File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/c4/32d824667eb606b28d4745a13aad1e/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62527
total bases: 9379050
Q20 bases: 9223244(98.3388%)
Q30 bases: 8933040(95.2446%)
Q40 bases: 8933040(95.2446%)

Read2 before filtering:
total reads: 62527
total bases: 9379050
Q20 bases: 9125928(97.3012%)
Q30 bases: 8764918(93.4521%)
Q40 bases: 8764918(93.4521%)

Read1 after filtering:
total reads: 62526
total bases: 8997737
Q20 bases: 8884928(98.7463%)
Q30 bases: 8625777(95.8661%)
Q40 bases: 8625777(95.8661%)

Read2 after filtering:
total reads: 62526
total bases: 8997997
Q20 bases: 8787403(97.6595%)
Q30 bases: 8467391(94.1031%)
Q40 bases: 8467391(94.1031%)

Filtering result:
reads passed filter: 125052
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20698
bases trimmed due to adapters: 762126

Duplication rate: 1.06994%

Insert size peak (evaluated by paired-end reads): 172

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L006_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L006_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds