File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/a6/30552ac287864f22f5c09c4fea27fd/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62368
total bases: 9355200
Q20 bases: 9194329(98.2804%)
Q30 bases: 8886627(94.9913%)
Q40 bases: 8886627(94.9913%)

Read2 before filtering:
total reads: 62368
total bases: 9355200
Q20 bases: 9123781(97.5263%)
Q30 bases: 8728619(93.3023%)
Q40 bases: 8728619(93.3023%)

Read1 after filtering:
total reads: 62368
total bases: 9035962
Q20 bases: 8910167(98.6078%)
Q30 bases: 8626375(95.4671%)
Q40 bases: 8626375(95.4671%)

Read2 after filtering:
total reads: 62368
total bases: 9036214
Q20 bases: 8835010(97.7734%)
Q30 bases: 8473620(93.774%)
Q40 bases: 8473620(93.774%)

Filtering result:
reads passed filter: 124736
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 18069
bases trimmed due to adapters: 638224

Duplication rate: 0.806503%

Insert size peak (evaluated by paired-end reads): 211

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L007_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L007_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds