Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/53/5e6f200fdf8f92ad426c34e2c33022/.command.sh
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/6e/f538f4eb7b2cda54a9c8b9fa6ff6cd/output/HCC1395_BL_S2_L008_R1_001.fastq.gz
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/53/5e6f200fdf8f92ad426c34e2c33022/.command.run
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/6e/f538f4eb7b2cda54a9c8b9fa6ff6cd/output/HCC1395_BL_S2_L008_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 62634
total bases: 9395100
Q20 bases: 9226123(98.2014%)
Q30 bases: 8898467(94.7139%)
Q40 bases: 8898467(94.7139%)
Read2 before filtering:
total reads: 62634
total bases: 9395100
Q20 bases: 9166896(97.571%)
Q30 bases: 8763642(93.2789%)
Q40 bases: 8763642(93.2789%)
Read1 after filtering:
total reads: 62634
total bases: 9040417
Q20 bases: 8907386(98.5285%)
Q30 bases: 8610838(95.2482%)
Q40 bases: 8610838(95.2482%)
Read2 after filtering:
total reads: 62634
total bases: 9040773
Q20 bases: 8845292(97.8378%)
Q30 bases: 8479560(93.7924%)
Q40 bases: 8479560(93.7924%)
Filtering result:
reads passed filter: 125268
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19271
bases trimmed due to adapters: 709010
Duplication rate: 0.94677%
Insert size peak (evaluated by paired-end reads): 182
JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html
fastp --in1 HCC1395_BL_S2_L008_R1_001.fastq.gz --in2 HCC1395_BL_S2_L008_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4
fastp v1.0.1, time used: 1 seconds