File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/12/4b414f44e3b21f7a59a57a58bdd073/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62593
total bases: 9388950
Q20 bases: 9226486(98.2696%)
Q30 bases: 8915793(94.9605%)
Q40 bases: 8915793(94.9605%)

Read2 before filtering:
total reads: 62593
total bases: 9388950
Q20 bases: 9154664(97.5047%)
Q30 bases: 8755598(93.2543%)
Q40 bases: 8755598(93.2543%)

Read1 after filtering:
total reads: 62590
total bases: 9073123
Q20 bases: 8946055(98.5995%)
Q30 bases: 8659669(95.4431%)
Q40 bases: 8659669(95.4431%)

Read2 after filtering:
total reads: 62590
total bases: 9073304
Q20 bases: 8869895(97.7582%)
Q30 bases: 8504720(93.7334%)
Q40 bases: 8504720(93.7334%)

Filtering result:
reads passed filter: 125180
reads failed due to low quality: 6
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17882
bases trimmed due to adapters: 630751

Duplication rate: 0.925024%

Insert size peak (evaluated by paired-end reads): 179

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L003_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L003_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds