.52%	284473549	0.93%	0.97%	0.05%	0.03%	265439547	134522689	14955506	4849251	544.32	260.00	0.75%	0.64%	0.97	0.000	9999000000	292195378				52.3%	86.0%	94.3%	279.1M	36.9%	97.0%	78010.8Mb	591.5M	57.0%	98.6%	45.5%
659_epP-T1-TRNA-1_B23MHV2LT4_1_1																																				157.1bp	97.7%	289.1M												88.1%	56%	151bp	151bp	18%	514.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1_2																																																		87.1%	56%	151bp	151bp	18%	514.9M
659_epP-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.4%	56%	136bp	151bp	18%	295.8M	84.4%	56%	136bp	151bp	18%	295.8M
659_epP-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.5%	57%	136bp	151bp	9%	295.8M	84.5%	57%	136bp	151bp	9%	295.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	565181163	0.8214	134.1bp	126.0bp	0.00%	0.74%	0.45%	0.00%	0.00%	2.40%	0.77%	0.00%	0.01	589898788	0.01%	0.72%	164328193	0.90%	0.94%	0.07%	0.06%	148008982	74534098	11841835	4776535	259.13	47.00	0.57%	0.39%	0.97	0.000	9999000000	140843234				72.7%	86.5%	94.8%	279.5M	45.8%	96.7%	71681.7Mb	589.9M	62.8%	98.3%	65.0%
659_epZ-T1-TRNA-1_B23MHV2LT4_1_1																																				134.1bp	97.4%	287.2M												91.4%	60%	151bp	151bp	18%	529.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_2																																																		89.9%	61%	151bp	151bp	18%	529.8M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		88.3%	62%	126bp	132bp	18%	294.9M	88.3%	62%	126bp	132bp	18%	294.9M
659_epZ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		88.0%	63%	126bp	132bp	9%	294.9M	88.0%	63%	126bp	132bp	9%	294.9M
659_eu1-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	257401323	0.9344	103.2bp	96.0bp	0.08%	1.64%	0.50%	0.00%	0.15%	4.58%	0.72%	0.00%	6.06	271201014	0.01%	0.51%	132702640	0.92%	0.94%	0.06%	0.06%	121660497	60997132	8360432	3558992	172.13	78.00	0.66%	0.45%	0.97	0.000	9999000000	145275803				51.6%	84.7%	94.1%	127.5M	24.4%	97.1%	27226.0Mb	271.2M	53.6%	98.6%	86.3%
659_eu1-T1-TRNA-1_B23MHV2LT4_1_1																																				103.2bp	97.9%	132.8M												77.1%	52%	151bp	151bp	27%	137.5M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_2																																																		75.0%	53%	151bp	151bp	27%	137.5M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		77.1%	53%	103bp	102bp	18%	135.6M	77.1%	53%	103bp	102bp	18%	135.6M
659_eu1-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		75.9%	53%	104bp	102bp	9%	135.6M	75.9%	53%	104bp	102bp	9%	135.6M
659_ezg-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	571977358	0.9374	140.0bp	130.0bp	0.01%	1.70%	0.68%	0.00%	0.03%	5.11%	1.00%	0.00%	0.00	592308610	0.01%	0.50%	297368181	0.94%	0.97%	0.05%	0.03%	279852684	141342939	14021639	4804735	530.44	254.00	0.74%	0.64%	0.97	0.000	9999000000	344674305				50.1%	89.2%	95.7%	283.3M	32.0%	97.2%	73858.0Mb	592.3M	54.7%	98.7%	59.7%
659_ezg-T1-TRNA-1_B23MHV2LT4_1_1																																				140.0bp	98.0%	290.4M												86.6%	53%	151bp	151bp	18%	419.1M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_2																																																		85.5%	54%	151bp	151bp	18%	419.1M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		84.3%	54%	128bp	137bp	18%	296.2M	84.3%	54%	128bp	137bp	18%	296.2M
659_ezg-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		84.1%	54%	128bp	137bp	9%	296.2M	84.1%	54%	128bp	137bp	9%	296.2M
659_gK-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	562679524	0.9219	150.6bp	140.0bp	0.02%	1.55%	0.54%	0.00%	0.05%	4.76%	0.84%	0.00%	0.00	590690094	0.01%	0.43%	333942199	0.94%	0.97%	0.05%	0.03%	314693471	159295944	15845659	5038407	638.82	277.00	0.73%	0.63%	0.97	0.000	9999000000	479693780				43.7%	86.6%	94.5%	279.0M	28.3%	97.2%	75791.7Mb	590.7M	54.6%	98.7%	51.4%
659_gK-T1-TRNA-1_B23MHV2LT4_1_1																																				150.6bp	98.1%	289.8M												83.1%	53%	151bp	151bp	18%	299.1M
659_gK-T1-TRNA-1_B23MHV2LT4_1_2																																																		82.4%	54%	151bp	151bp	18%	299.1M
659_gK-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.1%	54%	132bp	147bp	9%	295.3M	83.1%	54%	132bp	147bp	9%	295.3M
659_gK-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.3%	54%	132bp	147bp	9%	295.3M	83.3%	54%	132bp	147bp	9%	295.3M
659_mK-T1-TRNA-2_B23MHV2LT4_1	Yes	0.00%	532539126	0.8716	113.6bp	106.0bp	0.06%	1.06%	0.57%	0.00%	0.11%	3.09%	0.83%	0.00%	5.81	558623208	0.01%	0.55%	251497885	0.92%	0.95%	0.06%	0.05%	231979755	116448178	14800891	6023634	362.89	170.00	0.72%	0.59%	0.97	0.000	9999000000	259050055				55.4%	85.9%	94.5%	263.8M	25.6%	96.9%	60540.5Mb	558.6M	54.2%	98.5%	79.7%
659_mK-T1-TRNA-2_B23MHV2LT4_1_1																																				113.6bp	98.0%	273.7M												79.2%	52%	151bp	151bp	27%	283.7M
659_mK-T1-TRNA-2_B23MHV2LT4_1_2																																																		78.0%	53%	151bp	151bp	18%	283.7M
659_mK-T1-TRNA-2_B23MHV2LT4_1_trimmed_1																																																		79.3%	54%	112bp	112bp	18%	279.3M	79.3%	54%	112bp	112bp	18%	279.3M
659_mK-T1-TRNA-2_B23MHV2LT4_1_trimmed_2																																																		79.2%	54%	112bp	112bp	9%	279.3M	79.2%	54%	112bp	112bp	9%	279.3M
659_rd-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	408394368	0.9418	156.5bp	143.0bp	0.01%	1.27%	0.31%	0.00%	0.01%	4.26%	0.51%	0.00%	6.58	418384894	0.00%	0.41%	248300114	0.94%	0.97%	0.05%	0.03%	234478840	118850138	11891403	3672312	487.42	205.00	0.74%	0.61%	0.97	0.000	9999000000	398079515				40.8%	92.0%	96.6%	202.0M	27.5%	97.3%	54351.8Mb	418.4M	53.2%	98.8%	48.3%
659_rd-T1-TRNA-1_B23MHV2LT4_1_1																																				156.5bp	98.1%	205.3M												82.2%	52%	151bp	151bp	27%	211.7M
659_rd-T1-TRNA-1_B23MHV2LT4_1_2																																																		80.9%	53%	151bp	151bp	18%	211.7M
659_rd-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		82.3%	52%	133bp	151bp	18%	209.2M	82.3%	52%	133bp	151bp	18%	209.2M
659_rd-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		81.8%	53%	134bp	151bp	9%	209.2M	81.8%	53%	134bp	151bp	9%	209.2M
659_ri-T1-TRNA-1_B23MHV2LT4_1	No	0.00%	316064563	0.9101	103.6bp	97.0bp	0.08%	1.03%	0.52%	0.00%	0.14%	2.80%	0.69%	0.00%	5.91	330319114	0.01%	0.55%	147101336	0.92%	0.94%	0.07%	0.06%	134992460	67701843	9563838	4053512	191.33	78.00	0.64%	0.45%	0.97	0.000	9999000000	151661208				55.9%	86.6%	95.0%	156.8M	24.2%	97.1%	33539.0Mb	330.3M	53.9%	98.6%	86.4%
659_ri-T1-TRNA-1_B23MHV2LT4_1_1																																				103.6bp	98.0%	161.9M												80.6%	52%	151bp	151bp	27%	167.5M
659_ri-T1-TRNA-1_B23MHV2LT4_1_2																																																		77.8%	53%	151bp	151bp	27%	167.5M
659_ri-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		80.7%	53%	104bp	102bp	18%	165.2M	80.7%	53%	104bp	102bp	18%	165.2M
659_ri-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		78.9%	54%	105bp	102bp	9%	165.2M	78.9%	54%	105bp	102bp	9%	165.2M
659_wQ-T1-TRNA-1_B23MHV2LT4_1	Yes	1.42%	573313453	0.9455	142.8bp	131.0bp	0.01%	0.47%	0.36%	0.00%	0.03%	1.80%	0.66%	0.00%	1.14	590260544	0.01%	0.68%	188494032	0.92%	0.96%	0.06%	0.04%	173488916	87610929	11598757	4108529	335.86	151.00	0.73%	0.58%	0.97	0.000	9999000000	160943286				68.5%	90.8%	96.2%	284.0M	46.8%	96.9%	73813.2Mb	590.3M	56.9%	98.4%	54.3%
