File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/32/e116fafaaf596f9ae7e22fa165106f/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62350
total bases: 9352500
Q20 bases: 9187767(98.2386%)
Q30 bases: 8865289(94.7906%)
Q40 bases: 8865289(94.7906%)

Read2 before filtering:
total reads: 62350
total bases: 9352500
Q20 bases: 9127777(97.5972%)
Q30 bases: 8732057(93.366%)
Q40 bases: 8732057(93.366%)

Read1 after filtering:
total reads: 62350
total bases: 8996418
Q20 bases: 8867284(98.5646%)
Q30 bases: 8576187(95.3289%)
Q40 bases: 8576187(95.3289%)

Read2 after filtering:
total reads: 62350
total bases: 8996484
Q20 bases: 8804204(97.8627%)
Q30 bases: 8445832(93.8793%)
Q40 bases: 8445832(93.8793%)

Filtering result:
reads passed filter: 124700
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19354
bases trimmed due to adapters: 712098

Duplication rate: 0.91259%

Insert size peak (evaluated by paired-end reads): 223

JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html

fastp --in1 HCC1395_BL_S2_L002_R1_001.fastq.gz --in2 HCC1395_BL_S2_L002_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds