Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/2c/e39f8e2be10a936822b5cfd8d4338f/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/2c/e39f8e2be10a936822b5cfd8d4338f/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/6a/43ced0f4c299b270cb14441b9ba1ec/output/Sig_18_Blood_S4_L003_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/6a/43ced0f4c299b270cb14441b9ba1ec/output/Sig_18_Blood_S4_L003_R2_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62593 total bases: 9388950 Q20 bases: 9226486(98.2696%) Q30 bases: 8915793(94.9605%) Q40 bases: 8915793(94.9605%) Read2 before filtering: total reads: 62593 total bases: 9388950 Q20 bases: 9154664(97.5047%) Q30 bases: 8755598(93.2543%) Q40 bases: 8755598(93.2543%) Read1 after filtering: total reads: 62590 total bases: 9073123 Q20 bases: 8946055(98.5995%) Q30 bases: 8659669(95.4431%) Q40 bases: 8659669(95.4431%) Read2 after filtering: total reads: 62590 total bases: 9073304 Q20 bases: 8869895(97.7582%) Q30 bases: 8504720(93.7334%) Q40 bases: 8504720(93.7334%) Filtering result: reads passed filter: 125180 reads failed due to low quality: 6 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 17882 bases trimmed due to adapters: 630751 Duplication rate: 0.925024% Insert size peak (evaluated by paired-end reads): 179 JSON report: Sig_18_Blood.fastp.json HTML report: Sig_18_Blood.fastp.html fastp --in1 Sig_18_Blood_S4_L003_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L003_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds