File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/c7/2e359d10750ca386578567fffaac7a/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62437
total bases: 9365550
Q20 bases: 9204222(98.2774%)
Q30 bases: 8893934(94.9644%)
Q40 bases: 8893934(94.9644%)

Read2 before filtering:
total reads: 62437
total bases: 9365550
Q20 bases: 9131344(97.4993%)
Q30 bases: 8732732(93.2431%)
Q40 bases: 8732732(93.2431%)

Read1 after filtering:
total reads: 62437
total bases: 9053704
Q20 bases: 8927505(98.6061%)
Q30 bases: 8641020(95.4418%)
Q40 bases: 8641020(95.4418%)

Read2 after filtering:
total reads: 62437
total bases: 9054001
Q20 bases: 8850709(97.7547%)
Q30 bases: 8485919(93.7256%)
Q40 bases: 8485919(93.7256%)

Filtering result:
reads passed filter: 124874
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17561
bases trimmed due to adapters: 623395

Duplication rate: 0.874481%

Insert size peak (evaluated by paired-end reads): 202

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L005_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L005_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds