Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/fd/efdb05a07a2acd7271f082e2845d83/output/HCC1395_BL_S2_L003_R2_001.fastq.gz
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/23/8e8ed6ef75d1ea768c8dc843ef9b96/.command.sh
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/23/8e8ed6ef75d1ea768c8dc843ef9b96/.command.run
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/fd/efdb05a07a2acd7271f082e2845d83/output/HCC1395_BL_S2_L003_R1_001.fastq.gz
==> STAGING COMPLETE (4 inputs)
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 62275
total bases: 9341250
Q20 bases: 9173994(98.2095%)
Q30 bases: 8847351(94.7127%)
Q40 bases: 8847351(94.7127%)
Read2 before filtering:
total reads: 62275
total bases: 9341250
Q20 bases: 9114858(97.5764%)
Q30 bases: 8716485(93.3118%)
Q40 bases: 8716485(93.3118%)
Read1 after filtering:
total reads: 62274
total bases: 8991629
Q20 bases: 8859478(98.5303%)
Q30 bases: 8563509(95.2387%)
Q40 bases: 8563509(95.2387%)
Read2 after filtering:
total reads: 62274
total bases: 8991886
Q20 bases: 8797983(97.8436%)
Q30 bases: 8436445(93.8229%)
Q40 bases: 8436445(93.8229%)
Filtering result:
reads passed filter: 124548
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19099
bases trimmed due to adapters: 698687
Duplication rate: 0.892814%
Insert size peak (evaluated by paired-end reads): 170
JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html
fastp --in1 HCC1395_BL_S2_L003_R1_001.fastq.gz --in2 HCC1395_BL_S2_L003_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4
fastp v1.0.1, time used: 2 seconds