Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/08/6e88c77f3edf62161d605121c2dfc1/output/HCC1395_BL_S2_L001_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/4a/27f4ea10469e8e667febf836c14cbf/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/4a/27f4ea10469e8e667febf836c14cbf/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/08/6e88c77f3edf62161d605121c2dfc1/output/HCC1395_BL_S2_L001_R1_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62487 total bases: 9373050 Q20 bases: 9210103(98.2615%) Q30 bases: 8890866(94.8556%) Q40 bases: 8890866(94.8556%) Read2 before filtering: total reads: 62487 total bases: 9373050 Q20 bases: 9150118(97.6216%) Q30 bases: 8757440(93.4321%) Q40 bases: 8757440(93.4321%) Read1 after filtering: total reads: 62487 total bases: 9023509 Q20 bases: 8895065(98.5766%) Q30 bases: 8605938(95.3724%) Q40 bases: 8605938(95.3724%) Read2 after filtering: total reads: 62487 total bases: 9024164 Q20 bases: 8832536(97.8765%) Q30 bases: 8476049(93.9261%) Q40 bases: 8476049(93.9261%) Filtering result: reads passed filter: 124974 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 19183 bases trimmed due to adapters: 698427 Duplication rate: 0.896186% Insert size peak (evaluated by paired-end reads): 205 JSON report: HCC1395_BL.fastp.json HTML report: HCC1395_BL.fastp.html fastp --in1 HCC1395_BL_S2_L001_R1_001.fastq.gz --in2 HCC1395_BL_S2_L001_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds