Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/c1/c13a438be473b8bc28099700e6d238/output/HCC1395_tumor_S1_L001_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/23/2dcd2714af3a3b1e99f6dafe1a2201/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/23/2dcd2714af3a3b1e99f6dafe1a2201/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/c1/c13a438be473b8bc28099700e6d238/output/HCC1395_tumor_S1_L001_R1_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62239 total bases: 9335850 Q20 bases: 9179630(98.3267%) Q30 bases: 8888252(95.2056%) Q40 bases: 8888252(95.2056%) Read2 before filtering: total reads: 62239 total bases: 9335850 Q20 bases: 9086896(97.3334%) Q30 bases: 8732267(93.5348%) Q40 bases: 8732267(93.5348%) Read1 after filtering: total reads: 62239 total bases: 8962223 Q20 bases: 8847140(98.7159%) Q30 bases: 8585719(95.799%) Q40 bases: 8585719(95.799%) Read2 after filtering: total reads: 62239 total bases: 8962620 Q20 bases: 8754529(97.6782%) Q30 bases: 8439295(94.161%) Q40 bases: 8439295(94.161%) Filtering result: reads passed filter: 124478 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20267 bases trimmed due to adapters: 746857 Duplication rate: 1.11506% Insert size peak (evaluated by paired-end reads): 172 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L001_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L001_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds