Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/1e/72b2f974957937ed7fa060f8344587/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/9e184681094590a8f8cce4fee78d33/output/HCC1395_tumor_S1_L006_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/1e/72b2f974957937ed7fa060f8344587/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/9e184681094590a8f8cce4fee78d33/output/HCC1395_tumor_S1_L006_R1_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62527 total bases: 9379050 Q20 bases: 9223244(98.3388%) Q30 bases: 8933040(95.2446%) Q40 bases: 8933040(95.2446%) Read2 before filtering: total reads: 62527 total bases: 9379050 Q20 bases: 9125928(97.3012%) Q30 bases: 8764918(93.4521%) Q40 bases: 8764918(93.4521%) Read1 after filtering: total reads: 62526 total bases: 8997737 Q20 bases: 8884928(98.7463%) Q30 bases: 8625777(95.8661%) Q40 bases: 8625777(95.8661%) Read2 after filtering: total reads: 62526 total bases: 8997997 Q20 bases: 8787403(97.6595%) Q30 bases: 8467391(94.1031%) Q40 bases: 8467391(94.1031%) Filtering result: reads passed filter: 125052 reads failed due to low quality: 2 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20698 bases trimmed due to adapters: 762126 Duplication rate: 1.06994% Insert size peak (evaluated by paired-end reads): 172 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L006_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L006_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds