Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/bd/bd1594f51e11150d2fa76dd20c2982/.command.sh
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/bd/bd1594f51e11150d2fa76dd20c2982/.command.run
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/75/48796bfff9ce734ffda911fdc6e680/output/HCC1395_BL_S2_L006_R2_001.fastq.gz
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/75/48796bfff9ce734ffda911fdc6e680/output/HCC1395_BL_S2_L006_R1_001.fastq.gz
==> STAGING COMPLETE (4 inputs)
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 62416
total bases: 9362400
Q20 bases: 9196460(98.2276%)
Q30 bases: 8871519(94.7569%)
Q40 bases: 8871519(94.7569%)
Read2 before filtering:
total reads: 62416
total bases: 9362400
Q20 bases: 9136452(97.5866%)
Q30 bases: 8738119(93.332%)
Q40 bases: 8738119(93.332%)
Read1 after filtering:
total reads: 62414
total bases: 9011306
Q20 bases: 8879919(98.542%)
Q30 bases: 8585137(95.2707%)
Q40 bases: 8585137(95.2707%)
Read2 after filtering:
total reads: 62414
total bases: 9011557
Q20 bases: 8817639(97.8481%)
Q30 bases: 8456163(93.8369%)
Q40 bases: 8456163(93.8369%)
Filtering result:
reads passed filter: 124828
reads failed due to low quality: 4
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19322
bases trimmed due to adapters: 701385
Duplication rate: 0.903614%
Insert size peak (evaluated by paired-end reads): 220
JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html
fastp --in1 HCC1395_BL_S2_L006_R1_001.fastq.gz --in2 HCC1395_BL_S2_L006_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4
fastp v1.0.1, time used: 2 seconds