File Info

Filename
HCC1395_BL.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/61/e9e3cbdf438ce5d33f092a030ddfa2/HCC1395_BL.fastp.log
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62487
total bases: 9373050
Q20 bases: 9210103(98.2615%)
Q30 bases: 8890866(94.8556%)
Q40 bases: 8890866(94.8556%)

Read2 before filtering:
total reads: 62487
total bases: 9373050
Q20 bases: 9150118(97.6216%)
Q30 bases: 8757440(93.4321%)
Q40 bases: 8757440(93.4321%)

Read1 after filtering:
total reads: 62487
total bases: 9023509
Q20 bases: 8895065(98.5766%)
Q30 bases: 8605938(95.3724%)
Q40 bases: 8605938(95.3724%)

Read2 after filtering:
total reads: 62487
total bases: 9024164
Q20 bases: 8832536(97.8765%)
Q30 bases: 8476049(93.9261%)
Q40 bases: 8476049(93.9261%)

Filtering result:
reads passed filter: 124974
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19183
bases trimmed due to adapters: 698427

Duplication rate: 0.896186%

Insert size peak (evaluated by paired-end reads): 205

JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html

fastp --in1 HCC1395_BL_S2_L001_R1_001.fastq.gz --in2 HCC1395_BL_S2_L001_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds