Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/78/9e1c7e6eb1a2bad42bf19a3c618774/output/HCC1395_BL_S2_L004_R2_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/af/ef9771c440cc66b1c95e3ff817ac73/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/af/ef9771c440cc66b1c95e3ff817ac73/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/78/9e1c7e6eb1a2bad42bf19a3c618774/output/HCC1395_BL_S2_L004_R1_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62592
total bases: 9388800
Q20 bases: 9222586(98.2297%)
Q30 bases: 8899161(94.7849%)
Q40 bases: 8899161(94.7849%)

Read2 before filtering:
total reads: 62592
total bases: 9388800
Q20 bases: 9159786(97.5608%)
Q30 bases: 8759731(93.2998%)
Q40 bases: 8759731(93.2998%)

Read1 after filtering:
total reads: 62591
total bases: 9033506
Q20 bases: 8903881(98.5651%)
Q30 bases: 8611780(95.3315%)
Q40 bases: 8611780(95.3315%)

Read2 after filtering:
total reads: 62591
total bases: 9033951
Q20 bases: 8839366(97.8461%)
Q30 bases: 8477631(93.8419%)
Q40 bases: 8477631(93.8419%)

Filtering result:
reads passed filter: 125182
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19274
bases trimmed due to adapters: 709907

Duplication rate: 0.905867%

Insert size peak (evaluated by paired-end reads): 169

JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html

fastp --in1 HCC1395_BL_S2_L004_R1_001.fastq.gz --in2 HCC1395_BL_S2_L004_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 
fastp v1.0.1, time used: 1 seconds