Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/cf/eb8672aabecf58a000e9062f366e52/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/cf/eb8672aabecf58a000e9062f366e52/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ae/1de6e310c91d1c6c18e7cbda60b39a/output/HCC1395_BL_S2_L006_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ae/1de6e310c91d1c6c18e7cbda60b39a/output/HCC1395_BL_S2_L006_R1_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62416 total bases: 9362400 Q20 bases: 9196460(98.2276%) Q30 bases: 8871519(94.7569%) Q40 bases: 8871519(94.7569%) Read2 before filtering: total reads: 62416 total bases: 9362400 Q20 bases: 9136452(97.5866%) Q30 bases: 8738119(93.332%) Q40 bases: 8738119(93.332%) Read1 after filtering: total reads: 62414 total bases: 9011306 Q20 bases: 8879919(98.542%) Q30 bases: 8585137(95.2707%) Q40 bases: 8585137(95.2707%) Read2 after filtering: total reads: 62414 total bases: 9011557 Q20 bases: 8817639(97.8481%) Q30 bases: 8456163(93.8369%) Q40 bases: 8456163(93.8369%) Filtering result: reads passed filter: 124828 reads failed due to low quality: 4 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 19322 bases trimmed due to adapters: 701385 Duplication rate: 0.903614% Insert size peak (evaluated by paired-end reads): 220 JSON report: HCC1395_BL.fastp.json HTML report: HCC1395_BL.fastp.html fastp --in1 HCC1395_BL_S2_L006_R1_001.fastq.gz --in2 HCC1395_BL_S2_L006_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds