Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ee/5cc70fa0e4b61aab592c7c5c940081/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ee/5cc70fa0e4b61aab592c7c5c940081/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/e2/5518a4363f82935c99d6db90d0147e/output/HCC1395_BL_S2_L005_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/e2/5518a4363f82935c99d6db90d0147e/output/HCC1395_BL_S2_L005_R2_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62794 total bases: 9419100 Q20 bases: 9250604(98.2111%) Q30 bases: 8921224(94.7142%) Q40 bases: 8921224(94.7142%) Read2 before filtering: total reads: 62794 total bases: 9419100 Q20 bases: 9189311(97.5604%) Q30 bases: 8786919(93.2883%) Q40 bases: 8786919(93.2883%) Read1 after filtering: total reads: 62794 total bases: 9066702 Q20 bases: 8933948(98.5358%) Q30 bases: 8636084(95.2506%) Q40 bases: 8636084(95.2506%) Read2 after filtering: total reads: 62794 total bases: 9067009 Q20 bases: 8870934(97.8375%) Q30 bases: 8506004(93.8127%) Q40 bases: 8506004(93.8127%) Filtering result: reads passed filter: 125588 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 19165 bases trimmed due to adapters: 704489 Duplication rate: 0.880657% Insert size peak (evaluated by paired-end reads): 149 JSON report: HCC1395_BL.fastp.json HTML report: HCC1395_BL.fastp.html fastp --in1 HCC1395_BL_S2_L005_R1_001.fastq.gz --in2 HCC1395_BL_S2_L005_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds