File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/de/7b80f52b859bb2a280b1331048ac54/.command.err
Size
1.8 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 29514811
total bases: 4456736461
Q20 bases: 4367625387(98.0005%)
Q30 bases: 4197810273(94.1902%)
Q40 bases: 4197810273(94.1902%)

Read2 before filtering:
total reads: 29514811
total bases: 4456736461
Q20 bases: 4293467182(96.3366%)
Q30 bases: 4017674698(90.1484%)
Q40 bases: 4017674698(90.1484%)

Read1 after filtering:
total reads: 29091111
total bases: 4280775389
Q20 bases: 4211061908(98.3715%)
Q30 bases: 4058328562(94.8036%)
Q40 bases: 4058328562(94.8036%)

Read2 after filtering:
total reads: 29091111
total bases: 4280970823
Q20 bases: 4155624645(97.072%)
Q30 bases: 3911530952(91.3702%)
Q40 bases: 3911530952(91.3702%)

Filtering result:
reads passed filter: 58182222
reads failed due to low quality: 843014
reads failed due to too many N: 3972
reads failed due to too short: 414
reads with adapter trimmed: 6150418
bases trimmed due to adapters: 224558286

Duplication rate: 13.1795%

Insert size peak (evaluated by paired-end reads): 228

JSON report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L008_R1_001.fastq.gz --in2 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L008_R2_001.fastq.gz --out1 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 405 seconds