Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/a8/1aff2f4c8b87ca872cdb613e72ba41/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/bf/f21f95cec3b479406e3097ab7515c6/output/HCC1395_BL_S2_L002_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/a8/1aff2f4c8b87ca872cdb613e72ba41/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/bf/f21f95cec3b479406e3097ab7515c6/output/HCC1395_BL_S2_L002_R2_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62350 total bases: 9352500 Q20 bases: 9187767(98.2386%) Q30 bases: 8865289(94.7906%) Q40 bases: 8865289(94.7906%) Read2 before filtering: total reads: 62350 total bases: 9352500 Q20 bases: 9127777(97.5972%) Q30 bases: 8732057(93.366%) Q40 bases: 8732057(93.366%) Read1 after filtering: total reads: 62350 total bases: 8996418 Q20 bases: 8867284(98.5646%) Q30 bases: 8576187(95.3289%) Q40 bases: 8576187(95.3289%) Read2 after filtering: total reads: 62350 total bases: 8996484 Q20 bases: 8804204(97.8627%) Q30 bases: 8445832(93.8793%) Q40 bases: 8445832(93.8793%) Filtering result: reads passed filter: 124700 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 19354 bases trimmed due to adapters: 712098 Duplication rate: 0.91259% Insert size peak (evaluated by paired-end reads): 223 JSON report: HCC1395_BL.fastp.json HTML report: HCC1395_BL.fastp.html fastp --in1 HCC1395_BL_S2_L002_R1_001.fastq.gz --in2 HCC1395_BL_S2_L002_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds