Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/f7/bbb68f39d47d7775928ced4b3c54ec/output/HCC1395_tumor_S1_L008_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/f7/bbb68f39d47d7775928ced4b3c54ec/output/HCC1395_tumor_S1_L008_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/a8/8ea931acce47050ee3116812818f1a/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/a8/8ea931acce47050ee3116812818f1a/.command.run ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62876 total bases: 9431400 Q20 bases: 9273710(98.328%) Q30 bases: 8979673(95.2104%) Q40 bases: 8979673(95.2104%) Read2 before filtering: total reads: 62876 total bases: 9431400 Q20 bases: 9177845(97.3116%) Q30 bases: 8818539(93.5019%) Q40 bases: 8818539(93.5019%) Read1 after filtering: total reads: 62875 total bases: 9054085 Q20 bases: 8937938(98.7172%) Q30 bases: 8673266(95.794%) Q40 bases: 8673266(95.794%) Read2 after filtering: total reads: 62875 total bases: 9054446 Q20 bases: 8842090(97.6547%) Q30 bases: 8522281(94.1226%) Q40 bases: 8522281(94.1226%) Filtering result: reads passed filter: 125750 reads failed due to low quality: 2 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20705 bases trimmed due to adapters: 753973 Duplication rate: 1.16897% Insert size peak (evaluated by paired-end reads): 214 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L008_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L008_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds