Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/28/a56b0841a2af34f08e701b9d908341/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/03/1cede8bc3a2f9150ff657f55bd29c6/output/HCC1395_tumor_S1_L005_R1_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/28/a56b0841a2af34f08e701b9d908341/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/03/1cede8bc3a2f9150ff657f55bd29c6/output/HCC1395_tumor_S1_L005_R2_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62464
total bases: 9369600
Q20 bases: 9213147(98.3302%)
Q30 bases: 8921415(95.2166%)
Q40 bases: 8921415(95.2166%)

Read2 before filtering:
total reads: 62464
total bases: 9369600
Q20 bases: 9120569(97.3421%)
Q30 bases: 8764660(93.5436%)
Q40 bases: 8764660(93.5436%)

Read1 after filtering:
total reads: 62463
total bases: 8985416
Q20 bases: 8871853(98.7361%)
Q30 bases: 8610951(95.8325%)
Q40 bases: 8610951(95.8325%)

Read2 after filtering:
total reads: 62463
total bases: 8985777
Q20 bases: 8778756(97.6961%)
Q30 bases: 8463159(94.1839%)
Q40 bases: 8463159(94.1839%)

Filtering result:
reads passed filter: 124926
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20693
bases trimmed due to adapters: 767803

Duplication rate: 1.13345%

Insert size peak (evaluated by paired-end reads): 206

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L005_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L005_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds