Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/1b/68c8f5ff5bc406e789598230aa5f61/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/04/2c336824abc7c60d236769d414f380/output/HCC1395_tumor_S1_L002_R1_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/1b/68c8f5ff5bc406e789598230aa5f61/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/04/2c336824abc7c60d236769d414f380/output/HCC1395_tumor_S1_L002_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62815
total bases: 9422250
Q20 bases: 9262473(98.3043%)
Q30 bases: 8966112(95.1589%)
Q40 bases: 8966112(95.1589%)

Read2 before filtering:
total reads: 62815
total bases: 9422250
Q20 bases: 9170294(97.3259%)
Q30 bases: 8810408(93.5064%)
Q40 bases: 8810408(93.5064%)

Read1 after filtering:
total reads: 62813
total bases: 9049185
Q20 bases: 8930722(98.6909%)
Q30 bases: 8664424(95.7481%)
Q40 bases: 8664424(95.7481%)

Read2 after filtering:
total reads: 62813
total bases: 9049461
Q20 bases: 8838479(97.6686%)
Q30 bases: 8517936(94.1264%)
Q40 bases: 8517936(94.1264%)

Filtering result:
reads passed filter: 125626
reads failed due to low quality: 4
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20361
bases trimmed due to adapters: 745426

Duplication rate: 1.13508%

Insert size peak (evaluated by paired-end reads): 187

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L002_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L002_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds