File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/d4/c4591e4054bb9a36711c3e2ecc729c/.command.err
Size
1.8 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 22807822
total bases: 3443981122
Q20 bases: 3370611151(97.8696%)
Q30 bases: 3224936660(93.6398%)
Q40 bases: 3224936660(93.6398%)

Read2 before filtering:
total reads: 22807822
total bases: 3443981122
Q20 bases: 3314060731(96.2276%)
Q30 bases: 3094243943(89.845%)
Q40 bases: 3094243943(89.845%)

Read1 after filtering:
total reads: 22479600
total bases: 3308470414
Q20 bases: 3248797758(98.1964%)
Q30 bases: 3117402393(94.2249%)
Q40 bases: 3117402393(94.2249%)

Read2 after filtering:
total reads: 22479600
total bases: 3308655024
Q20 bases: 3208276378(96.9662%)
Q30 bases: 3012594206(91.0519%)
Q40 bases: 3012594206(91.0519%)

Filtering result:
reads passed filter: 44959200
reads failed due to low quality: 653198
reads failed due to too many N: 2966
reads failed due to too short: 280
reads with adapter trimmed: 4729346
bases trimmed due to adapters: 172350038

Duplication rate: 11.5106%

Insert size peak (evaluated by paired-end reads): 271

JSON report: 1136_5PU-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1136_5PU-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1136_5PU-N1-BDNA-1_B23KGCJLT4_1_S49_L005_R1_001.fastq.gz --in2 1136_5PU-N1-BDNA-1_B23KGCJLT4_1_S49_L005_R2_001.fastq.gz --out1 1136_5PU-N1-BDNA-1_B23KGCJLT4_1/1136_5PU-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1136_5PU-N1-BDNA-1_B23KGCJLT4_1/1136_5PU-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1136_5PU-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1136_5PU-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 127 seconds