Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62233
total bases: 9334950
Q20 bases: 9177992(98.3186%)
Q30 bases: 8887703(95.2089%)
Q40 bases: 8887703(95.2089%)

Read2 before filtering:
total reads: 62233
total bases: 9334950
Q20 bases: 9083124(97.3023%)
Q30 bases: 8723407(93.4489%)
Q40 bases: 8723407(93.4489%)

Read1 after filtering:
total reads: 62232
total bases: 8960155
Q20 bases: 8844563(98.7099%)
Q30 bases: 8584015(95.8021%)
Q40 bases: 8584015(95.8021%)

Read2 after filtering:
total reads: 62232
total bases: 8960413
Q20 bases: 8750270(97.6548%)
Q30 bases: 8430461(94.0856%)
Q40 bases: 8430461(94.0856%)

Filtering result:
reads passed filter: 124464
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20281
bases trimmed due to adapters: 749096

Duplication rate: 1.16016%

Insert size peak (evaluated by paired-end reads): 196

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L003_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L003_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds