File Info

Filename
Sig_18_Blood.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/80/9b9502df8004c5cdba549f22578148/Sig_18_Blood.fastp.log
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62697
total bases: 9404550
Q20 bases: 9239747(98.2476%)
Q30 bases: 8925255(94.9036%)
Q40 bases: 8925255(94.9036%)

Read2 before filtering:
total reads: 62697
total bases: 9404550
Q20 bases: 9167509(97.4795%)
Q30 bases: 8764372(93.1929%)
Q40 bases: 8764372(93.1929%)

Read1 after filtering:
total reads: 62697
total bases: 9089045
Q20 bases: 8959404(98.5737%)
Q30 bases: 8668812(95.3765%)
Q40 bases: 8668812(95.3765%)

Read2 after filtering:
total reads: 62697
total bases: 9089311
Q20 bases: 8883146(97.7318%)
Q30 bases: 8513818(93.6685%)
Q40 bases: 8513818(93.6685%)

Filtering result:
reads passed filter: 125394
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17752
bases trimmed due to adapters: 630744

Duplication rate: 0.87564%

Insert size peak (evaluated by paired-end reads): 261

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L001_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L001_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds