Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62464 total bases: 9369600 Q20 bases: 9213147(98.3302%) Q30 bases: 8921415(95.2166%) Q40 bases: 8921415(95.2166%) Read2 before filtering: total reads: 62464 total bases: 9369600 Q20 bases: 9120569(97.3421%) Q30 bases: 8764660(93.5436%) Q40 bases: 8764660(93.5436%) Read1 after filtering: total reads: 62463 total bases: 8985416 Q20 bases: 8871853(98.7361%) Q30 bases: 8610951(95.8325%) Q40 bases: 8610951(95.8325%) Read2 after filtering: total reads: 62463 total bases: 8985777 Q20 bases: 8778756(97.6961%) Q30 bases: 8463159(94.1839%) Q40 bases: 8463159(94.1839%) Filtering result: reads passed filter: 124926 reads failed due to low quality: 2 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20693 bases trimmed due to adapters: 767803 Duplication rate: 1.13345% Insert size peak (evaluated by paired-end reads): 206 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L005_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L005_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds