File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/13/8e19ceaeb296f73fbb2011d22dbe2f/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62673
total bases: 9400950
Q20 bases: 9238977(98.2771%)
Q30 bases: 8929146(94.9813%)
Q40 bases: 8929146(94.9813%)

Read2 before filtering:
total reads: 62673
total bases: 9400950
Q20 bases: 9171426(97.5585%)
Q30 bases: 8776037(93.3527%)
Q40 bases: 8776037(93.3527%)

Read1 after filtering:
total reads: 62673
total bases: 9087430
Q20 bases: 8959912(98.5968%)
Q30 bases: 8673684(95.4471%)
Q40 bases: 8673684(95.4471%)

Read2 after filtering:
total reads: 62673
total bases: 9087828
Q20 bases: 8888125(97.8025%)
Q30 bases: 8525698(93.8145%)
Q40 bases: 8525698(93.8145%)

Filtering result:
reads passed filter: 125346
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17747
bases trimmed due to adapters: 626642

Duplication rate: 0.954159%

Insert size peak (evaluated by paired-end reads): 180

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L004_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L004_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds