File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/3f/e3bcc31567290a5cdaa5f1ed6bfdd8/.command.err
Size
1.8 KB
Task
DAQ:FASTP (1029_0W2-N1-BDNA-1_B23KGCJLT4_1;L001)
Attempt

Content

View in new tab 
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 19310800
total bases: 2915930800
Q20 bases: 2865297158(98.2636%)
Q30 bases: 2766257081(94.867%)
Q40 bases: 2766257081(94.867%)

Read2 before filtering:
total reads: 19310800
total bases: 2915930800
Q20 bases: 2814797525(96.5317%)
Q30 bases: 2641884559(90.6018%)
Q40 bases: 2641884559(90.6018%)

Read1 after filtering:
total reads: 19014490
total bases: 2804673705
Q20 bases: 2765929424(98.6186%)
Q30 bases: 2677736901(95.4741%)
Q40 bases: 2677736901(95.4741%)

Read2 after filtering:
total reads: 19014490
total bases: 2804765798
Q20 bases: 2729669430(97.3225%)
Q30 bases: 2578370323(91.9282%)
Q40 bases: 2578370323(91.9282%)

Filtering result:
reads passed filter: 38028980
reads failed due to low quality: 589834
reads failed due to too many N: 2632
reads failed due to too short: 154
reads with adapter trimmed: 3497220
bases trimmed due to adapters: 133372412

Duplication rate: 15.0473%

Insert size peak (evaluated by paired-end reads): 186

JSON report: 1029_0W2-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1029_0W2-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1029_0W2-N1-BDNA-1_B23KGCJLT4_1_S48_L001_R1_001.fastq.gz --in2 1029_0W2-N1-BDNA-1_B23KGCJLT4_1_S48_L001_R2_001.fastq.gz --out1 1029_0W2-N1-BDNA-1_B23KGCJLT4_1/1029_0W2-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1029_0W2-N1-BDNA-1_B23KGCJLT4_1/1029_0W2-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1029_0W2-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1029_0W2-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 220 seconds