659_wQ-T1-TRNA-1_B23MHV2LT4_1_1																																				142.8bp	98.1%	289.5M												87.7%	55%	151bp	151bp	36%	351.6M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_2																																																		86.1%	56%	151bp	151bp	27%	351.6M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		86.8%	56%	129bp	142bp	27%	295.1M	86.8%	56%	129bp	142bp	27%	295.1M
659_wQ-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		86.5%	57%	129bp	142bp	27%	295.1M	86.5%	57%	129bp	142bp	27%	295.1M
659_zO-T1-TRNA-1_B23MHV2LT4_1	Yes	0.00%	570857929	0.9083	140.8bp	131.0bp	0.01%	0.80%	0.31%	0.00%	0.02%	2.59%	0.49%	0.00%	5.92	592785698	0.01%	0.52%	285592348	0.93%	0.96%	0.06%	0.04%	266323576	134494206	15752867	5746057	502.04	251.00	0.76%	0.65%	0.97	0.000	9999000000	305310012				52.1%	89.1%	95.6%	283.4M	32.6%	97.1%	73752.4Mb	592.8M	54.2%	98.8%	59.7%
659_zO-T1-TRNA-1_B23MHV2LT4_1_1																																				140.8bp	98.1%	290.8M												84.9%	53%	151bp	151bp	18%	356.5M
659_zO-T1-TRNA-1_B23MHV2LT4_1_2																																																		83.6%	54%	151bp	151bp	18%	356.5M
659_zO-T1-TRNA-1_B23MHV2LT4_1_trimmed_1																																																		83.6%	53%	128bp	137bp	18%	296.4M	83.6%	53%	128bp	137bp	18%	296.4M
659_zO-T1-TRNA-1_B23MHV2LT4_1_trimmed_2																																																		83.1%	54%	128bp	137bp	9%	296.4M	83.1%	54%	128bp	137bp	9%	296.4M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1	Yes	62.44%	569667148	0.9414	158.7bp	143.0bp	0.02%	1.73%	0.54%	0.00%	0.04%	5.02%	0.85%	0.00%	4.22	590717084	0.01%	0.40%	353035759	0.94%	0.97%	0.05%	0.03%	332327275	168487428	17180459	4989373	700.65	316.00	0.73%	0.64%	0.97	0.000	9999000000	549601287				40.5%	88.9%	95.7%	282.6M	26.4%	97.0%	76077.9Mb	590.7M	54.4%	98.5%	45.7%
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_1																																				158.7bp	97.9%	289.3M												84.3%	53%	151bp	151bp	27%	392.8M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_2																																																		83.2%	54%	151bp	151bp	18%	392.8M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_trimmed_1																																																		82.6%	54%	133bp	151bp	27%	295.4M	82.6%	54%	133bp	151bp	27%	295.4M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1_trimmed_2																																																		82.6%	54%	133bp	151bp	18%	295.4M	82.6%	54%	133bp	151bp	18%	295.4M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1	Yes	61.28%	572742717	0.9195	178.9bp	163.0bp	0.01%	1.83%	0.58%	0.00%	0.02%	5.44%	0.90%	0.00%	4.22	592056082	0.01%	0.39%	358333316	0.94%	0.97%	0.05%	0.03%	337253616	171734831	17726676	4679240	761.48	328.00	0.73%	0.64%	0.97	0.000	9999000000	547324551				39.7%	89.8%	96.0%	284.2M	28.3%	97.1%	80064.0Mb	592.1M	55.0%	98.7%	35.4%
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_1																																				178.9bp	97.8%	289.5M												89.3%	54%	151bp	151bp	18%	763.3M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_2																																																		88.1%	55%	151bp	151bp	18%	763.3M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_trimmed_1																																																		83.6%	54%	139bp	151bp	18%	296.0M	83.6%	54%	139bp	151bp	18%	296.0M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1_trimmed_2																																																		83.7%	55%	139bp	151bp	9%	296.0M	83.7%	55%	139bp	151bp	9%	296.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1	No	0.00%	570234769	0.9707	154.6bp	139.0bp	0.01%	1.61%	1.24%	0.00%	0.03%	4.34%	1.67%	0.00%	6.63	590659338	0.01%	0.45%	321950135	0.94%	0.97%	0.05%	0.03%	302611988	153335339	15698275	4642861	626.51	155.00	0.60%	0.53%	0.97	0.000	9999000000	418247823				45.8%	89.5%	95.6%	282.5M	29.0%	97.0%	75624.8Mb	590.7M	53.9%	98.4%	48.0%
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_1																																				154.6bp	97.5%	287.8M												86.0%	52%	151bp	151bp	27%	506.5M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_2																																																		85.2%	54%	151bp	151bp	18%	506.5M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_trimmed_1																																																		82.7%	53%	132bp	151bp	27%	295.3M	82.7%	53%	132bp	151bp	27%	295.3M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1_trimmed_2																																																		83.3%	54%	132bp	151bp	18%	295.3M	83.3%	54%	132bp	151bp	18%	295.3M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2	No	0.00%	572818534	0.9452	156.0bp	144.0bp	0.01%	1.74%	1.34%	0.00%	0.02%	4.68%	1.74%	0.00%	6.56	592067344	0.01%	0.52%	282478109	0.94%	0.97%	0.05%	0.03%	265574334	134604544	13403596	4023455	548.29	129.00	0.59%	0.52%	0.97	0.000	9999000000	298013380				52.6%	90.1%	95.9%	283.8M	34.9%	97.0%	77032.5Mb	592.1M	54.3%	98.7%	48.3%
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_1																																				156.0bp	97.6%	289.0M												89.4%	53%	151bp	151bp	18%	547.9M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_2																																																		88.2%	54%	151bp	151bp	18%	547.9M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_trimmed_1																																																		85.8%	53%	134bp	151bp	18%	296.0M	85.8%	53%	134bp	151bp	18%	296.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2_trimmed_2																																																		85.7%	54%	134bp	151bp	9%	296.0M	85.7%	54%	134bp	151bp	9%	296.0M
NTC_0001_0001_B23MHV2LT4_1	Skipped	N/A%	2464	0.4497	61.4bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00	47120	0.44%	0.46%	25521	0.01%	0.06%	0.17%	0.94%	284	137	4435	2002	0.00	0.00	0.00%	0.00%	0.94	0.000	9999000000	27385				82.1%	0.9%	4.0%	0.0M	42.2%	88.4%	2.9Mb	0.0M	69.7%	13.1%	53.3%
NTC_0001_0001_B23MHV2LT4_1_1																																				61.4bp	4.8%	0.0M												93.6%	73%	151bp	151bp	55%	0.2M
NTC_0001_0001_B23MHV2LT4_1_2																																																		90.3%	94%	151bp	151bp	55%	0.2M
NTC_0001_0001_B23MHV2LT4_1_trimmed_1																																																		60.9%	68%	48bp	37bp	45%	0.0M	60.9%	68%	48bp	37bp	45%	0.0M
NTC_0001_0001_B23MHV2LT4_1_trimmed_2																																																		61.5%	70%	90bp	72bp	55%	0.0M	61.5%	70%	90bp	72bp	55%	0.0M
NTC_0001_0001_B23MHV2LT4_2	Skipped	N/A%	3763	0.4923	62.3bp	31.0bp	0.00%	0.52%	0.05%	0.00%	0.00%	1.17%	0.06%	0.00%	0.00	488868	0.95%	0.04%	467367	0.00%	0.05%	0.01%	0.95%	231	116	4728	2331	0.00	0.00	0.00%	0.00%	0.93	0.000	9999000000	20758				81.3%	0.5%	0.6%	0.0M	57.1%	69.6%	49.0Mb	0.5M	85.6%	93.7%	6.7%
NTC_0001_0001_B23MHV2LT4_2_1																																				62.3bp	0.8%	0.0M												94.3%	72%	151bp	151bp	64%	0.3M
NTC_0001_0001_B23MHV2LT4_2_2																																																		90.7%	96%	151bp	151bp	55%	0.3M
NTC_0001_0001_B23MHV2LT4_2_trimmed_1																																																		94.9%	72%	145bp	151bp	64%	0.2M	94.9%	72%	145bp	151bp	64%	0.2M
NTC_0001_0001_B23MHV2LT4_2_trimmed_2																																																		95.1%	98%	143bp	151bp	55%	0.2M	95.1%	98%	143bp	151bp	55%	0.2M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_1q-T1-TRNA-1_B23MHV2LT4_1	636.6M	0.0M	0.0M	43.3M	3.1M	571.2M	285.7M	285.5M	285.7M	285.6M	303.3M	267.9M	569.5M	0.0M
659_6i-T1-TRNA-1_B23MHV2LT4_1	465.5M	0.0M	0.0M	38.3M	2.9M	408.7M	204.5M	204.2M	204.4M	204.3M	245.2M	163.5M	407.3M	0.0M
659_8h-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_Dd-T1-TRNA-1_B23MHV2LT4_1	629.4M	0.0M	0.0M	35.9M	3.7M	573.4M	286.8M	286.6M	286.8M	286.6M	268.2M	305.2M	571.3M	0.0M
659_Dl-T1-TRNA-1_B23MHV2LT4_1	454.3M	0.0M	0.0M	46.5M	3.3M	385.1M	192.8M	192.4M	192.6M	192.5M	231.2M	154.0M	383.8M	0.0M
659_Fr-T1-TRNA-1_B23MHV2LT4_1	644.6M	0.0M	0.0M	49.9M	3.3M	568.9M	284.6M	284.3M	284.5M	284.4M	301.1M	267.7M	567.2M	0.0M
659_Kh-T1-TRNA-1_B23MHV2LT4_1	7.2M	0.0M	0.0M	1.0M	0.0M	5.9M	3.0M	3.0M	3.0M	3.0M	2.9M	3.0M	5.9M	0.0M
659_Lx-T1-TRNA-1_B23MHV2LT4_1	582.4M	0.0M	0.0M	44.3M	2.7M	518.2M	259.2M	259.0M	259.2M	259.1M	296.9M	221.4M	516.4M	0.0M
659_Mt-T1-TRNA-1_B23MHV2LT4_1	653.3M	0.0M	0.0M	58.4M	3.8M	566.7M	283.5M	283.2M	283.4M	283.3M	320.8M	245.9M	565.0M	0.0M
659_On-T1-TRNA-2_B23MHV2LT4_1	634.9M	0.0M	0.0M	41.5M	2.8M	571.7M	286.0M	285.7M	285.9M	285.8M	308.9M	262.8M	569.7M	0.0M
659_R1-T1-TRNA-1_B23MHV2LT4_1	1.0M	0.0M	0.0M	0.8M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_SP-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.0M	3.8M	571.9M	286.1M	285.8M	286.0M	285.9M	305.4M	266.6M	570.2M	0.0M
659_Wm-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_b4x-T1-TRNA-1_B23MHV2LT4_1	163.4M	0.0M	0.0M	19.2M	1.3M	136.6M	68.4M	68.2M	68.3M	68.3M	91.6M	45.0M	136.1M	0.0M
659_b6o-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_b7Z-T1-TRNA-1_B23MHV2LT4_1	645.5M	0.0M	0.0M	50.7M	3.9M	566.8M	283.5M	283.3M	283.4M	283.4M	269.7M	297.1M	564.9M	0.0M
659_bCu-T1-TRNA-1_B23MHV2LT4_1	559.8M	0.0M	0.0M	47.1M	3.8M	490.6M	245.5M	245.1M	245.3M	245.3M	309.1M	181.6M	489.0M	0.0M
659_bGW-T1-TRNA-1_B23MHV2LT4_1	645.3M	0.0M	0.0M	51.9M	3.2M	566.5M	283.4M	283.1M	283.3M	283.2M	301.4M	265.1M	564.7M	0.0M
659_bGc-T1-TRNA-1_B23MHV2LT4_1	635.3M	0.0M	0.0M	42.8M	3.3M	570.8M	285.5M	285.3M	285.5M	285.4M	328.7M	242.2M	569.2M	0.0M
659_bIB-T1-TRNA-1_B23MHV2LT4_1	641.7M	0.0M	0.0M	46.6M	3.3M	569.6M	284.9M	284.7M	284.8M	284.8M	265.4M	304.2M	567.7M	0.0M
659_bKP-T1-TRNA-1_B23MHV2LT4_1	650.1M	0.0M	0.0M	55.5M	3.6M	565.6M	283.0M	282.7M	282.8M	282.8M	299.0M	266.6M	563.6M	0.0M
659_bMa-T1-TRNA-1_B23MHV2LT4_1	370.6M	0.0M	0.0M	46.0M	3.4M	304.6M	152.5M	152.1M	152.3M	152.3M	183.9M	120.7M	303.5M	0.0M
659_bNS-T1-TRNA-1_B23MHV2LT4_1	634.3M	0.0M	0.0M	41.1M	3.4M	570.2M	285.2M	285.0M	285.2M	285.1M	289.2M	281.1M	568.2M	0.0M
659_bQZ-T1-TRNA-1_B23MHV2LT4_1	641.3M	0.0M	0.0M	46.8M	5.5M	568.0M	284.1M	283.8M	284.0M	283.9M	288.8M	279.1M	565.9M	0.0M
659_bR4-T1-TRNA-1_B23MHV2LT4_1	632.9M	0.0M	0.0M	48.6M	3.7M	559.1M	279.7M	279.4M	279.6M	279.5M	312.6M	246.5M	556.9M	0.0M
659_bTo-T1-TRNA-1_B23MHV2LT4_1	621.9M	0.0M	0.0M	27.7M	2.5M	578.0M	289.1M	288.9M	289.1M	288.9M	273.3M	304.7M	576.3M	0.0M
659_bTq-T1-TRNA-1_B23MHV2LT4_1	640.1M	0.0M	0.0M	47.1M	3.8M	569.6M	284.9M	284.7M	284.8M	284.8M	293.3M	276.3M	568.0M	0.0M
659_bUW-T1-TRNA-1_B23MHV2LT4_1	679.7M	0.0M	0.0M	86.1M	3.8M	547.7M	274.0M	273.7M	273.9M	273.8M	271.9M	275.8M	545.8M	0.0M
659_bUs-T1-TRNA-1_B23MHV2LT4_1	626.8M	0.0M	0.0M	32.3M	2.6M	576.4M	288.3M	288.1M	288.2M	288.2M	262.8M	313.6M	574.3M	0.0M
659_bhK-T1-TRNA-1_B23MHV2LT4_1	627.0M	0.0M	0.0M	34.1M	3.5M	574.0M	287.2M	286.8M	287.1M	286.9M	280.4M	293.6M	571.9M	0.0M
659_bjQ-T1-TRNA-1_B23MHV2LT4_1	636.8M	0.0M	0.0M	43.6M	4.0M	570.4M	285.4M	285.0M	285.3M	285.1M	304.8M	265.6M	568.7M	0.0M
659_buD-T1-TRNA-1_B23MHV2LT4_1	638.1M	0.0M	0.0M	43.9M	3.9M	571.3M	285.8M	285.5M	285.7M	285.6M	297.5M	273.8M	569.0M	0.0M
659_bua-T1-TRNA-1_B23MHV2LT4_1	627.9M	0.0M	0.0M	33.7M	2.9M	575.6M	288.0M	287.6M	287.9M	287.8M	300.0M	275.7M	573.9M	0.0M
659_buj-T1-TRNA-1_B23MHV2LT4_1	0.6M	0.0M	0.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_c95-T1-TRNA-1_B23MHV2LT4_1	641.5M	0.0M	0.0M	47.7M	3.7M	570.4M	285.3M	285.0M	285.2M	285.1M	289.0M	281.3M	568.4M	0.0M
659_cAa-T1-TRNA-1_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cAd-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	48.7M	4.2M	562.4M	281.3M	281.0M	281.2M	281.1M	309.3M	253.1M	560.5M	0.0M
659_cB6-T1-TRNA-1_B23MHV2LT4_1	664.7M	0.0M	0.0M	73.6M	3.9M	560.1M	280.2M	279.9M	280.1M	280.0M	304.3M	255.8M	558.3M	0.0M
659_cGW-T1-TRNA-1_B23MHV2LT4_1	213.9M	0.0M	0.0M	24.0M	1.5M	179.7M	89.9M	89.8M	89.9M	89.8M	93.0M	86.7M	179.0M	0.0M
659_cIX-T1-TRNA-1_B23MHV2LT4_1	626.7M	0.0M	0.0M	32.1M	2.8M	577.3M	288.8M	288.5M	288.7M	288.6M	292.5M	284.8M	575.5M	0.0M
659_cRB-T1-TRNA-1_B23MHV2LT4_1	402.9M	0.0M	0.0M	27.4M	2.2M	362.1M	181.2M	181.0M	181.1M	181.0M	190.0M	172.2M	360.9M	0.0M
659_cRa-T1-TRNA-1_B23MHV2LT4_1	630.1M	0.0M	0.0M	37.1M	3.6M	572.7M	286.6M	286.2M	286.5M	286.3M	272.9M	299.8M	570.7M	0.0M
659_cTi-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	42.5M	3.8M	570.0M	285.2M	284.9M	285.1M	285.0M	292.6M	277.4M	567.8M	0.0M
659_cVw-T1-TRNA-1_B23MHV2LT4_1	641.4M	0.0M	0.0M	46.9M	3.9M	568.6M	284.4M	284.2M	284.3M	284.3M	282.3M	286.3M	566.9M	0.0M
659_cWx-T1-TRNA-1_B23MHV2LT4_1	647.0M	0.0M	0.0M	53.2M	3.8M	567.6M	284.0M	283.6M	283.8M	283.8M	302.5M	265.1M	565.7M	0.0M
659_cYf-T1-TRNA-1_B23MHV2LT4_1	645.4M	0.0M	0.0M	53.5M	3.4M	565.6M	283.1M	282.5M	282.9M	282.7M	331.0M	234.6M	563.2M	0.0M
659_cfy-T1-TRNA-1_B23MHV2LT4_1	629.6M	0.0M	0.0M	36.7M	2.7M	573.2M	286.7M	286.5M	286.6M	286.5M	291.6M	281.6M	571.2M	0.0M
659_ciJ-T1-TRNA-1_B23MHV2LT4_1	637.5M	0.0M	0.0M	44.5M	3.9M	569.4M	284.9M	284.6M	284.8M	284.7M	306.8M	262.6M	567.2M	0.0M
659_ciZ-T1-TRNA-1_B23MHV2LT4_1	612.7M	0.0M	0.0M	47.0M	3.4M	541.4M	270.8M	270.6M	270.7M	270.7M	285.9M	255.5M	539.5M	0.0M
659_cq5-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cuO-T1-TRNA-1_B23MHV2LT4_1	0.3M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_cwv-T1-TRNA-1_B23MHV2LT4_1	639.1M	0.0M	0.0M	45.4M	3.1M	570.4M	285.3M	285.0M	285.2M	285.2M	290.5M	279.9M	568.7M	0.0M
659_d01-T1-TRNA-1_B23MHV2LT4_1	641.2M	0.0M	0.0M	48.7M	3.7M	568.0M	284.2M	283.8M	284.0M	283.9M	339.2M	228.8M	566.2M	0.0M
659_d0M-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_d0V-T1-TRNA-1_B23MHV2LT4_1	0.6M	0.0M	0.0M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dES-T1-TRNA-1_B23MHV2LT4_1	646.8M	0.0M	0.0M	53.0M	4.1M	567.2M	283.8M	283.4M	283.6M	283.5M	313.7M	253.5M	565.1M	0.0M
659_dHy-T1-TRNA-1_B23MHV2LT4_1	637.0M	0.0M	0.0M	42.3M	4.0M	573.1M	286.7M	286.4M	286.6M	286.5M	286.9M	286.2M	571.2M	0.0M
659_dKM-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.2M	2.8M	573.7M	286.9M	286.7M	286.9M	286.8M	280.8M	292.8M	571.5M	0.0M
659_dQk-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dRe-T1-TRNA-1_B23MHV2LT4_1	585.7M	0.0M	0.0M	40.4M	3.0M	522.3M	261.3M	261.1M	261.2M	261.1M	258.1M	264.3M	520.9M	0.0M
659_dXa-T1-TRNA-1_B23MHV2LT4_1	648.6M	0.0M	0.0M	57.5M	3.6M	564.9M	282.6M	282.2M	282.5M	282.4M	329.5M	235.3M	563.0M	0.0M
659_dc8-T1-TRNA-1_B23MHV2LT4_1	636.9M	0.0M	0.0M	42.8M	3.3M	570.9M	285.6M	285.3M	285.5M	285.4M	289.9M	280.9M	569.0M	0.0M
659_dcz-T1-TRNA-1_B23MHV2LT4_1	360.2M	0.0M	0.0M	38.1M	3.0M	304.6M	152.5M	152.2M	152.3M	152.3M	201.3M	103.3M	303.5M	0.0M
659_dfA-T1-TRNA-1_B23MHV2LT4_1	634.0M	0.0M	0.0M	39.4M	3.1M	573.8M	287.0M	286.7M	286.9M	286.8M	283.0M	290.8M	571.5M	0.0M
659_djb-T1-TRNA-1_B23MHV2LT4_1	638.6M	0.0M	0.0M	43.2M	3.6M	573.2M	286.7M	286.5M	286.6M	286.5M	298.0M	275.1M	571.5M	0.0M
659_dkd-T1-TRNA-1_B23MHV2LT4_1	0.4M	0.0M	0.0M	0.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_dm4-T1-TRNA-1_B23MHV2LT4_1	419.8M	0.0M	0.0M	40.1M	2.8M	360.7M	180.5M	180.2M	180.4M	180.3M	231.9M	128.8M	359.6M	0.0M
659_dts-T1-TRNA-1_B23MHV2LT4_1	646.1M	0.0M	0.0M	52.9M	4.3M	566.6M	283.4M	283.2M	283.3M	283.2M	320.4M	246.1M	564.5M	0.0M
659_dwi-T1-TRNA-1_B23MHV2LT4_1	1.1M	0.0M	0.0M	0.9M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_e0S-T1-TRNA-1_B23MHV2LT4_1	0.1M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_eGK-T1-TRNA-1_B23MHV2LT4_1	632.6M	0.0M	0.0M	38.5M	2.8M	573.4M	286.8M	286.5M	286.7M	286.7M	300.3M	273.1M	571.4M	0.0M
659_eHw-T1-TRNA-1_B23MHV2LT4_1	632.9M	0.0M	0.0M	39.0M	3.1M	575.0M	287.7M	287.3M	287.6M	287.4M	284.8M	290.2M	572.8M	0.0M
659_eKx-T1-TRNA-1_B23MHV2LT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_ePR-T1-TRNA-1_B23MHV2LT4_1	632.5M	0.0M	0.0M	38.4M	3.1M	574.2M	287.2M	287.0M	287.1M	287.1M	299.3M	275.0M	572.3M	0.0M
659_eZ4-T1-TRNA-1_B23MHV2LT4_1	599.8M	0.0M	0.0M	43.9M	2.8M	532.8M	266.5M	266.2M	266.4M	266.4M	263.1M	269.7M	531.1M	0.0M
659_ecd-T1-TRNA-1_B23MHV2LT4_1	635.8M	0.0M	0.0M	42.6M	3.2M	571.1M	285.7M	285.5M	285.6M	285.5M	299.1M	272.0M	569.4M	0.0M
659_eeB-T1-TRNA-1_B23MHV2LT4_1	0.3M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_egp-T1-TRNA-1_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
659_end-T1-TRNA-1_B23MHV2LT4_1	627.8M	0.0M	0.0M	33.1M	3.8M	574.6M	287.4M	287.2M	287.3M	287.3M	283.0M	291.6M	572.9M	0.0M
659_epG-T1-TRNA-1_B23MHV2LT4_1	664.6M	0.0M	0.0M	70.8M	4.1M	559.1M	279.7M	279.4M	279.6M	279.5M	302.0M	257.1M	557.4M	0.0M
659_epP-T1-TRNA-1_B23MHV2LT4_1	653.5M	0.0M	0.0M	59.4M	4.1M	564.0M	282.2M	281.8M	282.0M	281.9M	290.6M	273.4M	561.9M	0.0M
659_epZ-T1-TRNA-1_B23MHV2LT4_1	650.6M	0.0M	0.0M	58.1M	4.5M	565.2M	282.8M	282.4M	282.7M	282.5M	296.6M	268.6M	563.0M	0.0M
659_eu1-T1-TRNA-1_B23MHV2LT4_1	303.1M	0.0M	0.0M	30.8M	2.7M	257.4M	128.8M	128.6M	128.7M	128.7M	163.0M	94.4M	256.6M	0.0M
659_ezg-T1-TRNA-1_B23MHV2LT4_1	638.9M	0.0M	0.0M	44.3M	3.5M	572.0M	286.1M	285.9M	286.0M	285.9M	286.1M	285.8M	570.1M	0.0M
659_gK-T1-TRNA-1_B23MHV2LT4_1	647.8M	0.0M	0.0M	55.1M	3.4M	562.7M	281.5M	281.2M	281.4M	281.3M	286.9M	275.7M	560.9M	0.0M
659_mK-T1-TRNA-2_B23MHV2LT4_1	618.2M	0.0M	0.0M	57.3M	4.7M	532.5M	266.5M	266.1M	266.3M	266.2M	324.3M	208.2M	530.8M	0.0M
659_rd-T1-TRNA-1_B23MHV2LT4_1	442.0M	0.0M	0.0M	21.9M	1.9M	408.4M	204.3M	204.1M	204.2M	204.2M	201.5M	206.9M	406.8M	0.0M
659_ri-T1-TRNA-1_B23MHV2LT4_1	364.0M	0.0M	0.0M	32.6M	2.5M	316.1M	158.1M	158.0M	158.1M	158.0M	200.6M	115.4M	315.2M	0.0M
659_wQ-T1-TRNA-1_B23MHV2LT4_1	629.2M	0.0M	0.0M	36.7M	3.4M	573.3M	286.9M	286.4M	286.8M	286.5M	277.7M	295.7M	571.4M	0.0M
659_zO-T1-TRNA-1_B23MHV2LT4_1	639.1M	0.0M	0.0M	44.5M	3.5M	570.9M	285.5M	285.3M	285.5M	285.4M	312.5M	258.4M	569.4M	0.0M
FFPE_HD789_02_RNA_0014_B23MHV2LT4_1	638.8M	0.0M	0.0M	46.2M	3.5M	569.7M	285.0M	284.7M	284.9M	284.8M	283.0M	286.7M	568.0M	0.0M
FFPE_HD789_02_RNA_0015_B23MHV2LT4_1	636.1M	0.0M	0.0M	42.2M	3.4M	572.7M	286.5M	286.3M	286.4M	286.3M	270.3M	302.4M	571.1M	0.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_1	635.1M	0.0M	0.0M	42.1M	3.6M	570.2M	285.3M	285.0M	285.2M	285.1M	274.6M	295.6M	568.3M	0.0M
FFPE_V4_0001_RNA_0003_B23MHV2LT4_2	633.4M	0.0M	0.0M	39.1M	3.5M	572.8M	286.5M	286.4M	286.4M	286.4M	269.1M	303.7M	570.9M	0.0M
NTC_0001_0001_B23MHV2LT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
NTC_0001_0001_B23MHV2LT4_2	0.7M	0.0M	0.0M	0.2M	0.5M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	277424296	0.2762%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	72	44552	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	66	36996	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	46	11227	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	37	15909	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	37	16126	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	36	6587	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	6517	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	4439	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGC	36	4486	0.0000%
CCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	34	3534	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	34	3606	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	31	2351	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGG	31	2387	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	31	2056	0.0000%
CCACCACCACACCACCACCACCACCACCACCACCACCACCACCACCACCA	31	2778	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	30	15801	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	30	15941	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	27	2801	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	27	2824	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	108020877	0.2588%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	38	19943	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	38	22591	0.0001%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	37	15909	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	37	16126	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	37	7895	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	36	6587	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	6517	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	36	4439	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGC	36	4486	0.0000%
CCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	34	3534	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	34	3606	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	31	2351	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGG	31	2387	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	31	2056	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	30	15801	0.0000%
CCACCACCACACCACCACCACCACCACCACCACCACCACCACCACCACCA	30	2505	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	30	15941	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	27	2801	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	27	2824	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp09_10-73d51683 --flowcell_id 20260226_LH00995_0015_B23MHV2LT4 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4/bclconvert_samplesheet.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp09_10-73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0009_exp0010/B23MHV2LT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4
flowcell_id: 20260226_LH00995_0015_B23MHV2LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260226_LH00995_0015_B23MHV2LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks