File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/9f/0b4383aa004a45a57b4c91aa4bf8c7/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62447
total bases: 9367050
Q20 bases: 9206865(98.2899%)
Q30 bases: 8898683(94.9998%)
Q40 bases: 8898683(94.9998%)

Read2 before filtering:
total reads: 62447
total bases: 9367050
Q20 bases: 9136719(97.5411%)
Q30 bases: 8740627(93.3125%)
Q40 bases: 8740627(93.3125%)

Read1 after filtering:
total reads: 62444
total bases: 9057400
Q20 bases: 8931290(98.6077%)
Q30 bases: 8646407(95.4624%)
Q40 bases: 8646407(95.4624%)

Read2 after filtering:
total reads: 62444
total bases: 9057509
Q20 bases: 8856079(97.7761%)
Q30 bases: 8492378(93.7606%)
Q40 bases: 8492378(93.7606%)

Filtering result:
reads passed filter: 124888
reads failed due to low quality: 6
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17528
bases trimmed due to adapters: 618585

Duplication rate: 0.869537%

Insert size peak (evaluated by paired-end reads): 227

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L008_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L008_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds