File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/64/5212929c5c525781fc5404a0f4dab1/.command.err
Size
1.8 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 29376492
total bases: 4435850292
Q20 bases: 4343993224(97.9292%)
Q30 bases: 4166965873(93.9384%)
Q40 bases: 4166965873(93.9384%)

Read2 before filtering:
total reads: 29376492
total bases: 4435850292
Q20 bases: 4272382914(96.3149%)
Q30 bases: 3995414940(90.071%)
Q40 bases: 3995414940(90.071%)

Read1 after filtering:
total reads: 28956459
total bases: 4264640747
Q20 bases: 4191753687(98.2909%)
Q30 bases: 4031565366(94.5347%)
Q40 bases: 4031565366(94.5347%)

Read2 after filtering:
total reads: 28956459
total bases: 4264834439
Q20 bases: 4138979029(97.049%)
Q30 bases: 3893228814(91.2868%)
Q40 bases: 3893228814(91.2868%)

Filtering result:
reads passed filter: 57912918
reads failed due to low quality: 835154
reads failed due to too many N: 4530
reads failed due to too short: 382
reads with adapter trimmed: 5926665
bases trimmed due to adapters: 216121593

Duplication rate: 13.3042%

Insert size peak (evaluated by paired-end reads): 268

JSON report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json
HTML report: 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html

fastp --in1 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L006_R1_001.fastq.gz --in2 1029_01S-N1-BDNA-1_B23KGCJLT4_1_S77_L006_R2_001.fastq.gz --out1 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R1.fastq.gz --out2 1029_01S-N1-BDNA-1_B23KGCJLT4_1/1029_01S-N1-BDNA-1_B23KGCJLT4_1_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.json --html 1029_01S-N1-BDNA-1_B23KGCJLT4_1.fastp.html --thread 4 
fastp v1.0.1, time used: 322 seconds