Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ff/44f5a2446b86863e9e9fcf5c3fb0e5/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/5b/a780a460234723bb6caabcf8d29ea1/output/Sig_18_Blood_S4_L001_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ff/44f5a2446b86863e9e9fcf5c3fb0e5/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/5b/a780a460234723bb6caabcf8d29ea1/output/Sig_18_Blood_S4_L001_R1_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62697 total bases: 9404550 Q20 bases: 9239747(98.2476%) Q30 bases: 8925255(94.9036%) Q40 bases: 8925255(94.9036%) Read2 before filtering: total reads: 62697 total bases: 9404550 Q20 bases: 9167509(97.4795%) Q30 bases: 8764372(93.1929%) Q40 bases: 8764372(93.1929%) Read1 after filtering: total reads: 62697 total bases: 9089045 Q20 bases: 8959404(98.5737%) Q30 bases: 8668812(95.3765%) Q40 bases: 8668812(95.3765%) Read2 after filtering: total reads: 62697 total bases: 9089311 Q20 bases: 8883146(97.7318%) Q30 bases: 8513818(93.6685%) Q40 bases: 8513818(93.6685%) Filtering result: reads passed filter: 125394 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 17752 bases trimmed due to adapters: 630744 Duplication rate: 0.87564% Insert size peak (evaluated by paired-end reads): 261 JSON report: Sig_18_Blood.fastp.json HTML report: Sig_18_Blood.fastp.html fastp --in1 Sig_18_Blood_S4_L001_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L001_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds