File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ae/e59119574ac5342ce039167d0bf638/.command.err
Size
1.8 KB
Task
DAQ:FASTP (1029_01S-N1-BDNA-1_B23KGCJLT4_1;L002)
Attempt

Content

View in new tab 
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 30259847
total bases: 4569236897
Q20 bases: 4488916145(98.2421%)
Q30 bases: 4335314258(94.8805%)
Q40 bases: 4335314258(94.8805%)

Read2 before filtering:
total reads: 30259847
total bases: 4569236897
Q20 bases: 4419632131(96.7258%)
Q30 bases: 4165933199(91.1735%)
Q40 bases: 4165933199(91.1735%)

Read1 after filtering:
total reads: 29844348
total bases: 4400611575
Q20 bases: 4338163171(98.5809%)
Q30 bases: 4200031736(95.442%)
Q40 bases: 4200031736(95.442%)

Read2 after filtering:
total reads: 29844348
total bases: 4400801123
Q20 bases: 4288914358(97.4576%)
Q30 bases: 4066016878(92.3927%)
Q40 bases: 4066016878(92.3927%)

Filtering result:
reads passed filter: 59688696
reads failed due to low quality: 825972
reads failed due to too many N: 4614
reads failed due to too short: 412
reads with adapter trimmed: 5838167
bases trimmed due to adapters: 212308839

Duplication rate: 16.5063%

Insert size peak (evaluated by paired-end reads): 269

JSON report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L002_R1_001.fastq.gz --in2 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L002_R2_001.fastq.gz --out1 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 256 seconds