Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/df/6d9d448d87186f2f619932e6962bf6/.command.sh
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/df/6d9d448d87186f2f619932e6962bf6/.command.run
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/77/a170f9787852f253579d1b9088aba7/output/HCC1395_tumor_S1_L004_R1_001.fastq.gz
Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/77/a170f9787852f253579d1b9088aba7/output/HCC1395_tumor_S1_L004_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 62283
total bases: 9342450
Q20 bases: 9188318(98.3502%)
Q30 bases: 8901933(95.2848%)
Q40 bases: 8901933(95.2848%)
Read2 before filtering:
total reads: 62283
total bases: 9342450
Q20 bases: 9094765(97.3488%)
Q30 bases: 8740624(93.5582%)
Q40 bases: 8740624(93.5582%)
Read1 after filtering:
total reads: 62280
total bases: 8970133
Q20 bases: 8856940(98.7381%)
Q30 bases: 8599982(95.8735%)
Q40 bases: 8599982(95.8735%)
Read2 after filtering:
total reads: 62280
total bases: 8970592
Q20 bases: 8763050(97.6864%)
Q30 bases: 8447874(94.173%)
Q40 bases: 8447874(94.173%)
Filtering result:
reads passed filter: 124560
reads failed due to low quality: 6
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20241
bases trimmed due to adapters: 743413
Duplication rate: 1.08216%
Insert size peak (evaluated by paired-end reads): 170
JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html
fastp --in1 HCC1395_tumor_S1_L004_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L004_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4
fastp v1.0.1, time used: 1 seconds