File Info

Filename
.command.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/3c41fda1f19af074fa3ad9e5516ebf/.command.log
Size
2.0 KB
Attempt
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/64/dc9b4e69baaf5d791eec2679291fb2/output/HCC1395_tumor_S1_L007_R1_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/3c41fda1f19af074fa3ad9e5516ebf/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/72/3c41fda1f19af074fa3ad9e5516ebf/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/64/dc9b4e69baaf5d791eec2679291fb2/output/HCC1395_tumor_S1_L007_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62563
total bases: 9384450
Q20 bases: 9227471(98.3272%)
Q30 bases: 8934730(95.2078%)
Q40 bases: 8934730(95.2078%)

Read2 before filtering:
total reads: 62563
total bases: 9384450
Q20 bases: 9132385(97.314%)
Q30 bases: 8775018(93.5059%)
Q40 bases: 8775018(93.5059%)

Read1 after filtering:
total reads: 62562
total bases: 8999755
Q20 bases: 8885037(98.7253%)
Q30 bases: 8623089(95.8147%)
Q40 bases: 8623089(95.8147%)

Read2 after filtering:
total reads: 62562
total bases: 9000113
Q20 bases: 8791274(97.6796%)
Q30 bases: 8474935(94.1648%)
Q40 bases: 8474935(94.1648%)

Filtering result:
reads passed filter: 125124
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20846
bases trimmed due to adapters: 768836

Duplication rate: 1.14285%

Insert size peak (evaluated by paired-end reads): 167

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L007_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L007_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds