Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ec/5681556aa9e5f32035ff46b294af98/output/HCC1395_tumor_S1_L007_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/78/d3f3ca2f9a6e3713d0981d788aedef/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/78/d3f3ca2f9a6e3713d0981d788aedef/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ec/5681556aa9e5f32035ff46b294af98/output/HCC1395_tumor_S1_L007_R2_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62563 total bases: 9384450 Q20 bases: 9227471(98.3272%) Q30 bases: 8934730(95.2078%) Q40 bases: 8934730(95.2078%) Read2 before filtering: total reads: 62563 total bases: 9384450 Q20 bases: 9132385(97.314%) Q30 bases: 8775018(93.5059%) Q40 bases: 8775018(93.5059%) Read1 after filtering: total reads: 62562 total bases: 8999755 Q20 bases: 8885037(98.7253%) Q30 bases: 8623089(95.8147%) Q40 bases: 8623089(95.8147%) Read2 after filtering: total reads: 62562 total bases: 9000113 Q20 bases: 8791274(97.6796%) Q30 bases: 8474935(94.1648%) Q40 bases: 8474935(94.1648%) Filtering result: reads passed filter: 125124 reads failed due to low quality: 2 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20846 bases trimmed due to adapters: 768836 Duplication rate: 1.14285% Insert size peak (evaluated by paired-end reads): 167 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L007_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L007_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds