File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/0e/dd67d3b2a1317ad89b3026fb75ef45/.command.err
Size
1.8 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 24087007
total bases: 3637138057
Q20 bases: 3565575039(98.0324%)
Q30 bases: 3429431736(94.2893%)
Q40 bases: 3429431736(94.2893%)

Read2 before filtering:
total reads: 24087007
total bases: 3637138057
Q20 bases: 3519071956(96.7539%)
Q30 bases: 3315733756(91.1633%)
Q40 bases: 3315733756(91.1633%)

Read1 after filtering:
total reads: 23791686
total bases: 3485388530
Q20 bases: 3430097355(98.4136%)
Q30 bases: 3307658975(94.9007%)
Q40 bases: 3307658975(94.9007%)

Read2 after filtering:
total reads: 23791686
total bases: 3485588084
Q20 bases: 3396198141(97.4354%)
Q30 bases: 3218063465(92.3248%)
Q40 bases: 3218063465(92.3248%)

Filtering result:
reads passed filter: 47583372
reads failed due to low quality: 586314
reads failed due to too many N: 4060
reads failed due to too short: 268
reads with adapter trimmed: 6034943
bases trimmed due to adapters: 214819393

Duplication rate: 11.4651%

Insert size peak (evaluated by paired-end reads): 198

JSON report: 1136_6J4-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1136_6J4-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1136_6J4-N1-BDNA-1_B23KGCJLT4_1_S161_L004_R1_001.fastq.gz --in2 1136_6J4-N1-BDNA-1_B23KGCJLT4_1_S161_L004_R2_001.fastq.gz --out1 1136_6J4-N1-BDNA-1_B23KGCJLT4_1/1136_6J4-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1136_6J4-N1-BDNA-1_B23KGCJLT4_1/1136_6J4-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1136_6J4-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1136_6J4-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 131 seconds