Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/74/d7f023c467653b312835b05a428849/output/HCC1395_tumor_S1_L001_R2_001.fastq.gz
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/5c508005d953383a61b97ba2091d8b/.command.sh
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/5c508005d953383a61b97ba2091d8b/.command.run
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/74/d7f023c467653b312835b05a428849/output/HCC1395_tumor_S1_L001_R1_001.fastq.gz
==> STAGING COMPLETE (4 inputs)
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 62239
total bases: 9335850
Q20 bases: 9179630(98.3267%)
Q30 bases: 8888252(95.2056%)
Q40 bases: 8888252(95.2056%)
Read2 before filtering:
total reads: 62239
total bases: 9335850
Q20 bases: 9086896(97.3334%)
Q30 bases: 8732267(93.5348%)
Q40 bases: 8732267(93.5348%)
Read1 after filtering:
total reads: 62239
total bases: 8962223
Q20 bases: 8847140(98.7159%)
Q30 bases: 8585719(95.799%)
Q40 bases: 8585719(95.799%)
Read2 after filtering:
total reads: 62239
total bases: 8962620
Q20 bases: 8754529(97.6782%)
Q30 bases: 8439295(94.161%)
Q40 bases: 8439295(94.161%)
Filtering result:
reads passed filter: 124478
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20267
bases trimmed due to adapters: 746857
Duplication rate: 1.11506%
Insert size peak (evaluated by paired-end reads): 172
JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html
fastp --in1 HCC1395_tumor_S1_L001_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L001_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4
fastp v1.0.1, time used: 2 seconds