{ "report_data_sources": { "Kallisto": { "all_sections": { "rna_s1221_S42_1": "/tmp/nxf.tG4QzmekYC/16/rna_s1221_S42.log", "rna_s1200_S21_1": "/tmp/nxf.tG4QzmekYC/15/rna_s1200_S21.log" } }, "Picard": { "InsertSizeMetrics": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/21/rna_s1200_S21_collectinsertsize.txt", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/22/rna_s1221_S42_collectinsertsize.txt" }, "DuplicationMetrics": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/37/rna_s1200_S21.md.bam.metrics", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/38/rna_s1221_S42.md.bam.metrics" }, "RnaSeqMetrics": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/52/rna_s1200_S21_rna_metrics.txt", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/51/rna_s1221_S42_rna_metrics.txt" } }, "Preseq": { "all_sections": { "rna_s1200_S21.lc_extrap": "/tmp/nxf.tG4QzmekYC/27/rna_s1200_S21.lc_extrap.txt", "rna_s1221_S42.lc_extrap": "/tmp/nxf.tG4QzmekYC/28/rna_s1221_S42.lc_extrap.txt" } }, "RSeQC": { "read_distribution": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/39/rna_s1200_S21.read_distribution.txt", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/40/rna_s1221_S42.read_distribution.txt" }, "inner_distance": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/35/rna_s1200_S21.inner_distance_freq.txt", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/36/rna_s1221_S42.inner_distance_freq.txt" }, "read_duplication": { "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/48/rna_s1221_S42.pos.DupRate.xls", "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/47/rna_s1200_S21.pos.DupRate.xls" }, "junction_annotation": { "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/46/rna_s1221_S42.junction_annotation.log", "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/45/rna_s1200_S21.junction_annotation.log" }, "junction_saturation": { "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/42/rna_s1221_S42.junctionSaturation_plot.r", "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/41/rna_s1200_S21.junctionSaturation_plot.r" }, "infer_experiment": { "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/34/rna_s1221_S42.infer_experiment.txt", "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/33/rna_s1200_S21.infer_experiment.txt" }, "bam_stat": { "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/32/rna_s1221_S42.bam_stat.txt", "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/31/rna_s1200_S21.bam_stat.txt" } }, "STAR": { "SummaryLog": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/17/rna_s1200_S21.Log.final.out", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/18/rna_s1221_S42.Log.final.out" }, "ReadsPerGene": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/19/rna_s1200_S21.ReadsPerGene.out.tab", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/20/rna_s1221_S42.ReadsPerGene.out.tab" } }, "fastp": { "all_sections": { "rna_s1200_S21": "/tmp/nxf.tG4QzmekYC/5/rna_s1200_S21.fastp.json", "rna_s1221_S42": "/tmp/nxf.tG4QzmekYC/6/rna_s1221_S42.fastp.json" } }, "FastQC (raw)": { "all_sections": { "rna_s1221_S42_trimmed_1": "/tmp/nxf.tG4QzmekYC/13/rna_s1221_S42_trimmed_1_fastqc.zip", "rna_s1200_S21_trimmed_2": "/tmp/nxf.tG4QzmekYC/12/rna_s1200_S21_trimmed_2_fastqc.zip", "rna_s1221_S42_1": "/tmp/nxf.tG4QzmekYC/9/rna_s1221_S42_1_fastqc.zip", "rna_s1200_S21_1": "/tmp/nxf.tG4QzmekYC/7/rna_s1200_S21_1_fastqc.zip", "rna_s1221_S42_trimmed_2": "/tmp/nxf.tG4QzmekYC/14/rna_s1221_S42_trimmed_2_fastqc.zip", "rna_s1221_S42_2": "/tmp/nxf.tG4QzmekYC/10/rna_s1221_S42_2_fastqc.zip", "rna_s1200_S21_trimmed_1": "/tmp/nxf.tG4QzmekYC/11/rna_s1200_S21_trimmed_1_fastqc.zip", "rna_s1200_S21_2": "/tmp/nxf.tG4QzmekYC/8/rna_s1200_S21_2_fastqc.zip" } }, "FastQC (trimmed)": { "all_sections": { "rna_s1221_S42_trimmed_1": "/tmp/nxf.tG4QzmekYC/13/rna_s1221_S42_trimmed_1_fastqc.zip", "rna_s1200_S21_trimmed_2": "/tmp/nxf.tG4QzmekYC/12/rna_s1200_S21_trimmed_2_fastqc.zip", "rna_s1221_S42_trimmed_2": "/tmp/nxf.tG4QzmekYC/14/rna_s1221_S42_trimmed_2_fastqc.zip", "rna_s1200_S21_trimmed_1": "/tmp/nxf.tG4QzmekYC/11/rna_s1200_S21_trimmed_1_fastqc.zip" } } }, "report_general_stats_data": [ { "rna_s1221_S42": { "fragment_length_mean": 175.9, "fragment_length_median": 160.0, "pct_mito_est_counts": 0.01, "pct_ribo_est_counts": 4.71, "pct_hk_est_counts": 2.83, "pct_male_est_counts": 0.0, "pct_mito_tpm": 0.01, "pct_ribo_tpm": 11.32, "pct_hk_tpm": 3.19, "pct_male_tpm": 0.0 }, "rna_s1200_S21": { "fragment_length_mean": 180.9, "fragment_length_median": 166.0, "pct_mito_est_counts": 0.0, "pct_ribo_est_counts": 4.58, "pct_hk_est_counts": 2.97, "pct_male_est_counts": 0.0, "pct_mito_tpm": 0.0, "pct_ribo_tpm": 10.89, "pct_hk_tpm": 3.45, "pct_male_tpm": 0.0 } }, { "rna_s1200_S21": { "total_reads": 9999000000.0, "expected_distinct": 53979070.0 }, "rna_s1221_S42": { "total_reads": 9999000000.0, "expected_distinct": 53000545.0 } }, { "rna_s1200_S21": { "reads": 19875412.0, "frac_unmapped": 0.003853, "frac_dupes": 0.183621, "unique_reads": 16225876.0, "frac_reads_on_target": 0.945347, "frac_pairs_on_target": 0.972121, "frac_reads_off_target": 0.049933, "frac_pairs_off_target": 0.027879, "reads_on_target": 15339088.0, "pairs_on_target": 7832369.0, "reads_off_target": 810206.0, "pairs_off_target": 224622.0, "mean_depth": 34.559207, "q50_depth": 5.0, "frac_bases_gt30x": 0.293198, "frac_bases_gt100x": 0.084685, "n_q30": 0.985625, "gc_bias": 0.0 }, "rna_s1221_S42": { "reads": 19864012.0, "frac_unmapped": 0.004391, "frac_dupes": 0.198705, "unique_reads": 15916933.0, "frac_reads_on_target": 0.936077, "frac_pairs_on_target": 0.962008, "frac_reads_off_target": 0.058443, "frac_pairs_off_target": 0.037992, "reads_on_target": 14899481.0, "pairs_on_target": 7595968.0, "reads_off_target": 930229.0, "pairs_off_target": 299983.0, "mean_depth": 32.870035, "q50_depth": 5.0, "frac_bases_gt30x": 0.28172, "frac_bases_gt100x": 0.079333, "n_q30": 0.98502, "gc_bias": 0.0 } }, { "rna_s1200_S21": { "is_contaminated": "Skipped", "contamination_pct": "N/A" }, "rna_s1221_S42": { "is_contaminated": "Skipped", "contamination_pct": "N/A" } }, { "rna_s1221_S42_1": { "total_reads": 9932006.0, "pseudoaligned_reads": 9571272.0, "not_pseudoaligned_reads": 360734.0, "percent_aligned": 96.36796433671103, "fragment_length": 175.9 }, "rna_s1200_S21_1": { "total_reads": 9937706.0, "pseudoaligned_reads": 9721684.0, "not_pseudoaligned_reads": 216022.0, "percent_aligned": 97.82623877180508, "fragment_length": 180.9 } }, { "rna_s1200_S21": { "total_count": 8310748, "meansum": 7531718528.091776, "total_pairs": 9881192.0, "summed_mean": 762.227728, "summed_median": 294 }, "rna_s1221_S42": { "total_count": 8126131, "meansum": 6522725284.939242, "total_pairs": 9867787.0, "summed_mean": 661.011966, "summed_median": 255 } }, { "rna_s1200_S21": { "LIBRARY": "Unknown Library", "UNPAIRED_READS_EXAMINED": 2.0, "READ_PAIRS_EXAMINED": 9899414.0, "SECONDARY_OR_SUPPLEMENTARY_RDS": 1326011.0, "UNMAPPED_READS": 76582.0, "UNPAIRED_READ_DUPLICATES": 2.0, "READ_PAIR_DUPLICATES": 1824767.0, "READ_PAIR_OPTICAL_DUPLICATES": 12067.0, "PERCENT_DUPLICATION": 0.184331, "ESTIMATED_LIBRARY_SIZE": 23557470.0, "READS_IN_DUPLICATE_PAIRS": 3649534.0, "READS_IN_UNIQUE_PAIRS": 16149294.0, "READS_IN_UNIQUE_UNPAIRED": 0.0, "READS_IN_DUPLICATE_PAIRS_OPTICAL": 24134.0, "READS_IN_DUPLICATE_PAIRS_NONOPTICAL": 3625400.0, "READS_IN_DUPLICATE_UNPAIRED": 2.0, "READS_UNMAPPED": 76582.0 }, "rna_s1221_S42": { "LIBRARY": "Unknown Library", "UNPAIRED_READS_EXAMINED": 3.0, "READ_PAIRS_EXAMINED": 9888393.0, "SECONDARY_OR_SUPPLEMENTARY_RDS": 3584450.0, "UNMAPPED_READS": 87223.0, "UNPAIRED_READ_DUPLICATES": 3.0, "READ_PAIR_DUPLICATES": 1973538.0, "READ_PAIR_OPTICAL_DUPLICATES": 18255.0, "PERCENT_DUPLICATION": 0.199581, "ESTIMATED_LIBRARY_SIZE": 21499970.0, "READS_IN_DUPLICATE_PAIRS": 3947076.0, "READS_IN_UNIQUE_PAIRS": 15829710.0, "READS_IN_UNIQUE_UNPAIRED": 0.0, "READS_IN_DUPLICATE_PAIRS_OPTICAL": 36510.0, "READS_IN_DUPLICATE_PAIRS_NONOPTICAL": 3910566.0, "READS_IN_DUPLICATE_UNPAIRED": 3.0, "READS_UNMAPPED": 87223.0 } }, { "rna_s1200_S21": { "PF_BASES": 2795883347.0, "PF_ALIGNED_BASES": 2772797282.0, "RIBOSOMAL_BASES": 300.0, "CODING_BASES": 2470896529.0, "UTR_BASES": 201902141.0, "INTRONIC_BASES": 86792356.0, "INTERGENIC_BASES": 13205956.0, "IGNORED_READS": 0.0, "CORRECT_STRAND_READS": 0.0, "INCORRECT_STRAND_READS": 0.0, "NUM_R1_TRANSCRIPT_STRAND_READS": 128383.0, "NUM_R2_TRANSCRIPT_STRAND_READS": 8100715.0, "NUM_UNEXPLAINED_READS": 41447.0, "PCT_R1_TRANSCRIPT_STRAND_READS": 1.5601, "PCT_R2_TRANSCRIPT_STRAND_READS": 98.43990000000001, "PCT_RIBOSOMAL_BASES": 0.0, "PCT_CODING_BASES": 89.1121, "PCT_UTR_BASES": 7.2815, "PCT_INTRONIC_BASES": 3.1301, "PCT_INTERGENIC_BASES": 0.4763, "PCT_MRNA_BASES": 96.3936, "PCT_USABLE_BASES": 95.5976, "PCT_CORRECT_STRAND_READS": 0.0, "MEDIAN_CV_COVERAGE": 0.563571, "MEDIAN_5PRIME_BIAS": 0.543049, "MEDIAN_3PRIME_BIAS": 0.68164, "MEDIAN_5PRIME_TO_3PRIME_BIAS": 0.755191, "SAMPLE": "NA", "LIBRARY": "NA", "READ_GROUP": "NA", "PF_NOT_ALIGNED_BASES": 23086065.0 }, "rna_s1221_S42": { "PF_BASES": 2754287345.0, "PF_ALIGNED_BASES": 2727550835.0, "RIBOSOMAL_BASES": 2380143.0, "CODING_BASES": 2400643463.0, "UTR_BASES": 197498918.0, "INTRONIC_BASES": 94951215.0, "INTERGENIC_BASES": 32077096.0, "IGNORED_READS": 0.0, "CORRECT_STRAND_READS": 0.0, "INCORRECT_STRAND_READS": 0.0, "NUM_R1_TRANSCRIPT_STRAND_READS": 82025.0, "NUM_R2_TRANSCRIPT_STRAND_READS": 8016569.0, "NUM_UNEXPLAINED_READS": 44319.0, "PCT_R1_TRANSCRIPT_STRAND_READS": 1.0128, "PCT_R2_TRANSCRIPT_STRAND_READS": 98.9872, "PCT_RIBOSOMAL_BASES": 0.0873, "PCT_CODING_BASES": 88.0146, "PCT_UTR_BASES": 7.2409, "PCT_INTRONIC_BASES": 3.4812000000000003, "PCT_INTERGENIC_BASES": 1.176, "PCT_MRNA_BASES": 95.2555, "PCT_USABLE_BASES": 94.33080000000001, "PCT_CORRECT_STRAND_READS": 0.0, "MEDIAN_CV_COVERAGE": 0.579755, "MEDIAN_5PRIME_BIAS": 0.568567, "MEDIAN_3PRIME_BIAS": 0.670525, "MEDIAN_5PRIME_TO_3PRIME_BIAS": 0.715967, "SAMPLE": "NA", "LIBRARY": "NA", "READ_GROUP": "NA", "PF_NOT_ALIGNED_BASES": 26736510.0 } }, { "rna_s1221_S42": { "total_records": 23448462, "qc_failed": 0, "optical_pcr_duplicate": 0, "non_primary_hits": 3505214, "unmapped_reads": 87223, "mapq_lt_mapq_cut_non-unique": 991412, "mapq_gte_mapq_cut_unique": 18864613, "read_1": 9436036, "read_2": 9428577, "reads_map_to_sense": 9432352, "reads_map_to_antisense": 9432261, "non-splice_reads": 8963248, "splice_reads": 9901365, "reads_mapped_in_proper_pairs": 18817394, "proper-paired_reads_map_to_different_chrom": 0, "unique_percent": 80.45138738736894, "proper_pairs_percent": 80.25001383886074 }, "rna_s1200_S21": { "total_records": 21201423, "qc_failed": 0, "optical_pcr_duplicate": 0, "non_primary_hits": 1266553, "unmapped_reads": 76582, "mapq_lt_mapq_cut_non-unique": 658159, "mapq_gte_mapq_cut_unique": 19200129, "read_1": 9603113, "read_2": 9597016, "reads_map_to_sense": 9600541, "reads_map_to_antisense": 9599588, "non-splice_reads": 8867379, "splice_reads": 10332750, "reads_mapped_in_proper_pairs": 19152518, "proper-paired_reads_map_to_different_chrom": 0, "unique_percent": 90.56056756190375, "proper_pairs_percent": 90.33600244662823 } }, { "rna_s1200_S21": { "total_reads": 9937706.0, "avg_input_read_length": 281.0, "uniquely_mapped": 9534804.0, "uniquely_mapped_percent": 95.95, "avg_mapped_read_length": 280.54, "num_splices": 11712172.0, "num_annotated_splices": 11589231.0, "num_GTAG_splices": 11611303.0, "num_GCAG_splices": 80521.0, "num_ATAC_splices": 10119.0, "num_noncanonical_splices": 10229.0, "mismatch_rate": 0.15, "deletion_rate": 0.0, "deletion_length": 1.13, "insertion_rate": 0.0, "insertion_length": 2.11, "multimapped": 286932.0, "multimapped_percent": 2.89, "multimapped_toomany": 513.0, "multimapped_toomany_percent": 0.01, "unmapped_mismatches_percent": 0.17, "unmapped_tooshort_percent": 0.41, "unmapped_other_percent": 0.08, "unmapped_mismatches": 29739, "unmapped_tooshort": 71723, "unmapped_other": 13995 }, "rna_s1221_S42": { "total_reads": 9932006.0, "avg_input_read_length": 276.0, "uniquely_mapped": 9368114.0, "uniquely_mapped_percent": 94.32, "avg_mapped_read_length": 276.81, "num_splices": 11191802.0, "num_annotated_splices": 11077176.0, "num_GTAG_splices": 11091104.0, "num_GCAG_splices": 80198.0, "num_ATAC_splices": 10029.0, "num_noncanonical_splices": 10471.0, "mismatch_rate": 0.15, "deletion_rate": 0.0, "deletion_length": 1.14, "insertion_rate": 0.0, "insertion_length": 2.1, "multimapped": 420440.0, "multimapped_percent": 4.23, "multimapped_toomany": 918.0, "multimapped_toomany_percent": 0.01, "unmapped_mismatches_percent": 0.17, "unmapped_tooshort_percent": 0.54, "unmapped_other_percent": 0.08, "unmapped_mismatches": 30672, "unmapped_tooshort": 97428, "unmapped_other": 14434 } }, { "rna_s1200_S21": { "filtering_result_passed_filter_reads": 19875412.0, "filtering_result_low_quality_reads": 124550.0, "filtering_result_too_many_N_reads": 0.0, "filtering_result_too_short_reads": 38.0, "filtering_result_too_long_reads": 0.0, "pct_duplication": 13.3191, "after_filtering_total_reads": 19875412.0, "after_filtering_total_bases": 2793257490.0, "after_filtering_q20_bases": 2780500198.0, "after_filtering_q30_bases": 2750334612.0, "after_filtering_q20_rate": 0.995433, "after_filtering_q30_rate": 0.984633, "after_filtering_read1_mean_length": 140.0, "after_filtering_read2_mean_length": 140.0, "after_filtering_gc_content": 0.535761, "before_filtering_total_reads": 20000000.0, "pct_surviving": 99.37706, "adapter_cutting_adapter_trimmed_reads": 6547787.0, "adapter_cutting_adapter_trimmed_bases": 188610493.0, "pct_adapter": 32.738935000000005 }, "rna_s1221_S42": { "filtering_result_passed_filter_reads": 19864012.0, "filtering_result_low_quality_reads": 135928.0, "filtering_result_too_many_N_reads": 0.0, "filtering_result_too_short_reads": 60.0, "filtering_result_too_long_reads": 0.0, "pct_duplication": 13.947899999999999, "after_filtering_total_reads": 19864012.0, "after_filtering_total_bases": 2750073323.0, "after_filtering_q20_bases": 2736635705.0, "after_filtering_q30_bases": 2705779238.0, "after_filtering_q20_rate": 0.995114, "after_filtering_q30_rate": 0.983893, "after_filtering_read1_mean_length": 138.0, "after_filtering_read2_mean_length": 138.0, "after_filtering_gc_content": 0.533166, "before_filtering_total_reads": 20000000.0, "pct_surviving": 99.32006, "adapter_cutting_adapter_trimmed_reads": 7366518.0, "adapter_cutting_adapter_trimmed_bases": 230290481.0, "pct_adapter": 36.832589999999996 } }, { "rna_s1221_S42_trimmed_1": { "percent_gc": 53.0, "avg_sequence_length": 138.4228959386452, "median_sequence_length": 150, "total_sequences": 9932006.0, "percent_duplicates": 58.26617657347452, "percent_fails": 18.181818181818183 }, "rna_s1200_S21_trimmed_2": { "percent_gc": 53.0, "avg_sequence_length": 140.53251514987463, "median_sequence_length": 150, "total_sequences": 9937706.0, "percent_duplicates": 51.30826279941934, "percent_fails": 9.090909090909092 }, "rna_s1221_S42_1": { "percent_gc": 52.0, "avg_sequence_length": 150.0, "median_sequence_length": 150, "total_sequences": 10000000.0, "percent_duplicates": 58.16307867114451, "percent_fails": 27.27272727272727 }, "rna_s1200_S21_1": { "percent_gc": 53.0, "avg_sequence_length": 150.0, "median_sequence_length": 150, "total_sequences": 10000000.0, "percent_duplicates": 55.25002152063861, "percent_fails": 27.27272727272727 }, "rna_s1221_S42_trimmed_2": { "percent_gc": 53.0, "avg_sequence_length": 138.44541374622608, "median_sequence_length": 150, "total_sequences": 9932006.0, "percent_duplicates": 52.77153448748192, "percent_fails": 9.090909090909092 }, "rna_s1221_S42_2": { "percent_gc": 53.0, "avg_sequence_length": 150.0, "median_sequence_length": 150, "total_sequences": 10000000.0, "percent_duplicates": 52.65069232510231, "percent_fails": 18.181818181818183 }, "rna_s1200_S21_trimmed_1": { "percent_gc": 53.0, "avg_sequence_length": 140.52089164239715, "median_sequence_length": 150, "total_sequences": 9937706.0, "percent_duplicates": 55.31816418825391, "percent_fails": 18.181818181818183 }, "rna_s1200_S21_2": { "percent_gc": 53.0, "avg_sequence_length": 150.0, "median_sequence_length": 150, "total_sequences": 10000000.0, "percent_duplicates": 51.18582796474035, "percent_fails": 18.181818181818183 } }, { "rna_s1221_S42_trimmed_1": { "percent_gc": 53.0, "avg_sequence_length": 138.4228959386452, "median_sequence_length": 150, "total_sequences": 9932006.0, "percent_duplicates": 58.26617657347452, "percent_fails": 18.181818181818183 }, "rna_s1200_S21_trimmed_2": { "percent_gc": 53.0, "avg_sequence_length": 140.53251514987463, "median_sequence_length": 150, "total_sequences": 9937706.0, "percent_duplicates": 51.30826279941934, "percent_fails": 9.090909090909092 }, "rna_s1221_S42_trimmed_2": { "percent_gc": 53.0, "avg_sequence_length": 138.44541374622608, "median_sequence_length": 150, "total_sequences": 9932006.0, "percent_duplicates": 52.77153448748192, "percent_fails": 9.090909090909092 }, "rna_s1200_S21_trimmed_1": { "percent_gc": 53.0, "avg_sequence_length": 140.52089164239715, "median_sequence_length": 150, "total_sequences": 9937706.0, "percent_duplicates": 55.31816418825391, "percent_fails": 18.181818181818183 } } ], "report_general_stats_headers": [ { "fragment_length_mean": { "namespace": "Custom content: Kallisto", "title": "Fragment Length Mean", "description": "Mean fragment length from kallisto fragment length distribution", "format": "{:,.1f}", "min": 0, "suffix": " bp", "rid": "mqc-generalstats-custom_content_kallisto-fragment_length_mean", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 180.9, "dmin": 0.0 }, "fragment_length_median": { "namespace": "Custom content: Kallisto", "title": "Fragment Length Median", "description": "Median fragment length from kallisto fragment length distribution", "format": "{:,.1f}", "min": 0, "suffix": " bp", "rid": "mqc-generalstats-custom_content_kallisto-fragment_length_median", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 166.0, "dmin": 0.0 }, "pct_mito_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Mito est. counts", "description": "Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0.01, "dmin": 0 }, "pct_ribo_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Ribo est. counts", "description": "Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 4.71, "dmin": 0 }, "pct_hk_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Housekeeping est. counts", "description": "Percentage of estimated counts from housekeeping genes.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 2.97, "dmin": 0 }, "pct_male_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Male est. counts", "format": "{:,.2f}", "suffix": "%", "description": "pct Male est. counts", "rid": "mqc-generalstats-custom_content_expression_qc-pct_male_est_counts", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0, "dmin": 0 }, "pct_mito_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Mito TPM", "description": "Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_mito_tpm", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0.01, "dmin": 0 }, "pct_ribo_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Ribo TPM", "description": "Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 11.32, "dmin": 0 }, "pct_hk_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Housekeeping TPM", "description": "Percentage of TPM from housekeeping genes.", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_expression_qc-pct_hk_tpm", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 3.45, "dmin": 0 }, "pct_male_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Male TPM", "format": "{:,.2f}", "suffix": "%", "description": "pct Male TPM", "rid": "mqc-generalstats-custom_content_expression_qc-pct_male_tpm", "scale": "GnBu", "colour": "55,126,184", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0, "dmin": 0 } }, { "total_reads": { "namespace": "Custom content: Preseq", "title": "Total Reads", "description": "Total reads from preseq analysis", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_preseq-total_reads", "scale": "GnBu", "colour": "77,175,74", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 9999000000.0, "dmin": 0.0 }, "expected_distinct": { "namespace": "Custom content: Preseq", "title": "Expected Distinct", "description": "Expected distinct molecules at maximum sequencing depth", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_preseq-expected_distinct", "scale": "GnBu", "colour": "77,175,74", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 53979070.0, "dmin": 0.0 } }, { "reads": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads", "description": "SeqTools (general stats) — reads", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-reads", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 19875412.0, "dmin": 0.0 }, "frac_unmapped": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Unmapped", "description": "SeqTools (general stats) — frac unmapped", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "frac_dupes": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Dupes", "description": "SeqTools (general stats) — frac dupes", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "unique_reads": { "namespace": "Custom content: SeqTools (general stats)", "title": "Unique Reads", "description": "SeqTools (general stats) — unique reads", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-unique_reads", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 16225876.0, "dmin": 0.0 }, "frac_reads_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Reads On Target", "description": "SeqTools (general stats) — frac reads on target", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "frac_pairs_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Pairs On Target", "description": "SeqTools (general stats) — frac pairs on target", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "frac_reads_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Reads Off Target", "description": "SeqTools (general stats) — frac reads off target", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "frac_pairs_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Pairs Off Target", "description": "SeqTools (general stats) — frac pairs off target", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "reads_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads On Target", "description": "SeqTools (general stats) — reads on target", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 15339088.0, "dmin": 0.0 }, "pairs_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Pairs On Target", "description": "SeqTools (general stats) — pairs on target", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 7832369.0, "dmin": 0.0 }, "reads_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads Off Target", "description": "SeqTools (general stats) — reads off target", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 930229.0, "dmin": 0.0 }, "pairs_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Pairs Off Target", "description": "SeqTools (general stats) — pairs off target", "format": "{:,.0f}", "min": 0, "rid": "mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 299983.0, "dmin": 0.0 }, "mean_depth": { "namespace": "Custom content: SeqTools (general stats)", "title": "Mean Depth", "description": "SeqTools (general stats) — mean depth", "format": "{:,.2f}", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-mean_depth", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 34.559207, "dmin": 0 }, "q50_depth": { "namespace": "Custom content: SeqTools (general stats)", "title": "Q50 Depth", "description": "SeqTools (general stats) — q50 depth", "format": "{:,.2f}", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-q50_depth", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 5.0, "dmin": 0 }, "frac_bases_gt30x": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Bases Gt30X", "description": "SeqTools (general stats) — frac bases gt30x", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "frac_bases_gt100x": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Bases Gt100X", "description": "SeqTools (general stats) — frac bases gt100x", "format": "{:,.2f}", "suffix": "%", "max": 100, "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "n_q30": { "namespace": "Custom content: SeqTools (general stats)", "title": "N Q30", "description": "SeqTools (general stats) — n q30", "format": "{:,.2f}", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-n_q30", "scale": "GnBu", "colour": "152,78,163", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0.985625, "dmin": 0 }, "gc_bias": { "namespace": "Custom content: SeqTools (general stats)", "title": "GC Bias", "description": "SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads", "format": "{:,.3f}", "min": 0, "scale": "RdYlGn", "rid": "mqc-generalstats-custom_content_seqtools_general_stats-gc_bias", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0, "dmin": 0.0 } }, { "is_contaminated": { "namespace": "Custom content: RNA contamination", "title": "RNA contaminated", "description": "Whether the sample was classified as contaminated from VAF_p90", "rid": "mqc-generalstats-custom_content_rna_contamination-is_contaminated", "scale": "GnBu", "format": "{:,.1f}", "colour": "255,127,0", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0, "dmin": 0 }, "contamination_pct": { "namespace": "Custom content: RNA contamination", "title": "RNA contamination %", "description": "Estimated RNA contamination from VAF_p90; 0% for samples classified as clean", "format": "{:,.2f}", "suffix": "%", "rid": "mqc-generalstats-custom_content_rna_contamination-contamination_pct", "scale": "GnBu", "colour": "255,127,0", "hidden": null, "max": null, "min": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 0, "dmin": 0 } }, { "fragment_length": { "title": "Frag Length", "description": "Estimated average fragment length", "min": 0, "suffix": "bp", "scale": "RdYlGn", "namespace": "Kallisto", "rid": "mqc-generalstats-kallisto-fragment_length", "format": "{:,.1f}", "colour": "228,26,28", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 180.9, "dmin": 0.0 }, "percent_aligned": { "title": "% Aligned", "description": "% processed reads that were pseudoaligned", "max": 100, "min": 0, "suffix": "%", "scale": "YlGn", "namespace": "Kallisto", "rid": "mqc-generalstats-kallisto-percent_aligned", "format": "{:,.1f}", "colour": "228,26,28", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "pseudoaligned_reads": { "title": "M Aligned", "description": "Pseudoaligned reads (millions)", "min": 0, "scale": "PuRd", "modify": 1e-06, "shared_key": "read_count", "namespace": "Kallisto", "rid": "mqc-generalstats-kallisto-pseudoaligned_reads", "suffix": " M", "format": "{:,.1f}", "colour": "228,26,28", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 19.875412, "dmin": 0.0 } }, { "summed_median": { "title": "Insert Size", "description": "Median Insert Size, all read orientations (bp)", "min": 0, "suffix": " bp", "format": "{:,.0f}", "scale": "GnBu", "namespace": "Picard: InsertSizeMetrics", "rid": "mqc-generalstats-picard_insertsizemetrics-summed_median", "colour": "179,179,50", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 294.0, "dmin": 0.0 }, "summed_mean": { "title": "Mean Insert Size", "description": "Mean Insert Size, all read orientations (bp)", "min": 0, "suffix": " bp", "format": "{:,.0f}", "scale": "GnBu", "hidden": true, "namespace": "Picard: InsertSizeMetrics", "rid": "mqc-generalstats-picard_insertsizemetrics-summed_mean", "colour": "179,179,50", "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 762.227728, "dmin": 0.0 } }, { "PERCENT_DUPLICATION": { "title": "Duplication", "description": "Mark Duplicates - Percent Duplication", "max": 100, "min": 0, "suffix": "%", "scale": "OrRd", "modify": 100.0, "namespace": "Picard: Mark Duplicates", "rid": "mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION", "format": "{:,.1f}", "colour": "166,86,40", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 } }, { "PCT_RIBOSOMAL_BASES": { "title": "rRNA", "description": "Percent of aligned bases overlapping ribosomal RNA regions", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "namespace": "Picard: RnaSeqMetrics", "rid": "mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES", "format": "{:,.1f}", "colour": "247,129,191", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "PCT_MRNA_BASES": { "title": "mRNA", "description": "Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts", "max": 100, "min": 0, "suffix": "%", "scale": "Greens", "namespace": "Picard: RnaSeqMetrics", "rid": "mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES", "format": "{:,.1f}", "colour": "247,129,191", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 } }, { "proper_pairs_percent": { "title": "% Proper Pairs", "description": "% Reads mapped in proper pairs", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn", "namespace": "RSeQC", "rid": "mqc-generalstats-rseqc-proper_pairs_percent", "format": "{:,.1f}", "colour": "153,153,153", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 } }, { "uniquely_mapped_percent": { "title": "% Aligned", "description": "% Uniquely mapped reads", "max": 100, "min": 0, "suffix": "%", "scale": "YlGn", "namespace": "STAR", "rid": "mqc-generalstats-star-uniquely_mapped_percent", "format": "{:,.1f}", "colour": "55,126,184", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "uniquely_mapped": { "title": "M Aligned", "description": "Uniquely mapped reads (millions)", "min": 0, "scale": "PuRd", "modify": 1e-06, "shared_key": "read_count", "namespace": "STAR", "rid": "mqc-generalstats-star-uniquely_mapped", "suffix": " M", "format": "{:,.1f}", "colour": "55,126,184", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 19.875412, "dmin": 0.0 } }, { "pct_duplication": { "title": "% Duplication", "description": "Duplication rate before filtering", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "fastp", "rid": "mqc-generalstats-fastp-pct_duplication", "format": "{:,.1f}", "colour": "77,175,74", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "after_filtering_q30_rate": { "title": "% > Q30", "description": "Percentage of reads > Q30 after filtering", "min": 0, "max": 100, "modify": 100.0, "scale": "GnBu", "suffix": "%", "hidden": true, "namespace": "fastp", "rid": "mqc-generalstats-fastp-after_filtering_q30_rate", "format": "{:,.1f}", "colour": "77,175,74", "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "after_filtering_q30_bases": { "title": "Mb Q30 bases", "description": "Bases > Q30 after filtering (millions)", "min": 0, "modify": 1e-06, "scale": "GnBu", "shared_key": "base_count", "hidden": true, "namespace": "fastp", "rid": "mqc-generalstats-fastp-after_filtering_q30_bases", "suffix": " Mb", "format": "{:,.1f}", "colour": "77,175,74", "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 2750.3346119999997, "dmin": 0.0 }, "filtering_result_passed_filter_reads": { "title": "M Reads After Filtering", "description": "Total reads after filtering (millions)", "min": 0, "scale": "Blues", "modify": 1e-06, "shared_key": "read_count", "namespace": "fastp", "rid": "mqc-generalstats-fastp-filtering_result_passed_filter_reads", "suffix": " M", "format": "{:,.1f}", "colour": "77,175,74", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 19.875412, "dmin": 0.0 }, "after_filtering_gc_content": { "title": "GC content", "description": "GC content after filtering", "max": 100, "min": 0, "suffix": "%", "scale": "Blues", "modify": 100.0, "namespace": "fastp", "rid": "mqc-generalstats-fastp-after_filtering_gc_content", "format": "{:,.1f}", "colour": "77,175,74", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "pct_surviving": { "title": "% PF", "description": "Percent reads passing filter", "max": 100, "min": 0, "suffix": "%", "scale": "BuGn", "namespace": "fastp", "rid": "mqc-generalstats-fastp-pct_surviving", "format": "{:,.1f}", "colour": "77,175,74", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "pct_adapter": { "title": "% Adapter", "description": "Percentage adapter-trimmed reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "fastp", "rid": "mqc-generalstats-fastp-pct_adapter", "format": "{:,.1f}", "colour": "77,175,74", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 } }, { "percent_duplicates": { "title": "% Dups", "description": "% Duplicate Reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-percent_duplicates", "format": "{:,.1f}", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "percent_gc": { "title": "% GC", "description": "Average % GC Content", "max": 100, "min": 0, "suffix": "%", "scale": "PuRd", "format": "{:,.0f}", "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-percent_gc", "colour": "152,78,163", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "avg_sequence_length": { "title": "Average Read Length", "description": "Average Read Length (bp)", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-avg_sequence_length", "colour": "152,78,163", "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 150.0, "dmin": 0.0 }, "median_sequence_length": { "title": "Median Read Length", "description": "Median Read Length (bp)", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-median_sequence_length", "colour": "152,78,163", "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 150.0, "dmin": 0.0 }, "percent_fails": { "title": "% Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-percent_fails", "colour": "152,78,163", "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "total_sequences": { "title": "M Seqs", "description": "Total Sequences (millions)", "min": 0, "scale": "Blues", "modify": 1e-06, "shared_key": "read_count", "namespace": "FastQC (raw)", "rid": "mqc-generalstats-fastqc_raw-total_sequences", "suffix": " M", "format": "{:,.1f}", "colour": "152,78,163", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 19.875412, "dmin": 0.0 } }, { "percent_duplicates": { "title": "% Dups", "description": "% Duplicate Reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-percent_duplicates", "format": "{:,.1f}", "colour": "255,127,0", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "percent_gc": { "title": "% GC", "description": "Average % GC Content", "max": 100, "min": 0, "suffix": "%", "scale": "PuRd", "format": "{:,.0f}", "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-percent_gc", "colour": "255,127,0", "hidden": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "avg_sequence_length": { "title": "Average Read Length", "description": "Average Read Length (bp)", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-avg_sequence_length", "colour": "255,127,0", "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 140.53251514987463, "dmin": 0.0 }, "median_sequence_length": { "title": "Median Read Length", "description": "Median Read Length (bp)", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-median_sequence_length", "colour": "255,127,0", "max": null, "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 150.0, "dmin": 0.0 }, "percent_fails": { "title": "% Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-percent_fails", "colour": "255,127,0", "ceiling": null, "floor": null, "minRange": null, "shared_key": null, "modify": null, "placement": 1000.0, "dmax": 100.0, "dmin": 0.0 }, "total_sequences": { "title": "M Seqs", "description": "Total Sequences (millions)", "min": 0, "scale": "Blues", "modify": 1e-06, "shared_key": "read_count", "namespace": "FastQC (trimmed)", "rid": "mqc-generalstats-fastqc_trimmed-total_sequences", "suffix": " M", "format": "{:,.1f}", "colour": "255,127,0", "hidden": null, "max": null, "ceiling": null, "floor": null, "minRange": null, "placement": 1000.0, "dmax": 19.875412, "dmin": 0.0 } } ], "report_multiqc_command": "/usr/local/bin/multiqc --force --config multiqc_config.yml .", "report_plot_data": { "kallisto_alignment": { "id": "kallisto_alignment", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "Kallisto: Alignment Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "kallisto_alignment", "dconfig": {}, "layout": { "title": { "text": "Kallisto: Alignment Scores" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9937706 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Pseudoaligned", "data": [ 9571272, 9721684 ], "color": "0.26,0.48,0.69", "data_pct": [ 96.36796433671103, 97.82623877180508 ] }, { "name": "Not aligned", "data": [ 360734, 216022 ], "color": "0.69,0.03,0.30", "data_pct": [ 3.632035663288967, 2.1737612281949175 ] } ], "samples": [ "rna_s1221_S42_1", "rna_s1200_S21_1" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "kallisto_alignment", "title": "Kallisto: Alignment Scores", "ylab": "# Reads", "cpswitch_counts_label": "Number of Reads" } }, "picard_insert_size": { "id": "picard_insert_size", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Picard: Insert Size", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Counts", "uid": "picard_insert_size_Counts", "dconfig": { "name": "Counts", "ylab": "Coverage", "categories": [] }, "layout": { "title": { "text": "Picard: Insert Size" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Insert Size (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Coverage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.0f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 7, 1 ], [ 15, 11 ], [ 22, 20 ], [ 30, 26 ], [ 38, 94 ], [ 45, 173 ], [ 53, 306 ], [ 61, 762 ], [ 68, 2343 ], [ 76, 6837 ], [ 84, 12625 ], [ 91, 18764 ], [ 99, 24950 ], [ 107, 30344 ], [ 114, 31743 ], [ 122, 32743 ], [ 130, 32919 ], [ 137, 31104 ], [ 145, 28689 ], [ 153, 26162 ], [ 160, 24846 ], [ 168, 22204 ], [ 176, 20026 ], [ 183, 19393 ], [ 191, 17948 ], [ 199, 16307 ], [ 206, 15397 ], [ 214, 14645 ], [ 222, 14183 ], [ 229, 13165 ], [ 237, 12614 ], [ 245, 11777 ], [ 252, 11550 ], [ 260, 10651 ], [ 268, 9974 ], [ 275, 9502 ], [ 283, 8904 ], [ 291, 8352 ], [ 298, 7888 ], [ 306, 7364 ], [ 314, 6961 ], [ 321, 6602 ], [ 329, 6397 ], [ 337, 5939 ], [ 344, 5477 ], [ 352, 5344 ], [ 360, 5189 ], [ 367, 4776 ], [ 375, 4430 ], [ 383, 4434 ], [ 390, 4102 ], [ 398, 4049 ], [ 405, 3832 ], [ 413, 3770 ], [ 421, 3600 ], [ 428, 3550 ], [ 436, 3312 ], [ 444, 3387 ], [ 451, 3224 ], [ 459, 3083 ], [ 467, 3053 ], [ 474, 3030 ], [ 482, 2950 ], [ 490, 2845 ], [ 497, 2835 ], [ 505, 2695 ], [ 513, 2710 ], [ 520, 2725 ], [ 528, 2703 ], [ 536, 2670 ], [ 543, 2854 ], [ 551, 2528 ], [ 559, 2527 ], [ 566, 2470 ], [ 574, 2503 ], [ 582, 2434 ], [ 589, 2383 ], [ 597, 2290 ], [ 605, 2384 ], [ 612, 2411 ], [ 620, 2320 ], [ 628, 2307 ], [ 635, 2402 ], [ 643, 2255 ], [ 651, 2139 ], [ 658, 2191 ], [ 666, 2197 ], [ 674, 2299 ], [ 681, 2304 ], [ 689, 2265 ], [ 697, 2259 ], [ 704, 2233 ], [ 712, 2288 ], [ 720, 2136 ], [ 727, 2063 ], [ 735, 2196 ], [ 743, 2075 ], [ 750, 2146 ], [ 758, 2090 ], [ 766, 1977 ], [ 773, 2067 ], [ 781, 1895 ], [ 789, 1930 ], [ 796, 1888 ], [ 804, 1970 ], [ 812, 1912 ], [ 819, 1790 ], [ 827, 1852 ], [ 835, 1785 ], [ 842, 1743 ], [ 850, 1808 ], [ 858, 1784 ], [ 865, 1758 ], [ 873, 1741 ], [ 881, 1867 ], [ 888, 1753 ], [ 896, 1667 ], [ 904, 1555 ], [ 911, 1601 ], [ 919, 1600 ], [ 927, 1593 ], [ 934, 1616 ], [ 942, 1758 ], [ 950, 1688 ], [ 957, 1633 ], [ 965, 1642 ], [ 973, 1600 ], [ 980, 1617 ], [ 988, 1541 ], [ 996, 1629 ], [ 1003, 1608 ], [ 1011, 1539 ], [ 1019, 1474 ], [ 1026, 1558 ], [ 1034, 1450 ], [ 1042, 1396 ], [ 1049, 1447 ], [ 1057, 1388 ], [ 1065, 1399 ], [ 1072, 1455 ], [ 1080, 1407 ], [ 1088, 1411 ], [ 1095, 1417 ], [ 1103, 1424 ], [ 1111, 1535 ], [ 1118, 1402 ], [ 1126, 1353 ], [ 1134, 1334 ], [ 1141, 1353 ], [ 1149, 1294 ], [ 1156, 1331 ], [ 1164, 1367 ], [ 1172, 1340 ], [ 1179, 1360 ], [ 1187, 1294 ], [ 1195, 1362 ], [ 1202, 1413 ], [ 1210, 1384 ], [ 1218, 1313 ], [ 1225, 1350 ], [ 1233, 1296 ], [ 1241, 1323 ], [ 1248, 1330 ], [ 1256, 1338 ], [ 1264, 1283 ], [ 1271, 1231 ], [ 1279, 1311 ], [ 1287, 1246 ], [ 1294, 1385 ], [ 1302, 1379 ], [ 1310, 1292 ], [ 1317, 1397 ], [ 1325, 1255 ], [ 1333, 1358 ], [ 1340, 1390 ], [ 1348, 1274 ], [ 1356, 1376 ], [ 1363, 1320 ], [ 1371, 1363 ], [ 1379, 1395 ], [ 1386, 1227 ], [ 1394, 1290 ], [ 1402, 1175 ], [ 1409, 1217 ], [ 1417, 1125 ], [ 1425, 1222 ], [ 1432, 1195 ], [ 1440, 1114 ], [ 1448, 1145 ], [ 1455, 1170 ], [ 1463, 1139 ], [ 1471, 1130 ], [ 1478, 1087 ], [ 1486, 1105 ], [ 1494, 1046 ], [ 1501, 1071 ], [ 1509, 1037 ], [ 1517, 1069 ], [ 1524, 1109 ], [ 1532, 1199 ], [ 1540, 1090 ], [ 1547, 1173 ], [ 1555, 1179 ], [ 1563, 1160 ], [ 1570, 1160 ], [ 1578, 1075 ], [ 1586, 1184 ], [ 1593, 1139 ], [ 1601, 1264 ], [ 1609, 1160 ], [ 1616, 1153 ], [ 1624, 1121 ], [ 1632, 1032 ], [ 1639, 1097 ], [ 1647, 1232 ], [ 1655, 1048 ], [ 1662, 1015 ], [ 1670, 1017 ], [ 1678, 1052 ], [ 1685, 1086 ], [ 1693, 1141 ], [ 1701, 1085 ], [ 1708, 1162 ], [ 1716, 1141 ], [ 1724, 1148 ], [ 1731, 1144 ], [ 1739, 1139 ], [ 1747, 973 ], [ 1754, 984 ], [ 1762, 992 ], [ 1770, 1033 ], [ 1777, 983 ], [ 1785, 1012 ], [ 1793, 963 ], [ 1800, 962 ], [ 1808, 906 ], [ 1816, 826 ], [ 1823, 865 ], [ 1831, 823 ], [ 1839, 915 ], [ 1846, 909 ], [ 1854, 866 ], [ 1862, 941 ], [ 1869, 842 ], [ 1877, 936 ], [ 1885, 784 ], [ 1892, 787 ], [ 1900, 844 ], [ 1908, 838 ], [ 1915, 857 ], [ 1923, 784 ], [ 1930, 920 ], [ 1938, 852 ], [ 1946, 919 ], [ 1953, 872 ], [ 1961, 911 ], [ 1969, 909 ], [ 1976, 867 ], [ 1984, 820 ], [ 1992, 901 ], [ 1999, 887 ], [ 2007, 870 ], [ 2015, 884 ], [ 2022, 870 ], [ 2030, 888 ], [ 2038, 865 ], [ 2045, 917 ], [ 2053, 832 ], [ 2061, 873 ], [ 2068, 832 ], [ 2076, 874 ], [ 2084, 846 ], [ 2091, 845 ], [ 2099, 845 ], [ 2107, 749 ], [ 2114, 814 ], [ 2122, 811 ], [ 2130, 825 ], [ 2137, 747 ], [ 2145, 775 ], [ 2153, 749 ], [ 2160, 727 ], [ 2168, 760 ], [ 2176, 709 ], [ 2183, 680 ], [ 2191, 708 ], [ 2199, 755 ], [ 2206, 723 ], [ 2214, 728 ], [ 2222, 711 ], [ 2229, 755 ], [ 2237, 723 ], [ 2245, 796 ], [ 2252, 712 ], [ 2260, 753 ], [ 2268, 739 ], [ 2275, 748 ], [ 2283, 771 ], [ 2291, 719 ], [ 2298, 681 ], [ 2306, 681 ], [ 2314, 688 ], [ 2321, 720 ], [ 2329, 764 ], [ 2337, 690 ], [ 2344, 721 ], [ 2352, 693 ], [ 2360, 671 ], [ 2367, 690 ], [ 2375, 710 ], [ 2383, 624 ], [ 2390, 737 ], [ 2398, 609 ], [ 2406, 640 ], [ 2413, 679 ], [ 2421, 649 ], [ 2429, 701 ], [ 2436, 668 ], [ 2444, 624 ], [ 2452, 661 ], [ 2459, 602 ], [ 2467, 681 ], [ 2475, 588 ], [ 2482, 631 ], [ 2490, 655 ], [ 2498, 630 ], [ 2505, 679 ], [ 2513, 635 ], [ 2521, 683 ], [ 2528, 722 ], [ 2536, 656 ], [ 2544, 649 ], [ 2551, 630 ], [ 2559, 675 ], [ 2567, 649 ], [ 2574, 600 ], [ 2582, 594 ], [ 2590, 626 ], [ 2597, 589 ], [ 2605, 611 ], [ 2613, 589 ], [ 2620, 603 ], [ 2628, 579 ], [ 2636, 621 ], [ 2643, 595 ], [ 2651, 559 ], [ 2659, 629 ], [ 2666, 651 ], [ 2674, 547 ], [ 2682, 596 ], [ 2689, 557 ], [ 2697, 543 ], [ 2704, 583 ], [ 2712, 538 ], [ 2720, 548 ], [ 2727, 627 ], [ 2735, 563 ], [ 2743, 512 ], [ 2750, 471 ], [ 2758, 530 ], [ 2766, 556 ], [ 2773, 534 ], [ 2781, 550 ], [ 2789, 550 ], [ 2796, 549 ], [ 2804, 558 ], [ 2812, 569 ], [ 2819, 601 ], [ 2827, 524 ], [ 2835, 500 ], [ 2842, 520 ], [ 2850, 568 ], [ 2858, 570 ], [ 2865, 560 ], [ 2873, 535 ], [ 2881, 563 ], [ 2888, 519 ], [ 2896, 533 ], [ 2904, 567 ], [ 2911, 467 ], [ 2919, 512 ], [ 2927, 535 ], [ 2934, 437 ], [ 2942, 503 ], [ 2950, 458 ], [ 2957, 510 ], [ 2965, 486 ], [ 2973, 535 ], [ 2980, 485 ], [ 2988, 509 ], [ 2996, 483 ], [ 3003, 528 ], [ 3011, 511 ], [ 3019, 548 ], [ 3026, 564 ], [ 3034, 513 ], [ 3042, 556 ], [ 3049, 520 ], [ 3057, 513 ], [ 3065, 557 ], [ 3072, 556 ], [ 3080, 494 ], [ 3088, 501 ], [ 3095, 511 ], [ 3103, 465 ], [ 3111, 468 ], [ 3118, 458 ], [ 3126, 510 ], [ 3134, 480 ], [ 3141, 514 ], [ 3149, 438 ], [ 3157, 484 ], [ 3164, 482 ], [ 3172, 466 ], [ 3180, 477 ], [ 3187, 441 ], [ 3195, 491 ], [ 3203, 456 ], [ 3210, 484 ], [ 3218, 492 ], [ 3226, 504 ], [ 3233, 474 ], [ 3241, 498 ], [ 3249, 545 ], [ 3256, 536 ], [ 3264, 496 ], [ 3272, 521 ], [ 3279, 525 ], [ 3287, 572 ], [ 3295, 549 ], [ 3302, 570 ], [ 3310, 499 ], [ 3318, 525 ], [ 3325, 536 ], [ 3333, 481 ], [ 3341, 457 ], [ 3348, 524 ], [ 3356, 472 ], [ 3364, 532 ], [ 3371, 423 ], [ 3379, 453 ], [ 3387, 454 ], [ 3394, 392 ], [ 3402, 431 ], [ 3410, 413 ], [ 3417, 437 ], [ 3425, 431 ], [ 3433, 399 ], [ 3440, 423 ], [ 3448, 420 ], [ 3455, 434 ], [ 3463, 407 ], [ 3471, 418 ], [ 3478, 390 ], [ 3486, 369 ], [ 3494, 424 ], [ 3501, 410 ], [ 3509, 399 ], [ 3517, 402 ], [ 3524, 402 ], [ 3532, 424 ], [ 3540, 361 ], [ 3547, 367 ], [ 3555, 411 ], [ 3563, 383 ], [ 3570, 411 ], [ 3578, 355 ], [ 3586, 387 ], [ 3593, 426 ], [ 3601, 418 ], [ 3609, 392 ], [ 3616, 362 ], [ 3624, 405 ], [ 3632, 420 ], [ 3639, 403 ], [ 3647, 415 ], [ 3655, 402 ], [ 3662, 367 ], [ 3670, 386 ], [ 3678, 392 ], [ 3685, 348 ], [ 3693, 356 ], [ 3701, 396 ], [ 3708, 411 ], [ 3716, 405 ], [ 3724, 369 ], [ 3731, 353 ], [ 3739, 381 ], [ 3747, 410 ], [ 3754, 368 ], [ 3762, 361 ], [ 3770, 323 ], [ 3777, 378 ], [ 3785, 375 ], [ 3793, 377 ], [ 3800, 391 ], [ 3808, 366 ], [ 3816, 398 ], [ 3823, 375 ], [ 3831, 409 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 7, 3 ], [ 14, 12 ], [ 20, 20 ], [ 27, 43 ], [ 34, 141 ], [ 40, 310 ], [ 47, 603 ], [ 53, 920 ], [ 60, 1614 ], [ 67, 3822 ], [ 73, 7634 ], [ 80, 13944 ], [ 87, 21905 ], [ 93, 26750 ], [ 100, 32832 ], [ 106, 36178 ], [ 113, 35787 ], [ 120, 36453 ], [ 126, 34567 ], [ 133, 33611 ], [ 140, 31605 ], [ 146, 28802 ], [ 153, 26436 ], [ 160, 24797 ], [ 166, 22651 ], [ 173, 20872 ], [ 179, 19228 ], [ 186, 18235 ], [ 193, 16833 ], [ 199, 15837 ], [ 206, 14806 ], [ 213, 14007 ], [ 219, 13261 ], [ 226, 12743 ], [ 232, 12361 ], [ 239, 11552 ], [ 246, 11056 ], [ 252, 10540 ], [ 259, 10076 ], [ 266, 9238 ], [ 272, 8879 ], [ 279, 8270 ], [ 286, 7863 ], [ 292, 7446 ], [ 299, 7262 ], [ 305, 6708 ], [ 312, 6338 ], [ 319, 6148 ], [ 325, 6092 ], [ 332, 5594 ], [ 339, 5263 ], [ 345, 5054 ], [ 352, 5010 ], [ 358, 4567 ], [ 365, 4176 ], [ 372, 4072 ], [ 378, 4195 ], [ 385, 3806 ], [ 392, 3762 ], [ 398, 3708 ], [ 405, 3580 ], [ 412, 3439 ], [ 418, 3429 ], [ 425, 3322 ], [ 431, 3332 ], [ 438, 3019 ], [ 445, 3151 ], [ 451, 3071 ], [ 458, 2999 ], [ 465, 2899 ], [ 471, 2873 ], [ 478, 2716 ], [ 484, 2703 ], [ 491, 2630 ], [ 498, 2646 ], [ 504, 2577 ], [ 511, 2653 ], [ 518, 2523 ], [ 524, 2597 ], [ 531, 2558 ], [ 538, 2493 ], [ 544, 2600 ], [ 551, 2446 ], [ 557, 2412 ], [ 564, 2397 ], [ 571, 2331 ], [ 577, 2277 ], [ 584, 2208 ], [ 591, 2305 ], [ 597, 2245 ], [ 604, 2167 ], [ 610, 2162 ], [ 617, 2144 ], [ 624, 2159 ], [ 630, 2162 ], [ 637, 2118 ], [ 644, 2115 ], [ 650, 2125 ], [ 657, 2075 ], [ 663, 2005 ], [ 670, 2101 ], [ 677, 2068 ], [ 683, 2050 ], [ 690, 2169 ], [ 697, 2137 ], [ 703, 2101 ], [ 710, 1999 ], [ 717, 1972 ], [ 723, 2029 ], [ 730, 1979 ], [ 736, 2061 ], [ 743, 2029 ], [ 750, 1802 ], [ 756, 1872 ], [ 763, 1943 ], [ 770, 1826 ], [ 776, 1925 ], [ 783, 1889 ], [ 789, 1798 ], [ 796, 1925 ], [ 803, 1917 ], [ 809, 1888 ], [ 816, 1620 ], [ 823, 1757 ], [ 829, 1699 ], [ 836, 1693 ], [ 843, 1658 ], [ 849, 1643 ], [ 856, 1648 ], [ 862, 1739 ], [ 869, 1733 ], [ 876, 1815 ], [ 882, 1732 ], [ 889, 1649 ], [ 896, 1626 ], [ 902, 1689 ], [ 909, 1475 ], [ 915, 1567 ], [ 922, 1492 ], [ 929, 1568 ], [ 935, 1599 ], [ 942, 1678 ], [ 949, 1532 ], [ 955, 1622 ], [ 962, 1580 ], [ 969, 1580 ], [ 975, 1610 ], [ 982, 1537 ], [ 988, 1545 ], [ 995, 1490 ], [ 1002, 1522 ], [ 1008, 1430 ], [ 1015, 1418 ], [ 1022, 1479 ], [ 1028, 1459 ], [ 1035, 1349 ], [ 1041, 1419 ], [ 1048, 1394 ], [ 1055, 1380 ], [ 1061, 1365 ], [ 1068, 1328 ], [ 1075, 1303 ], [ 1081, 1406 ], [ 1088, 1334 ], [ 1095, 1316 ], [ 1101, 1393 ], [ 1108, 1338 ], [ 1114, 1261 ], [ 1121, 1250 ], [ 1128, 1312 ], [ 1134, 1341 ], [ 1141, 1247 ], [ 1148, 1254 ], [ 1154, 1254 ], [ 1161, 1355 ], [ 1167, 1264 ], [ 1174, 1258 ], [ 1181, 1293 ], [ 1187, 1310 ], [ 1194, 1316 ], [ 1201, 1326 ], [ 1207, 1328 ], [ 1214, 1281 ], [ 1221, 1275 ], [ 1227, 1331 ], [ 1234, 1293 ], [ 1240, 1327 ], [ 1247, 1212 ], [ 1254, 1244 ], [ 1260, 1385 ], [ 1267, 1205 ], [ 1274, 1164 ], [ 1280, 1259 ], [ 1287, 1211 ], [ 1293, 1241 ], [ 1300, 1205 ], [ 1307, 1281 ], [ 1313, 1244 ], [ 1320, 1337 ], [ 1327, 1298 ], [ 1333, 1240 ], [ 1340, 1261 ], [ 1347, 1288 ], [ 1353, 1268 ], [ 1360, 1188 ], [ 1366, 1222 ], [ 1373, 1277 ], [ 1380, 1289 ], [ 1386, 1186 ], [ 1393, 1197 ], [ 1400, 1149 ], [ 1406, 1107 ], [ 1413, 1183 ], [ 1419, 1195 ], [ 1426, 1165 ], [ 1433, 1066 ], [ 1439, 1106 ], [ 1446, 1014 ], [ 1453, 1102 ], [ 1459, 1113 ], [ 1466, 1129 ], [ 1473, 1053 ], [ 1479, 1013 ], [ 1486, 1110 ], [ 1492, 1131 ], [ 1499, 1048 ], [ 1506, 1106 ], [ 1512, 1072 ], [ 1519, 1021 ], [ 1526, 1070 ], [ 1532, 1074 ], [ 1539, 1057 ], [ 1545, 1092 ], [ 1552, 1073 ], [ 1559, 1139 ], [ 1565, 1062 ], [ 1572, 1106 ], [ 1579, 1057 ], [ 1585, 1110 ], [ 1592, 1056 ], [ 1599, 1108 ], [ 1605, 1033 ], [ 1612, 1123 ], [ 1618, 997 ], [ 1625, 1038 ], [ 1632, 1044 ], [ 1638, 1032 ], [ 1645, 1089 ], [ 1652, 1011 ], [ 1658, 1104 ], [ 1665, 1054 ], [ 1671, 1064 ], [ 1678, 951 ], [ 1685, 1006 ], [ 1691, 1069 ], [ 1698, 1072 ], [ 1705, 1144 ], [ 1711, 1057 ], [ 1718, 1052 ], [ 1724, 1061 ], [ 1731, 1034 ], [ 1738, 1031 ], [ 1744, 971 ], [ 1751, 1019 ], [ 1758, 994 ], [ 1764, 973 ], [ 1771, 959 ], [ 1778, 992 ], [ 1784, 961 ], [ 1791, 983 ], [ 1797, 861 ], [ 1804, 999 ], [ 1811, 837 ], [ 1817, 846 ], [ 1824, 895 ], [ 1831, 842 ], [ 1837, 827 ], [ 1844, 828 ], [ 1850, 769 ], [ 1857, 788 ], [ 1864, 806 ], [ 1870, 827 ], [ 1877, 778 ], [ 1884, 761 ], [ 1890, 786 ], [ 1897, 801 ], [ 1904, 779 ], [ 1910, 782 ], [ 1917, 805 ], [ 1923, 845 ], [ 1930, 821 ], [ 1937, 841 ], [ 1943, 887 ], [ 1950, 759 ], [ 1957, 822 ], [ 1963, 821 ], [ 1970, 820 ], [ 1976, 833 ], [ 1983, 885 ], [ 1990, 811 ], [ 1996, 811 ], [ 2003, 863 ], [ 2010, 838 ], [ 2016, 839 ], [ 2023, 864 ], [ 2030, 844 ], [ 2036, 756 ], [ 2043, 808 ], [ 2049, 867 ], [ 2056, 792 ], [ 2063, 848 ], [ 2069, 863 ], [ 2076, 831 ], [ 2083, 769 ], [ 2089, 800 ], [ 2096, 753 ], [ 2102, 833 ], [ 2109, 752 ], [ 2116, 767 ], [ 2122, 794 ], [ 2129, 723 ], [ 2136, 747 ], [ 2142, 750 ], [ 2149, 757 ], [ 2156, 682 ], [ 2162, 693 ], [ 2169, 706 ], [ 2175, 723 ], [ 2182, 707 ], [ 2189, 732 ], [ 2195, 674 ], [ 2202, 708 ], [ 2209, 651 ], [ 2215, 693 ], [ 2222, 737 ], [ 2228, 720 ], [ 2235, 749 ], [ 2242, 760 ], [ 2248, 706 ], [ 2255, 696 ], [ 2262, 720 ], [ 2268, 687 ], [ 2275, 677 ], [ 2282, 688 ], [ 2288, 676 ], [ 2295, 706 ], [ 2301, 671 ], [ 2308, 659 ], [ 2315, 651 ], [ 2321, 708 ], [ 2328, 663 ], [ 2335, 661 ], [ 2341, 724 ], [ 2348, 627 ], [ 2354, 664 ], [ 2361, 685 ], [ 2368, 716 ], [ 2374, 679 ], [ 2381, 650 ], [ 2388, 646 ], [ 2394, 668 ], [ 2401, 601 ], [ 2408, 609 ], [ 2414, 634 ], [ 2421, 636 ], [ 2427, 627 ], [ 2434, 660 ], [ 2441, 643 ], [ 2447, 592 ], [ 2454, 600 ], [ 2461, 645 ], [ 2467, 588 ], [ 2474, 628 ], [ 2480, 582 ], [ 2487, 557 ], [ 2494, 586 ], [ 2500, 610 ], [ 2507, 642 ], [ 2514, 638 ], [ 2520, 613 ], [ 2527, 622 ], [ 2534, 600 ], [ 2540, 627 ], [ 2547, 625 ], [ 2553, 635 ], [ 2560, 644 ], [ 2567, 633 ], [ 2573, 604 ], [ 2580, 545 ], [ 2587, 593 ], [ 2593, 608 ], [ 2600, 568 ], [ 2606, 619 ], [ 2613, 606 ], [ 2620, 573 ], [ 2626, 611 ], [ 2633, 568 ], [ 2640, 577 ], [ 2646, 583 ], [ 2653, 573 ], [ 2660, 565 ], [ 2666, 599 ], [ 2673, 597 ], [ 2679, 574 ], [ 2686, 596 ], [ 2693, 526 ], [ 2699, 533 ], [ 2706, 609 ], [ 2713, 567 ], [ 2719, 481 ], [ 2726, 554 ], [ 2732, 511 ], [ 2739, 569 ], [ 2746, 507 ], [ 2752, 511 ], [ 2759, 574 ], [ 2766, 539 ], [ 2772, 546 ], [ 2779, 504 ], [ 2785, 569 ], [ 2792, 556 ], [ 2799, 563 ], [ 2805, 483 ], [ 2812, 530 ], [ 2819, 551 ], [ 2825, 544 ], [ 2832, 529 ], [ 2839, 587 ], [ 2845, 533 ], [ 2852, 561 ], [ 2858, 590 ], [ 2865, 506 ], [ 2872, 553 ], [ 2878, 541 ], [ 2885, 549 ], [ 2892, 517 ], [ 2898, 459 ], [ 2905, 460 ], [ 2911, 471 ], [ 2918, 495 ], [ 2925, 494 ], [ 2931, 488 ], [ 2938, 484 ], [ 2945, 503 ], [ 2951, 485 ], [ 2958, 492 ], [ 2965, 446 ], [ 2971, 491 ], [ 2978, 484 ], [ 2984, 500 ], [ 2991, 470 ], [ 2998, 516 ], [ 3004, 483 ], [ 3011, 450 ], [ 3018, 516 ], [ 3024, 535 ], [ 3031, 498 ], [ 3037, 500 ], [ 3044, 493 ], [ 3051, 557 ], [ 3057, 513 ], [ 3064, 543 ], [ 3071, 496 ], [ 3077, 486 ], [ 3084, 541 ], [ 3091, 500 ], [ 3097, 468 ], [ 3104, 466 ], [ 3110, 459 ], [ 3117, 517 ], [ 3124, 423 ], [ 3130, 413 ], [ 3137, 437 ], [ 3144, 471 ], [ 3150, 508 ], [ 3157, 449 ], [ 3163, 486 ], [ 3170, 428 ], [ 3177, 479 ], [ 3183, 407 ], [ 3190, 455 ], [ 3197, 447 ], [ 3203, 448 ], [ 3210, 443 ], [ 3217, 455 ], [ 3223, 498 ], [ 3230, 503 ], [ 3236, 467 ], [ 3243, 417 ], [ 3250, 520 ], [ 3256, 492 ], [ 3263, 502 ], [ 3270, 478 ], [ 3276, 453 ], [ 3283, 471 ], [ 3289, 502 ], [ 3296, 515 ], [ 3303, 500 ], [ 3309, 489 ], [ 3316, 510 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Percentages", "uid": "picard_insert_size_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage of Counts", "categories": [] }, "layout": { "title": { "text": "Picard: Insert Size" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Insert Size (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Percentage of Counts" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.0f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 7, 1.20326112643531e-05 ], [ 15, 0.0001323587239078841 ], [ 22, 0.00024065222528706204 ], [ 30, 0.0003128478928731806 ], [ 38, 0.0011310654588491914 ], [ 45, 0.0020816417487330863 ], [ 53, 0.0036819790468920486 ], [ 61, 0.009168849783437063 ], [ 68, 0.028192408192379313 ], [ 76, 0.08226696321438215 ], [ 84, 0.1519117172124579 ], [ 91, 0.22577991776432157 ], [ 99, 0.3002136510456099 ], [ 107, 0.36511755620553044 ], [ 114, 0.38195117936436046 ], [ 122, 0.3939837906287135 ], [ 130, 0.39610153021123967 ], [ 137, 0.37426234076643883 ], [ 145, 0.34520358456302613 ], [ 153, 0.31479717589800577 ], [ 160, 0.29896225947411714 ], [ 168, 0.2671721005136962 ], [ 176, 0.24096507317993518 ], [ 183, 0.23334843024959967 ], [ 191, 0.21596130697260946 ], [ 199, 0.196215791887806 ], [ 206, 0.18526611563724468 ], [ 214, 0.17621759196645115 ], [ 222, 0.17065852556232003 ], [ 229, 0.15840932729520857 ], [ 237, 0.15177935848855 ], [ 245, 0.14170806286028648 ], [ 252, 0.1389766601032783 ], [ 260, 0.12815934257662487 ], [ 268, 0.12001326475065784 ], [ 275, 0.11433387223388315 ], [ 283, 0.1071383706978 ], [ 291, 0.10049636927987711 ], [ 298, 0.09491323765321726 ], [ 306, 0.08860814935069623 ], [ 314, 0.08375900701116193 ], [ 321, 0.07943929956725916 ], [ 329, 0.07697261425806678 ], [ 337, 0.07146167829899307 ], [ 344, 0.06590261189486193 ], [ 352, 0.06430227459670297 ], [ 360, 0.06243721985072823 ], [ 367, 0.05746775139855041 ], [ 375, 0.053304467901084236 ], [ 383, 0.053352598346141644 ], [ 390, 0.04935777140637642 ], [ 398, 0.04872004300936571 ], [ 405, 0.04610896636500108 ], [ 413, 0.04536294446661119 ], [ 421, 0.043317400551671166 ], [ 428, 0.04271576998845351 ], [ 436, 0.039852008507537465 ], [ 444, 0.04075445435236395 ], [ 451, 0.0387931387162744 ], [ 459, 0.037096540528000606 ], [ 467, 0.036735562190070015 ], [ 474, 0.03645881213098989 ], [ 482, 0.03549620322984164 ], [ 490, 0.03423277904708457 ], [ 497, 0.03411245293444104 ], [ 505, 0.03242788735743161 ], [ 513, 0.0326083765263969 ], [ 520, 0.0327888656953622 ], [ 528, 0.03252414824754643 ], [ 536, 0.03212707207582278 ], [ 543, 0.03434107254846375 ], [ 551, 0.030418441276284635 ], [ 559, 0.030406408665020285 ], [ 566, 0.02972054982295216 ], [ 574, 0.03011762599467581 ], [ 582, 0.02928737581743545 ], [ 589, 0.028673712642953438 ], [ 597, 0.027554679795368596 ], [ 605, 0.028685745254217788 ], [ 612, 0.029010625758355328 ], [ 620, 0.02791565813329919 ], [ 628, 0.027759234186862602 ], [ 635, 0.028902332256976145 ], [ 643, 0.027133538401116243 ], [ 651, 0.02573775549445128 ], [ 658, 0.026363451280197646 ], [ 666, 0.02643564694778376 ], [ 674, 0.027662973296747776 ], [ 681, 0.02772313635306954 ], [ 689, 0.02725386451375977 ], [ 697, 0.027181668846173655 ], [ 704, 0.02686882095330047 ], [ 712, 0.027530614572839892 ], [ 720, 0.025701657660658225 ], [ 727, 0.024823277038360445 ], [ 735, 0.026423614336519408 ], [ 743, 0.024967668373532682 ], [ 750, 0.025821983773301752 ], [ 758, 0.02514815754249798 ], [ 766, 0.02378847246962608 ], [ 773, 0.02487140748341786 ], [ 781, 0.022801798345949125 ], [ 789, 0.023222939740201485 ], [ 796, 0.022717570067098652 ], [ 804, 0.023704244190775606 ], [ 812, 0.023006352737443128 ], [ 819, 0.02153837416319205 ], [ 827, 0.022284396061581942 ], [ 835, 0.021478211106870284 ], [ 842, 0.02097284143376745 ], [ 850, 0.021754961165950406 ], [ 858, 0.021466178495605934 ], [ 865, 0.02115333060273275 ], [ 873, 0.020948776211238748 ], [ 881, 0.022464885230547238 ], [ 888, 0.021093167546410985 ], [ 896, 0.02005836297767662 ], [ 904, 0.01871071051606907 ], [ 911, 0.019264210634229312 ], [ 919, 0.01925217802296496 ], [ 927, 0.01916794974411449 ], [ 934, 0.01944469980319461 ], [ 942, 0.02115333060273275 ], [ 950, 0.02031104781422803 ], [ 957, 0.01964925419468861 ], [ 965, 0.01975754769606779 ], [ 973, 0.01925217802296496 ], [ 980, 0.01945673241445896 ], [ 988, 0.01854225395836813 ], [ 996, 0.019601123749631202 ], [ 1003, 0.019348438913079784 ], [ 1011, 0.018518188735839422 ], [ 1019, 0.01773606900365647 ], [ 1026, 0.01874680834986213 ], [ 1034, 0.017447286333311995 ], [ 1042, 0.01679752532503693 ], [ 1049, 0.017411188499518938 ], [ 1057, 0.016701264434922102 ], [ 1065, 0.01683362315882999 ], [ 1072, 0.01750744938963376 ], [ 1080, 0.016929884048944813 ], [ 1088, 0.016978014494002224 ], [ 1095, 0.017050210161588343 ], [ 1103, 0.017134438440438816 ], [ 1111, 0.01847005829078201 ], [ 1118, 0.016869720992623048 ], [ 1126, 0.016280123040669746 ], [ 1134, 0.016051503426647035 ], [ 1141, 0.016280123040669746 ], [ 1149, 0.01557019897607291 ], [ 1156, 0.016015405592853978 ], [ 1164, 0.016448579598370688 ], [ 1172, 0.016123699094233154 ], [ 1179, 0.01636435131952022 ], [ 1187, 0.01557019897607291 ], [ 1195, 0.016388416542048923 ], [ 1202, 0.017002079716530928 ], [ 1210, 0.01665313398986469 ], [ 1218, 0.01579881859009562 ], [ 1225, 0.016244025206876685 ], [ 1233, 0.01559426419860162 ], [ 1241, 0.01591914470273915 ], [ 1248, 0.016003372981589624 ], [ 1256, 0.016099633871704447 ], [ 1264, 0.015437840252165028 ], [ 1271, 0.014812144466418665 ], [ 1279, 0.015774753367566913 ], [ 1287, 0.014992633635383962 ], [ 1294, 0.016665166601129044 ], [ 1302, 0.016592970933542926 ], [ 1310, 0.015546133753544206 ], [ 1317, 0.01680955793630128 ], [ 1325, 0.015100927136763139 ], [ 1333, 0.016340286096991508 ], [ 1340, 0.01672532965745081 ], [ 1348, 0.01532954675078585 ], [ 1356, 0.016556873099749868 ], [ 1363, 0.015883046868946094 ], [ 1371, 0.016400449153313276 ], [ 1379, 0.016785492713772575 ], [ 1386, 0.014764014021361255 ], [ 1394, 0.0155220685310155 ], [ 1402, 0.014138318235614893 ], [ 1409, 0.014643687908717725 ], [ 1417, 0.013536687672397239 ], [ 1425, 0.014703850965039489 ], [ 1432, 0.014378970460901955 ], [ 1440, 0.013404328948489353 ], [ 1448, 0.013777339897684298 ], [ 1455, 0.01407815517929313 ], [ 1463, 0.013705144230098183 ], [ 1471, 0.013596850728719002 ], [ 1478, 0.01307944844435182 ], [ 1486, 0.013296035447110175 ], [ 1494, 0.012586111382513343 ], [ 1501, 0.01288692666412217 ], [ 1509, 0.012477817881134166 ], [ 1517, 0.012862861441593465 ], [ 1524, 0.013344165892167588 ], [ 1532, 0.014427100905959367 ], [ 1540, 0.013115546278144877 ], [ 1547, 0.014114253013086187 ], [ 1555, 0.014186448680672306 ], [ 1563, 0.013957829066649595 ], [ 1570, 0.013957829066649595 ], [ 1578, 0.012935057109179582 ], [ 1586, 0.01424661173699407 ], [ 1593, 0.013705144230098183 ], [ 1601, 0.015209220638142317 ], [ 1609, 0.013957829066649595 ], [ 1616, 0.013873600787799124 ], [ 1624, 0.013488557227339824 ], [ 1632, 0.012417654824812399 ], [ 1639, 0.01319977455699535 ], [ 1647, 0.014824177077683019 ], [ 1655, 0.012610176605042048 ], [ 1662, 0.012213100433318398 ], [ 1670, 0.012237165655847104 ], [ 1678, 0.012658307050099463 ], [ 1685, 0.013067415833087468 ], [ 1693, 0.013729209452626888 ], [ 1701, 0.013055383221823114 ], [ 1708, 0.013981894289178304 ], [ 1716, 0.013729209452626888 ], [ 1724, 0.01381343773147736 ], [ 1731, 0.013765307286419946 ], [ 1739, 0.013705144230098183 ], [ 1747, 0.011707730760215567 ], [ 1754, 0.011840089484123451 ], [ 1762, 0.011936350374238276 ], [ 1770, 0.012429687436076753 ], [ 1777, 0.011828056872859097 ], [ 1785, 0.012177002599525338 ], [ 1793, 0.011587404647572037 ], [ 1800, 0.011575372036307683 ], [ 1808, 0.010901545805503909 ], [ 1816, 0.00993893690435566 ], [ 1823, 0.010408208743665432 ], [ 1831, 0.009902839070562601 ], [ 1839, 0.011009839306883087 ], [ 1846, 0.010937643639296968 ], [ 1854, 0.010420241354929785 ], [ 1862, 0.011322687199756267 ], [ 1869, 0.010131458684585311 ], [ 1877, 0.011262524143434502 ], [ 1885, 0.00943356723125283 ], [ 1892, 0.009469665065045891 ], [ 1900, 0.010155523907114015 ], [ 1908, 0.010083328239527898 ], [ 1915, 0.010311947853550607 ], [ 1923, 0.00943356723125283 ], [ 1930, 0.011070002363204852 ], [ 1938, 0.010251784797228842 ], [ 1946, 0.011057969751940499 ], [ 1953, 0.010492437022515903 ], [ 1961, 0.010961708861825674 ], [ 1969, 0.010937643639296968 ], [ 1976, 0.010432273966194137 ], [ 1984, 0.009866741236769542 ], [ 1992, 0.010841382749182144 ], [ 1999, 0.0106729261914812 ], [ 2007, 0.010468371799987197 ], [ 2015, 0.01063682835768814 ], [ 2022, 0.010468371799987197 ], [ 2030, 0.010684958802745554 ], [ 2038, 0.010408208743665432 ], [ 2045, 0.011033904529411793 ], [ 2053, 0.01001113257194178 ], [ 2061, 0.010504469633780256 ], [ 2068, 0.01001113257194178 ], [ 2076, 0.01051650224504461 ], [ 2084, 0.010179589129642723 ], [ 2091, 0.010167556518378371 ], [ 2099, 0.010167556518378371 ], [ 2107, 0.009012425837000472 ], [ 2114, 0.009794545569183424 ], [ 2122, 0.009758447735390365 ], [ 2130, 0.009926904293091308 ], [ 2137, 0.008988360614471766 ], [ 2145, 0.009325273729873653 ], [ 2153, 0.009012425837000472 ], [ 2160, 0.008747708389184705 ], [ 2168, 0.009144784560908356 ], [ 2176, 0.008531121386426348 ], [ 2183, 0.00818217565976011 ], [ 2191, 0.008519088775161995 ], [ 2199, 0.00908462150458659 ], [ 2206, 0.008699577944127292 ], [ 2214, 0.008759741000449057 ], [ 2222, 0.008555186608955054 ], [ 2229, 0.00908462150458659 ], [ 2237, 0.008699577944127292 ], [ 2245, 0.009577958566425068 ], [ 2252, 0.008567219220219408 ], [ 2260, 0.009060556282057885 ], [ 2268, 0.008892099724356941 ], [ 2275, 0.00900039322573612 ], [ 2283, 0.00927714328481624 ], [ 2291, 0.00865144749906988 ], [ 2298, 0.008194208271024461 ], [ 2306, 0.008194208271024461 ], [ 2314, 0.008278436549874934 ], [ 2321, 0.008663480110334233 ], [ 2329, 0.009192915005965769 ], [ 2337, 0.00830250177240364 ], [ 2344, 0.008675512721598585 ], [ 2352, 0.008338599606196699 ], [ 2360, 0.00807388215838093 ], [ 2367, 0.00830250177240364 ], [ 2375, 0.0085431539976907 ], [ 2383, 0.007508349428956334 ], [ 2390, 0.008868034501828236 ], [ 2398, 0.0073278602599910385 ], [ 2406, 0.007700871209185985 ], [ 2413, 0.008170143048495754 ], [ 2421, 0.007809164710565163 ], [ 2429, 0.008434860496311524 ], [ 2436, 0.008037784324587871 ], [ 2444, 0.007508349428956334 ], [ 2452, 0.007953556045737399 ], [ 2459, 0.007243631981140567 ], [ 2467, 0.008194208271024461 ], [ 2475, 0.007075175423439622 ], [ 2482, 0.007592577707806806 ], [ 2490, 0.00788136037815128 ], [ 2498, 0.007580545096542453 ], [ 2505, 0.008170143048495754 ], [ 2513, 0.007640708152864218 ], [ 2521, 0.008218273493553167 ], [ 2528, 0.008687545332862938 ], [ 2536, 0.007893392989415634 ], [ 2544, 0.007809164710565163 ], [ 2551, 0.007580545096542453 ], [ 2559, 0.008122012603438342 ], [ 2567, 0.007809164710565163 ], [ 2574, 0.007219566758611859 ], [ 2582, 0.007147371091025742 ], [ 2590, 0.007532414651485041 ], [ 2597, 0.007087208034703977 ], [ 2605, 0.007351925482519744 ], [ 2613, 0.007087208034703977 ], [ 2620, 0.00725566459240492 ], [ 2628, 0.006966881922060445 ], [ 2636, 0.0074722515951632755 ], [ 2643, 0.007159403702290095 ], [ 2651, 0.006726229696773383 ], [ 2659, 0.0075685124852781 ], [ 2666, 0.007833229933093868 ], [ 2674, 0.006581838361601146 ], [ 2682, 0.007171436313554447 ], [ 2689, 0.0067021644742446766 ], [ 2697, 0.006533707916543734 ], [ 2704, 0.007015012367117857 ], [ 2712, 0.006473544860221969 ], [ 2720, 0.006593870972865499 ], [ 2727, 0.0075444472627493936 ], [ 2735, 0.0067743601418307955 ], [ 2743, 0.006160696967348787 ], [ 2750, 0.00566735990551031 ], [ 2758, 0.006377283970107144 ], [ 2766, 0.006690131862980324 ], [ 2773, 0.006425414415164556 ], [ 2781, 0.006617936195394206 ], [ 2789, 0.006617936195394206 ], [ 2796, 0.006605903584129852 ], [ 2804, 0.00671419708550903 ], [ 2812, 0.0068465558094169135 ], [ 2819, 0.007231599369876214 ], [ 2827, 0.006305088302521024 ], [ 2835, 0.00601630563217655 ], [ 2842, 0.006256957857463612 ], [ 2850, 0.006834523198152561 ], [ 2858, 0.006858588420681267 ], [ 2865, 0.006738262308037736 ], [ 2873, 0.006437447026428909 ], [ 2881, 0.0067743601418307955 ], [ 2888, 0.006244925246199259 ], [ 2896, 0.006413381803900202 ], [ 2904, 0.006822490586888208 ], [ 2911, 0.005619229460452898 ], [ 2919, 0.006160696967348787 ], [ 2927, 0.006437447026428909 ], [ 2934, 0.005258251122522305 ], [ 2942, 0.006052403465969609 ], [ 2950, 0.00551093595907372 ], [ 2957, 0.0061366317448200815 ], [ 2965, 0.005847849074475607 ], [ 2973, 0.006437447026428909 ], [ 2980, 0.005835816463211254 ], [ 2988, 0.006124599133555728 ], [ 2996, 0.005811751240682547 ], [ 3003, 0.0063532187475784365 ], [ 3011, 0.006148664356084434 ], [ 3019, 0.006593870972865499 ], [ 3026, 0.006786392753095148 ], [ 3034, 0.00617272957861314 ], [ 3042, 0.006690131862980324 ], [ 3049, 0.006256957857463612 ], [ 3057, 0.00617272957861314 ], [ 3065, 0.0067021644742446766 ], [ 3072, 0.006690131862980324 ], [ 3080, 0.005944109964590431 ], [ 3088, 0.006028338243440903 ], [ 3095, 0.006148664356084434 ], [ 3103, 0.005595164237924191 ], [ 3111, 0.005631262071717251 ], [ 3118, 0.00551093595907372 ], [ 3126, 0.0061366317448200815 ], [ 3134, 0.005775653406889489 ], [ 3141, 0.006184762189877494 ], [ 3149, 0.005270283733786658 ], [ 3157, 0.005823783851946901 ], [ 3164, 0.005799718629418194 ], [ 3172, 0.005607196849188545 ], [ 3180, 0.005739555573096428 ], [ 3187, 0.005306381567579717 ], [ 3195, 0.005908012130797372 ], [ 3203, 0.005486870736545014 ], [ 3210, 0.005823783851946901 ], [ 3218, 0.005920044742061726 ], [ 3226, 0.006064436077233963 ], [ 3233, 0.00570345773930337 ], [ 3241, 0.005992240409647844 ], [ 3249, 0.006557773139072439 ], [ 3256, 0.006449479637693262 ], [ 3264, 0.005968175187119138 ], [ 3272, 0.006268990468727965 ], [ 3279, 0.006317120913785377 ], [ 3287, 0.006882653643209973 ], [ 3295, 0.006605903584129852 ], [ 3302, 0.006858588420681267 ], [ 3310, 0.0060042730209121965 ], [ 3318, 0.006317120913785377 ], [ 3325, 0.006449479637693262 ], [ 3333, 0.0057876860181538415 ], [ 3341, 0.005498903347809367 ], [ 3348, 0.006305088302521024 ], [ 3356, 0.005679392516774663 ], [ 3364, 0.006401349192635849 ], [ 3371, 0.0050897945648213615 ], [ 3379, 0.005450772902751954 ], [ 3387, 0.005462805514016308 ], [ 3394, 0.004716783615626415 ], [ 3402, 0.005186055454936186 ], [ 3410, 0.00496946845217783 ], [ 3417, 0.005258251122522305 ], [ 3425, 0.005186055454936186 ], [ 3433, 0.0048010118944768875 ], [ 3440, 0.0050897945648213615 ], [ 3448, 0.005053696731028302 ], [ 3455, 0.005222153288729246 ], [ 3463, 0.004897272784591712 ], [ 3471, 0.005029631508499595 ], [ 3478, 0.004692718393097709 ], [ 3486, 0.004440033556546294 ], [ 3494, 0.005101827176085714 ], [ 3501, 0.004933370618384771 ], [ 3509, 0.0048010118944768875 ], [ 3517, 0.004837109728269946 ], [ 3524, 0.004837109728269946 ], [ 3532, 0.005101827176085714 ], [ 3540, 0.004343772666431469 ], [ 3547, 0.004415968334017587 ], [ 3555, 0.0049454032296491245 ], [ 3563, 0.004608490114247237 ], [ 3570, 0.0049454032296491245 ], [ 3578, 0.00427157699884535 ], [ 3586, 0.0046566205593046505 ], [ 3593, 0.005125892398614421 ], [ 3601, 0.005029631508499595 ], [ 3609, 0.004716783615626415 ], [ 3616, 0.004355805277695822 ], [ 3624, 0.004873207562063006 ], [ 3632, 0.005053696731028302 ], [ 3639, 0.0048491423395343 ], [ 3647, 0.004993533674706537 ], [ 3655, 0.004837109728269946 ], [ 3662, 0.004415968334017587 ], [ 3670, 0.004644587948040297 ], [ 3678, 0.004716783615626415 ], [ 3685, 0.004187348719994879 ], [ 3693, 0.004283609610109704 ], [ 3701, 0.004764914060683828 ], [ 3708, 0.0049454032296491245 ], [ 3716, 0.004873207562063006 ], [ 3724, 0.004440033556546294 ], [ 3731, 0.0042475117763166445 ], [ 3739, 0.004584424891718532 ], [ 3747, 0.004933370618384771 ], [ 3754, 0.004428000945281941 ], [ 3762, 0.004343772666431469 ], [ 3770, 0.0038865334383860516 ], [ 3777, 0.004548327057925472 ], [ 3785, 0.004512229224132413 ], [ 3793, 0.004536294446661118 ], [ 3800, 0.004704751004362063 ], [ 3808, 0.004403935722753235 ], [ 3816, 0.004788979283212534 ], [ 3823, 0.004512229224132413 ], [ 3831, 0.004921338007120418 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 7, 3.6917937946114825e-05 ], [ 14, 0.0001476717517844593 ], [ 20, 0.0002461195863074321 ], [ 27, 0.0005291571105609791 ], [ 34, 0.0017351430834673968 ], [ 40, 0.0038148535877651985 ], [ 47, 0.00742050552716908 ], [ 53, 0.01132150097014188 ], [ 60, 0.019861850615009776 ], [ 67, 0.04703345294335028 ], [ 73, 0.09394384609354685 ], [ 80, 0.17159457557354169 ], [ 87, 0.26956247690321505 ], [ 93, 0.32918494668619047 ], [ 100, 0.40402991288228063 ], [ 106, 0.44520571967151407 ], [ 113, 0.4403940817592038 ], [ 120, 0.44858986398324124 ], [ 126, 0.42538078699445037 ], [ 133, 0.41361627076895513 ], [ 140, 0.3889304762623197 ], [ 146, 0.35443681624133305 ], [ 153, 0.3253208691811638 ], [ 160, 0.30515136908326973 ], [ 166, 0.2787427374724823 ], [ 173, 0.2568504002704362 ], [ 179, 0.2366193702759653 ], [ 186, 0.22439953281580127 ], [ 193, 0.20714654981565028 ], [ 199, 0.19488979441754015 ], [ 206, 0.182202329743392 ], [ 213, 0.17236985227041013 ], [ 219, 0.1631895917011429 ], [ 226, 0.1568150944157804 ], [ 232, 0.15211421031730846 ], [ 239, 0.14215867305117283 ], [ 246, 0.13605490731074849 ], [ 252, 0.12970502198401673 ], [ 259, 0.12399504758168432 ], [ 266, 0.11368263691540292 ], [ 272, 0.10926479034118451 ], [ 279, 0.1017704489381232 ], [ 286, 0.09676191535676695 ], [ 292, 0.09163032198225698 ], [ 299, 0.08936602178822863 ], [ 305, 0.08254850924751274 ], [ 312, 0.07799529690082525 ], [ 319, 0.07565716083090464 ], [ 325, 0.07496802598924383 ], [ 332, 0.06883964829018877 ], [ 339, 0.06476636913680077 ], [ 345, 0.06219441945988811 ], [ 352, 0.06165295637001176 ], [ 358, 0.056201407533302127 ], [ 365, 0.05138976962099183 ], [ 372, 0.050109947772193186 ], [ 378, 0.051623583227983896 ], [ 385, 0.046836557274304344 ], [ 392, 0.04629509418442799 ], [ 398, 0.04563057130139792 ], [ 405, 0.04405540594903036 ], [ 412, 0.04232026286556296 ], [ 418, 0.04219720307240924 ], [ 425, 0.040880463285664484 ], [ 431, 0.041003523078818195 ], [ 438, 0.03715175155310689 ], [ 445, 0.038776140822735936 ], [ 451, 0.03779166247750621 ], [ 458, 0.036905631966799454 ], [ 465, 0.03567503403526229 ], [ 471, 0.03535507857306263 ], [ 478, 0.03342303982054928 ], [ 484, 0.03326306208944946 ], [ 491, 0.03236472559942733 ], [ 498, 0.03256162126847328 ], [ 504, 0.031712508695712634 ], [ 511, 0.032647763123680874 ], [ 518, 0.031047985812682567 ], [ 524, 0.03195862828202006 ], [ 531, 0.031478695088720574 ], [ 538, 0.03067880643322142 ], [ 544, 0.031995546219966184 ], [ 551, 0.030100425405398954 ], [ 557, 0.02968202210867632 ], [ 564, 0.029497432418945743 ], [ 571, 0.02868523778413122 ], [ 577, 0.02802071490110115 ], [ 584, 0.02717160232834051 ], [ 591, 0.028365282321931553 ], [ 597, 0.02762692356300926 ], [ 604, 0.026667057176410276 ], [ 610, 0.026605527279833417 ], [ 617, 0.02638401965215673 ], [ 624, 0.0265686093418873 ], [ 630, 0.026605527279833417 ], [ 637, 0.026064064189957062 ], [ 644, 0.02602714625201095 ], [ 650, 0.026150206045164666 ], [ 657, 0.025534907079396086 ], [ 663, 0.024673488527320073 ], [ 670, 0.025854862541595747 ], [ 677, 0.025448765224188485 ], [ 683, 0.025227257596511794 ], [ 690, 0.026691669135041014 ], [ 697, 0.026297877796949126 ], [ 703, 0.025854862541595747 ], [ 710, 0.024599652651427842 ], [ 717, 0.02426739120991281 ], [ 723, 0.024968832030888996 ], [ 730, 0.02435353306512041 ], [ 736, 0.025362623368980885 ], [ 743, 0.024968832030888996 ], [ 750, 0.022175374726299636 ], [ 756, 0.02303679327837565 ], [ 763, 0.023910517809767034 ], [ 770, 0.022470718229868555 ], [ 776, 0.023689010182090346 ], [ 783, 0.023245994926736967 ], [ 789, 0.02212615080903815 ], [ 796, 0.023689010182090346 ], [ 803, 0.023590562347567373 ], [ 809, 0.0232336889474216 ], [ 816, 0.019935686490902008 ], [ 823, 0.021621605657107915 ], [ 829, 0.020907858856816362 ], [ 836, 0.020834022980924134 ], [ 843, 0.020403313704886124 ], [ 849, 0.02021872401515555 ], [ 856, 0.02028025391173241 ], [ 862, 0.021400098029431228 ], [ 869, 0.021326262153538996 ], [ 876, 0.02233535245739947 ], [ 882, 0.021313956174223624 ], [ 889, 0.020292559891047782 ], [ 896, 0.020009522366794232 ], [ 902, 0.020784799063662644 ], [ 909, 0.01815131949017312 ], [ 915, 0.01928346958718731 ], [ 922, 0.01836052113853444 ], [ 929, 0.019295775566502683 ], [ 935, 0.019677260925279202 ], [ 942, 0.020649433291193557 ], [ 949, 0.018852760311149304 ], [ 955, 0.019960298449532746 ], [ 962, 0.019443447318287142 ], [ 969, 0.019443447318287142 ], [ 975, 0.01981262669774829 ], [ 982, 0.01891429020772616 ], [ 988, 0.019012738042249133 ], [ 995, 0.018335909179903694 ], [ 1002, 0.018729700517995586 ], [ 1008, 0.0175975504209814 ], [ 1015, 0.01744987866919694 ], [ 1022, 0.018200543407434606 ], [ 1028, 0.017954423821127177 ], [ 1035, 0.0166007660964363 ], [ 1041, 0.017462184648512312 ], [ 1048, 0.01715453516562802 ], [ 1055, 0.01698225145521282 ], [ 1061, 0.016797661765482242 ], [ 1068, 0.016342340530813494 ], [ 1075, 0.016034691047929206 ], [ 1081, 0.01730220691741248 ], [ 1088, 0.016416176406705726 ], [ 1095, 0.016194668779029035 ], [ 1101, 0.01714222918631265 ], [ 1108, 0.016465400323967212 ], [ 1114, 0.015517839916683599 ], [ 1121, 0.015382474144214509 ], [ 1128, 0.01614544486176755 ], [ 1134, 0.016502318261913326 ], [ 1141, 0.015345556206268395 ], [ 1148, 0.015431698061475995 ], [ 1154, 0.015431698061475995 ], [ 1161, 0.01667460197232853 ], [ 1167, 0.015554757854629713 ], [ 1174, 0.015480921978737482 ], [ 1181, 0.01591163125477549 ], [ 1187, 0.016120832903136807 ], [ 1194, 0.016194668779029035 ], [ 1201, 0.016317728572182753 ], [ 1207, 0.016342340530813494 ], [ 1214, 0.01576395950299103 ], [ 1221, 0.0156901236270988 ], [ 1227, 0.016379258468759608 ], [ 1234, 0.01591163125477549 ], [ 1240, 0.016330034551498125 ], [ 1247, 0.014914846930230388 ], [ 1254, 0.015308638268322282 ], [ 1260, 0.017043781351789678 ], [ 1267, 0.014828705075022788 ], [ 1274, 0.014324159923092552 ], [ 1280, 0.015493227958052856 ], [ 1287, 0.014902540950915017 ], [ 1293, 0.015271720330376165 ], [ 1300, 0.014828705075022788 ], [ 1307, 0.01576395950299103 ], [ 1313, 0.015308638268322282 ], [ 1320, 0.01645309434465184 ], [ 1327, 0.015973161151352347 ], [ 1333, 0.015259414351060794 ], [ 1340, 0.015517839916683599 ], [ 1347, 0.01585010135819863 ], [ 1353, 0.0156039817718912 ], [ 1360, 0.014619503426661469 ], [ 1366, 0.015037906723384105 ], [ 1373, 0.015714735585729542 ], [ 1380, 0.015862407337514005 ], [ 1386, 0.014594891468030726 ], [ 1393, 0.014730257240499813 ], [ 1400, 0.014139570233361978 ], [ 1406, 0.01362271910211637 ], [ 1413, 0.014557973530084613 ], [ 1419, 0.01470564528186907 ], [ 1426, 0.014336465902407922 ], [ 1433, 0.013118173950186135 ], [ 1439, 0.013610413122801 ], [ 1446, 0.01247826302578681 ], [ 1453, 0.013561189205539512 ], [ 1459, 0.0136965549780086 ], [ 1466, 0.013893450647054544 ], [ 1473, 0.012958196219086305 ], [ 1479, 0.01246595704647144 ], [ 1486, 0.013659637040062483 ], [ 1492, 0.013918062605685289 ], [ 1499, 0.012896666322509444 ], [ 1506, 0.013610413122801 ], [ 1512, 0.013192009826078365 ], [ 1519, 0.012564404880994412 ], [ 1526, 0.013167397867447622 ], [ 1532, 0.013216621784709108 ], [ 1539, 0.013007420136347791 ], [ 1545, 0.013438129412385796 ], [ 1552, 0.013204315805393736 ], [ 1559, 0.014016510440208262 ], [ 1565, 0.013068950032924648 ], [ 1572, 0.013610413122801 ], [ 1579, 0.013007420136347791 ], [ 1585, 0.013659637040062483 ], [ 1592, 0.012995114157032419 ], [ 1599, 0.013635025081431744 ], [ 1605, 0.01271207663277887 ], [ 1612, 0.013819614771162317 ], [ 1618, 0.012269061377425493 ], [ 1625, 0.012773606529355731 ], [ 1632, 0.012847442405247957 ], [ 1638, 0.0126997706534635 ], [ 1645, 0.013401211474439682 ], [ 1652, 0.012441345087840696 ], [ 1658, 0.013585801164170255 ], [ 1665, 0.012970502198401675 ], [ 1671, 0.013093561991555392 ], [ 1678, 0.011702986328918398 ], [ 1685, 0.012379815191263839 ], [ 1691, 0.013155091888132249 ], [ 1698, 0.013192009826078365 ], [ 1705, 0.014078040336785119 ], [ 1711, 0.013007420136347791 ], [ 1718, 0.01294589023977093 ], [ 1724, 0.013056644053609274 ], [ 1731, 0.012724382612094243 ], [ 1738, 0.012687464674148127 ], [ 1744, 0.01194910591522583 ], [ 1751, 0.012539792922363669 ], [ 1758, 0.012232143439479379 ], [ 1764, 0.011973717873856574 ], [ 1771, 0.011801434163441373 ], [ 1778, 0.012207531480848636 ], [ 1784, 0.011826046122072116 ], [ 1791, 0.01209677766701029 ], [ 1797, 0.010595448190534954 ], [ 1804, 0.012293673336056236 ], [ 1811, 0.010300104686966035 ], [ 1817, 0.01041085850080438 ], [ 1824, 0.01101385148725759 ], [ 1831, 0.010361634583542894 ], [ 1837, 0.01017704489381232 ], [ 1844, 0.010189350873127691 ], [ 1850, 0.009463298093520766 ], [ 1857, 0.009697111700512828 ], [ 1864, 0.009918619328189516 ], [ 1870, 0.01017704489381232 ], [ 1877, 0.00957405190735911 ], [ 1884, 0.009364850258997793 ], [ 1890, 0.009672499741882085 ], [ 1897, 0.009857089431612658 ], [ 1904, 0.009586357886674482 ], [ 1910, 0.009623275824620598 ], [ 1917, 0.009906313348874145 ], [ 1923, 0.010398552521489008 ], [ 1930, 0.010103209017920091 ], [ 1937, 0.010349328604227524 ], [ 1943, 0.010915403652734617 ], [ 1950, 0.009340238300367051 ], [ 1957, 0.010115514997235462 ], [ 1963, 0.010103209017920091 ], [ 1970, 0.010090903038604718 ], [ 1976, 0.010250880769704549 ], [ 1983, 0.010890791694103874 ], [ 1990, 0.009980149224766373 ], [ 1996, 0.009980149224766373 ], [ 2003, 0.010620060149165698 ], [ 2010, 0.010312410666281408 ], [ 2016, 0.010324716645596779 ], [ 2023, 0.010632366128481069 ], [ 2030, 0.010386246542173638 ], [ 2036, 0.009303320362420936 ], [ 2043, 0.00994323128682026 ], [ 2049, 0.010669284066427184 ], [ 2056, 0.009746335617774314 ], [ 2063, 0.010435470459435122 ], [ 2069, 0.010620060149165698 ], [ 2076, 0.010226268811073806 ], [ 2083, 0.009463298093520766 ], [ 2089, 0.009844783452297286 ], [ 2096, 0.009266402424474822 ], [ 2102, 0.010250880769704549 ], [ 2109, 0.009254096445159449 ], [ 2116, 0.009438686134890023 ], [ 2122, 0.009770947576405056 ], [ 2129, 0.008897223045013673 ], [ 2136, 0.00919256654858259 ], [ 2142, 0.009229484486528706 ], [ 2149, 0.009315626341736308 ], [ 2156, 0.008392677893083436 ], [ 2162, 0.008528043665552524 ], [ 2169, 0.008688021396652356 ], [ 2175, 0.008897223045013673 ], [ 2182, 0.008700327375967728 ], [ 2189, 0.009007976858852016 ], [ 2195, 0.008294230058560463 ], [ 2202, 0.008712633355283097 ], [ 2209, 0.008011192534306917 ], [ 2215, 0.008528043665552524 ], [ 2222, 0.009069506755428875 ], [ 2228, 0.008860305107067559 ], [ 2235, 0.009217178507213335 ], [ 2242, 0.009352544279682422 ], [ 2248, 0.008688021396652356 ], [ 2255, 0.00856496160349864 ], [ 2262, 0.008860305107067559 ], [ 2268, 0.008454207789660296 ], [ 2275, 0.008331147996506577 ], [ 2282, 0.008466513768975666 ], [ 2288, 0.008318842017191207 ], [ 2295, 0.008688021396652356 ], [ 2301, 0.00825731212061435 ], [ 2308, 0.00810964036882989 ], [ 2315, 0.008011192534306917 ], [ 2321, 0.008712633355283097 ], [ 2328, 0.008158864286091376 ], [ 2335, 0.008134252327460633 ], [ 2341, 0.008909529024329045 ], [ 2348, 0.0077158490307379975 ], [ 2354, 0.008171170265406747 ], [ 2361, 0.008429595831029552 ], [ 2368, 0.008811081189806072 ], [ 2374, 0.00835575995513732 ], [ 2381, 0.007998886554991546 ], [ 2388, 0.00794966263773006 ], [ 2394, 0.008220394182668234 ], [ 2401, 0.007395893568538337 ], [ 2408, 0.007494341403061309 ], [ 2414, 0.0078019908859456 ], [ 2421, 0.007826602844576343 ], [ 2427, 0.0077158490307379975 ], [ 2434, 0.00812194634814526 ], [ 2441, 0.007912744699783944 ], [ 2447, 0.007285139754699991 ], [ 2454, 0.007383587589222965 ], [ 2461, 0.007937356658414687 ], [ 2467, 0.0072359158374385064 ], [ 2474, 0.007728155010053369 ], [ 2480, 0.007162079961546276 ], [ 2487, 0.006854430478661985 ], [ 2494, 0.007211303878807763 ], [ 2500, 0.007506647382376681 ], [ 2507, 0.007900438720468571 ], [ 2514, 0.007851214803207086 ], [ 2520, 0.0075435653203227955 ], [ 2527, 0.007654319134161141 ], [ 2534, 0.007383587589222965 ], [ 2540, 0.0077158490307379975 ], [ 2547, 0.007691237072107254 ], [ 2553, 0.00781429686526097 ], [ 2560, 0.007925050679099314 ], [ 2567, 0.007789684906630228 ], [ 2573, 0.007432811506484452 ], [ 2580, 0.006706758726877526 ], [ 2587, 0.007297445734015363 ], [ 2593, 0.007482035423745937 ], [ 2600, 0.006989796251131074 ], [ 2606, 0.007617401196215025 ], [ 2613, 0.007457423465115194 ], [ 2620, 0.007051326147707931 ], [ 2626, 0.007518953361692052 ], [ 2633, 0.006989796251131074 ], [ 2640, 0.007100550064969418 ], [ 2646, 0.007174385940861647 ], [ 2653, 0.007051326147707931 ], [ 2660, 0.006952878313184959 ], [ 2666, 0.0073712816099075935 ], [ 2673, 0.00734666965127685 ], [ 2679, 0.007063632127023303 ], [ 2686, 0.007334363671961479 ], [ 2693, 0.006472945119885465 ], [ 2699, 0.0065590869750930675 ], [ 2706, 0.007494341403061309 ], [ 2713, 0.006977490271815702 ], [ 2719, 0.005919176050693743 ], [ 2726, 0.006817512540715872 ], [ 2732, 0.0062883554301548916 ], [ 2739, 0.007002102230446445 ], [ 2746, 0.006239131512893405 ], [ 2752, 0.0062883554301548916 ], [ 2759, 0.007063632127023303 ], [ 2766, 0.006632922850985296 ], [ 2772, 0.006719064706192898 ], [ 2779, 0.00620221357494729 ], [ 2785, 0.007002102230446445 ], [ 2792, 0.006842124499346613 ], [ 2799, 0.006928266354554216 ], [ 2805, 0.005943788009324487 ], [ 2812, 0.006522169037146953 ], [ 2819, 0.006780594602769756 ], [ 2825, 0.006694452747562155 ], [ 2832, 0.006509863057831581 ], [ 2839, 0.007223609858123135 ], [ 2845, 0.0065590869750930675 ], [ 2852, 0.0069036543959234715 ], [ 2858, 0.007260527796069248 ], [ 2865, 0.006226825533578033 ], [ 2872, 0.0068052065614005 ], [ 2878, 0.00665753480961604 ], [ 2885, 0.006755982644139013 ], [ 2892, 0.006362191306047121 ], [ 2898, 0.005648444505755568 ], [ 2905, 0.00566075048507094 ], [ 2911, 0.005796116257540027 ], [ 2918, 0.006091459761108946 ], [ 2925, 0.006079153781793575 ], [ 2931, 0.006005317905901345 ], [ 2938, 0.005956093988639858 ], [ 2945, 0.006189907595631919 ], [ 2951, 0.00596839996795523 ], [ 2958, 0.0060545418231628305 ], [ 2965, 0.005488466774655737 ], [ 2971, 0.006042235843847459 ], [ 2978, 0.005956093988639858 ], [ 2984, 0.0061529896576858045 ], [ 2991, 0.0057838102782246555 ], [ 2998, 0.00634988532673175 ], [ 3004, 0.005943788009324487 ], [ 3011, 0.005537690691917224 ], [ 3018, 0.00634988532673175 ], [ 3024, 0.006583698933723811 ], [ 3031, 0.006128377699055061 ], [ 3037, 0.0061529896576858045 ], [ 3044, 0.006066847802478202 ], [ 3051, 0.006854430478661985 ], [ 3057, 0.006312967388785635 ], [ 3064, 0.006682146768246783 ], [ 3071, 0.006103765740424318 ], [ 3077, 0.005980705947270602 ], [ 3084, 0.00665753480961604 ], [ 3091, 0.0061529896576858045 ], [ 3097, 0.005759198319593912 ], [ 3104, 0.005734586360963169 ], [ 3110, 0.005648444505755568 ], [ 3117, 0.006362191306047121 ], [ 3124, 0.00520542925040219 ], [ 3130, 0.005082369457248474 ], [ 3137, 0.005377712960817392 ], [ 3144, 0.005796116257540027 ], [ 3150, 0.006251437492208777 ], [ 3157, 0.005525384712601852 ], [ 3163, 0.005980705947270602 ], [ 3170, 0.005266959146979049 ], [ 3177, 0.005894564092063 ], [ 3183, 0.005008533581356244 ], [ 3190, 0.005599220588494082 ], [ 3197, 0.005500772753971109 ], [ 3203, 0.00551307873328648 ], [ 3210, 0.005451548836709622 ], [ 3217, 0.005599220588494082 ], [ 3223, 0.006128377699055061 ], [ 3230, 0.006189907595631919 ], [ 3236, 0.0057468923402785406 ], [ 3243, 0.005131593374509961 ], [ 3250, 0.006399109243993237 ], [ 3256, 0.0060545418231628305 ], [ 3263, 0.006177601616316548 ], [ 3270, 0.0058822581127476285 ], [ 3276, 0.0055746086298633386 ], [ 3283, 0.005796116257540027 ], [ 3289, 0.006177601616316548 ], [ 3296, 0.006337579347416378 ], [ 3303, 0.0061529896576858045 ], [ 3309, 0.0060176238852167165 ], [ 3316, 0.00627604945083952 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "smooth_points": 500, "smooth_points_sumcounts": [ true, false ], "id": "picard_insert_size", "title": "Picard: Insert Size", "ylab": "Count", "xlab": "Insert Size (bp)", "xDecimals": false, "tt_label": "{point.x} bp: {point.y:.0f}", "ymin": 0, "data_labels": [ { "name": "Counts", "ylab": "Coverage", "categories": [] }, { "name": "Percentages", "ylab": "Percentage of Counts", "categories": [] } ] } }, "picard_deduplication": { "id": "picard_deduplication", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "Picard: Deduplication Stats", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "picard_deduplication", "dconfig": {}, "layout": { "title": { "text": "Picard: Deduplication Stats" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 19875412 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Unique Pairs", "data": [ 15829710, 16149294 ], "color": "0.49,0.71,0.93", "data_pct": [ 79.690396884577, 81.25262510281547 ] }, { "name": "Duplicate Pairs Optical", "data": [ 36510, 24134 ], "color": "0.26,0.26,0.28", "data_pct": [ 0.18379972786967708, 0.12142641370151219 ] }, { "name": "Duplicate Pairs Nonoptical", "data": [ 3910566, 3625400 ], "color": "0.56,0.93,0.49", "data_pct": [ 19.686687664103303, 18.240628169116697 ] }, { "name": "Duplicate Unpaired", "data": [ 3, 2 ], "color": "0.97,0.64,0.36", "data_pct": [ 1.5102689225117261e-05, 1.0062684486741709e-05 ] }, { "name": "Unmapped", "data": [ 87223, 76582 ], "color": "0.50,0.52,0.91", "data_pct": [ 0.43910062076080103, 0.38531025168182675 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": true, "l_active": false, "square": null, "config": { "id": "picard_deduplication", "title": "Picard: Deduplication Stats", "ylab": "# Reads", "cpswitch_counts_label": "Number of Reads", "cpswitch_c_active": false } }, "picard_rnaseqmetrics_assignment_plot": { "id": "picard_rnaseqmetrics_assignment_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "Picard: RnaSeqMetrics Base Assignments", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "picard_rnaseqmetrics_assignment_plot", "dconfig": {}, "layout": { "title": { "text": "Picard: RnaSeqMetrics Base Assignments" }, "xaxis": { "title": { "text": "Number of bases" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 2795883347 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Coding", "data": [ 2400643463, 2470896529 ], "color": "0.49,0.71,0.93", "data_pct": [ 87.16024010196365, 88.37623828802754 ] }, { "name": "UTR", "data": [ 197498918, 201902141 ], "color": "0.26,0.26,0.28", "data_pct": [ 7.170599623838449, 7.221407903754004 ] }, { "name": "Intronic", "data": [ 94951215, 86792356 ], "color": "0.56,0.93,0.49", "data_pct": [ 3.44739684377412, 3.104291031781735 ] }, { "name": "Intergenic", "data": [ 32077096, 13205956 ], "color": "0.97,0.64,0.36", "data_pct": [ 1.1646241652393752, 0.4723357293919316 ] }, { "name": "Ribosomal", "data": [ 2380143, 300 ], "color": "0.50,0.52,0.91", "data_pct": [ 0.08641592912666853, 1.073006140695755e-05 ] }, { "name": "PF not aligned", "data": [ 26736510, 23086065 ], "color": "0.95,0.36,0.50", "data_pct": [ 0.9707233360577343, 0.825716316983378 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "picard_rnaseqmetrics_assignment_plot", "title": "Picard: RnaSeqMetrics Base Assignments", "ylab": "Number of bases" } }, "picard_rna_coverage": { "id": "picard_rna_coverage", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Picard: Normalized Gene Coverage", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "picard_rna_coverage", "dconfig": { "categories": [] }, "layout": { "title": { "text": "Picard: Normalized Gene Coverage" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percent through gene" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Coverage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.0f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 0, 0.309711 ], [ 1, 0.346553 ], [ 2, 0.40561 ], [ 3, 0.470656 ], [ 4, 0.537896 ], [ 5, 0.614158 ], [ 6, 0.684648 ], [ 7, 0.738329 ], [ 8, 0.789637 ], [ 9, 0.828806 ], [ 10, 0.866681 ], [ 11, 0.904154 ], [ 12, 0.940791 ], [ 13, 0.977607 ], [ 14, 1.009535 ], [ 15, 1.043883 ], [ 16, 1.072314 ], [ 17, 1.084224 ], [ 18, 1.091344 ], [ 19, 1.111463 ], [ 20, 1.129586 ], [ 21, 1.144436 ], [ 22, 1.153642 ], [ 23, 1.165019 ], [ 24, 1.179679 ], [ 25, 1.187506 ], [ 26, 1.195764 ], [ 27, 1.199859 ], [ 28, 1.200035 ], [ 29, 1.192135 ], [ 30, 1.179665 ], [ 31, 1.172731 ], [ 32, 1.161183 ], [ 33, 1.168447 ], [ 34, 1.168088 ], [ 35, 1.16902 ], [ 36, 1.172234 ], [ 37, 1.16216 ], [ 38, 1.154721 ], [ 39, 1.146874 ], [ 40, 1.134038 ], [ 41, 1.130972 ], [ 42, 1.139922 ], [ 43, 1.144444 ], [ 44, 1.143409 ], [ 45, 1.14165 ], [ 46, 1.140949 ], [ 47, 1.141277 ], [ 48, 1.137295 ], [ 49, 1.139882 ], [ 50, 1.150497 ], [ 51, 1.150395 ], [ 52, 1.14884 ], [ 53, 1.145621 ], [ 54, 1.147696 ], [ 55, 1.147571 ], [ 56, 1.152178 ], [ 57, 1.152211 ], [ 58, 1.146733 ], [ 59, 1.143444 ], [ 60, 1.141569 ], [ 61, 1.144566 ], [ 62, 1.138619 ], [ 63, 1.130625 ], [ 64, 1.120877 ], [ 65, 1.116734 ], [ 66, 1.115729 ], [ 67, 1.10746 ], [ 68, 1.100787 ], [ 69, 1.095879 ], [ 70, 1.090612 ], [ 71, 1.088397 ], [ 72, 1.088978 ], [ 73, 1.084292 ], [ 74, 1.077125 ], [ 75, 1.065958 ], [ 76, 1.055391 ], [ 77, 1.039038 ], [ 78, 1.029497 ], [ 79, 1.021956 ], [ 80, 0.998467 ], [ 81, 0.976544 ], [ 82, 0.960909 ], [ 83, 0.944819 ], [ 84, 0.922483 ], [ 85, 0.900228 ], [ 86, 0.870929 ], [ 87, 0.862738 ], [ 88, 0.860338 ], [ 89, 0.836321 ], [ 90, 0.815203 ], [ 91, 0.784223 ], [ 92, 0.759136 ], [ 93, 0.734634 ], [ 94, 0.705999 ], [ 95, 0.676786 ], [ 96, 0.6461 ], [ 97, 0.62318 ], [ 98, 0.581398 ], [ 99, 0.542495 ], [ 100, 0.501162 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 0, 0.31384 ], [ 1, 0.35613 ], [ 2, 0.432987 ], [ 3, 0.515289 ], [ 4, 0.587595 ], [ 5, 0.660486 ], [ 6, 0.726424 ], [ 7, 0.780129 ], [ 8, 0.829338 ], [ 9, 0.872901 ], [ 10, 0.909585 ], [ 11, 0.939608 ], [ 12, 0.975934 ], [ 13, 1.012808 ], [ 14, 1.036853 ], [ 15, 1.064561 ], [ 16, 1.084072 ], [ 17, 1.10147 ], [ 18, 1.109069 ], [ 19, 1.132917 ], [ 20, 1.151881 ], [ 21, 1.16543 ], [ 22, 1.174495 ], [ 23, 1.178809 ], [ 24, 1.186087 ], [ 25, 1.189214 ], [ 26, 1.192396 ], [ 27, 1.188338 ], [ 28, 1.186295 ], [ 29, 1.17864 ], [ 30, 1.160312 ], [ 31, 1.153343 ], [ 32, 1.14244 ], [ 33, 1.147909 ], [ 34, 1.149988 ], [ 35, 1.154553 ], [ 36, 1.15302 ], [ 37, 1.14338 ], [ 38, 1.135031 ], [ 39, 1.12947 ], [ 40, 1.121112 ], [ 41, 1.119347 ], [ 42, 1.12874 ], [ 43, 1.131274 ], [ 44, 1.135245 ], [ 45, 1.133415 ], [ 46, 1.131511 ], [ 47, 1.129232 ], [ 48, 1.12542 ], [ 49, 1.129481 ], [ 50, 1.140017 ], [ 51, 1.13864 ], [ 52, 1.138577 ], [ 53, 1.134826 ], [ 54, 1.137382 ], [ 55, 1.133095 ], [ 56, 1.131532 ], [ 57, 1.128972 ], [ 58, 1.124459 ], [ 59, 1.119512 ], [ 60, 1.114492 ], [ 61, 1.116643 ], [ 62, 1.111405 ], [ 63, 1.105245 ], [ 64, 1.098802 ], [ 65, 1.095564 ], [ 66, 1.094848 ], [ 67, 1.08728 ], [ 68, 1.080188 ], [ 69, 1.078516 ], [ 70, 1.07072 ], [ 71, 1.063914 ], [ 72, 1.056756 ], [ 73, 1.05226 ], [ 74, 1.043466 ], [ 75, 1.036107 ], [ 76, 1.033195 ], [ 77, 1.022765 ], [ 78, 1.01718 ], [ 79, 1.013339 ], [ 80, 0.997186 ], [ 81, 0.981692 ], [ 82, 0.966946 ], [ 83, 0.953471 ], [ 84, 0.935427 ], [ 85, 0.918758 ], [ 86, 0.89125 ], [ 87, 0.878174 ], [ 88, 0.875717 ], [ 89, 0.855333 ], [ 90, 0.837316 ], [ 91, 0.807179 ], [ 92, 0.787559 ], [ 93, 0.76148 ], [ 94, 0.727603 ], [ 95, 0.692064 ], [ 96, 0.655598 ], [ 97, 0.625537 ], [ 98, 0.577016 ], [ 99, 0.535906 ], [ 100, 0.494773 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "smooth_points": 500, "smooth_points_sumcounts": [ true, false ], "id": "picard_rna_coverage", "title": "Picard: Normalized Gene Coverage", "ylab": "Coverage", "xlab": "Percent through gene", "xDecimals": false, "tt_label": "{point.x}%: {point.y:.0f}", "ymin": 0 } }, "preseq_complexity_plot_molecules": { "id": "preseq_complexity_plot_molecules", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Preseq: Complexity curve (molecule count)", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "preseq_complexity_plot_molecules", "dconfig": { "categories": [] }, "layout": { "title": { "text": "Preseq: Complexity curve (molecule count)" }, "xaxis": { "hoverformat": null, "ticksuffix": "M", "title": { "text": "Total molecules (including duplicates)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 232.0 } }, "yaxis": { "hoverformat": null, "ticksuffix": "M", "title": { "text": "Unique molecules" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{y:,.2f} M unique molecules: %{x:,.2f} M total molecules", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21.lc_extrap", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.9653484999999999 ], [ 2.0, 1.8801245 ], [ 3.0, 2.754531 ], [ 4.0, 3.5937769999999998 ], [ 5.0, 4.401418 ], [ 6.0, 5.180121499999999 ], [ 7.0, 5.9320695 ], [ 8.0, 6.659084 ], [ 9.0, 7.362728499999999 ], [ 10.0, 8.0443172 ], [ 11.0, 8.7051425 ], [ 12.0, 9.3463985 ], [ 13.0, 9.968803999999999 ], [ 14.0, 10.5735485 ], [ 15.0, 11.161503399999999 ], [ 16.0, 11.733225099999999 ], [ 17.0, 12.2894269 ], [ 18.0, 12.8309453 ], [ 19.0, 13.3583844 ], [ 20.0, 13.8723806 ], [ 21.0, 14.373498099999999 ], [ 22.0, 14.8617841 ], [ 23.0, 15.3383424 ], [ 24.0, 15.803266199999998 ], [ 25.0, 16.2571538 ], [ 26.0, 16.7000796 ], [ 27.0, 17.1326349 ], [ 28.0, 17.5551212 ], [ 29.0, 17.9681318 ], [ 30.0, 18.3718456 ], [ 31.0, 18.7660982 ], [ 32.0, 19.1526408 ], [ 33.0, 19.5310939 ], [ 34.0, 19.9002019 ], [ 35.0, 20.261794 ], [ 36.0, 20.616169499999998 ], [ 37.0, 20.9634061 ], [ 38.0, 21.3033157 ], [ 39.0, 21.6363895 ], [ 40.0, 21.962472399999996 ], [ 41.0, 22.282052399999998 ], [ 42.0, 22.5951612 ], [ 43.0, 22.902275 ], [ 44.0, 23.2033311 ], [ 45.0, 23.498828899999996 ], [ 46.0, 23.7888033 ], [ 47.0, 24.073608999999998 ], [ 48.0, 24.3531206 ], [ 49.0, 24.6271536 ], [ 50.0, 24.896641499999998 ], [ 51.0, 25.1610408 ], [ 52.0, 25.4211376 ], [ 53.0, 25.676824999999997 ], [ 54.0, 25.927958699999998 ], [ 55.0, 26.1746063 ], [ 56.0, 26.4170136 ], [ 57.0, 26.655115399999996 ], [ 58.0, 26.8891601 ], [ 59.0, 27.1192786 ], [ 60.0, 27.3455694 ], [ 61.0, 27.5681278 ], [ 62.0, 27.787045799999998 ], [ 63.0, 28.002412399999997 ], [ 64.0, 28.214313699999998 ], [ 65.0, 28.4228332 ], [ 66.0, 28.628051399999997 ], [ 67.0, 28.830046499999998 ], [ 68.0, 29.028893999999998 ], [ 69.0, 29.2246576 ], [ 70.0, 29.416835799999998 ], [ 71.0, 29.605718999999997 ], [ 72.0, 29.7916996 ], [ 73.0, 29.974842699999996 ], [ 74.0, 30.1552287 ], [ 75.0, 30.3337693 ], [ 76.0, 30.509689899999998 ], [ 77.0, 30.6830478 ], [ 78.0, 30.8538988 ], [ 79.0, 31.022297 ], [ 80.0, 31.188295 ], [ 81.0, 31.3519438 ], [ 82.0, 31.5132931 ], [ 83.0, 31.6723911 ], [ 84.0, 31.8292847 ], [ 85.0, 31.9840195 ], [ 86.0, 32.1366399 ], [ 87.0, 32.287189 ], [ 88.0, 32.4357087 ], [ 89.0, 32.5822399 ], [ 90.0, 32.726822399999996 ], [ 91.0, 32.8694948 ], [ 92.0, 33.010294699999996 ], [ 93.0, 33.1492436 ], [ 94.0, 33.2862085 ], [ 95.0, 33.4214076 ], [ 96.0, 33.5548747 ], [ 97.0, 33.6866431 ], [ 98.0, 33.816745 ], [ 99.0, 33.9452119 ], [ 100.0, 34.0720743 ], [ 101.0, 34.197362299999995 ], [ 102.0, 34.321104899999995 ], [ 103.0, 34.4433306 ], [ 104.0, 34.5640673 ], [ 105.0, 34.683341799999994 ], [ 106.0, 34.8011807 ], [ 107.0, 34.917609799999994 ], [ 108.0, 35.0326542 ], [ 109.0, 35.1463385 ], [ 110.0, 35.2586866 ], [ 111.0, 35.3697222 ], [ 112.0, 35.479467899999996 ], [ 113.0, 35.5879463 ], [ 114.0, 35.6951791 ], [ 115.0, 35.8011876 ], [ 116.0, 35.90599279999999 ], [ 117.0, 36.0096151 ], [ 118.0, 36.112074299999996 ], [ 119.0, 36.213389899999996 ], [ 120.0, 36.3135811 ], [ 121.0, 36.4126664 ], [ 122.0, 36.510664 ], [ 123.0, 36.607591799999994 ], [ 124.0, 36.7034672 ], [ 125.0, 36.7983073 ], [ 126.0, 36.892128799999995 ], [ 127.0, 36.984947899999995 ], [ 128.0, 37.0767807 ], [ 129.0, 37.1676429 ], [ 130.0, 37.2575496 ], [ 131.0, 37.3465161 ], [ 132.0, 37.434556799999996 ], [ 133.0, 37.52168629999999 ], [ 134.0, 37.6079185 ], [ 135.0, 37.693267299999995 ], [ 136.0, 37.7777463 ], [ 137.0, 37.8613685 ], [ 138.0, 37.9441471 ], [ 139.0, 38.0260947 ], [ 140.0, 38.1072237 ], [ 141.0, 38.187546399999995 ], [ 142.0, 38.267074799999996 ], [ 143.0, 38.3458206 ], [ 144.0, 38.4237952 ], [ 145.0, 38.5010101 ], [ 146.0, 38.5774761 ], [ 147.0, 38.653204200000005 ], [ 148.0, 38.728204899999994 ], [ 149.0, 38.80248879999999 ], [ 150.0, 38.8760661 ], [ 151.0, 38.948946799999995 ], [ 152.0, 39.021140700000004 ], [ 153.0, 39.0926575 ], [ 154.0, 39.1635067 ], [ 155.0, 39.2336976 ], [ 156.0, 39.303239399999995 ], [ 157.0, 39.372141 ], [ 158.0, 39.4404112 ], [ 159.0, 39.5080587 ], [ 160.0, 39.5750919 ], [ 161.0, 39.6415191 ], [ 162.0, 39.7073486 ], [ 163.0, 39.7725885 ], [ 164.0, 39.8372464 ], [ 165.0, 39.9013304 ], [ 166.0, 39.964847799999994 ], [ 167.0, 40.027806299999995 ], [ 168.0, 40.0902132 ], [ 169.0, 40.152075599999996 ], [ 170.0, 40.213400799999995 ], [ 171.0, 40.2741956 ], [ 172.0, 40.334466899999995 ], [ 173.0, 40.3942215 ], [ 174.0, 40.4534659 ], [ 175.0, 40.5122067 ], [ 176.0, 40.5704503 ], [ 177.0, 40.6282029 ], [ 178.0, 40.6854708 ], [ 179.0, 40.74226 ], [ 180.0, 40.798576499999996 ], [ 181.0, 40.8544262 ], [ 182.0, 40.90981479999999 ], [ 183.0, 40.9647481 ], [ 184.0, 41.0192316 ], [ 185.0, 41.0732709 ], [ 186.0, 41.1268713 ], [ 187.0, 41.1800382 ], [ 188.0, 41.2327769 ], [ 189.0, 41.285092399999996 ], [ 190.0, 41.3369898 ], [ 191.0, 41.388474200000005 ], [ 192.0, 41.439550399999995 ], [ 193.0, 41.4902234 ], [ 194.0, 41.5404978 ], [ 195.0, 41.5903783 ], [ 196.0, 41.6398696 ], [ 197.0, 41.6889761 ], [ 198.0, 41.737702399999996 ], [ 199.0, 41.786052899999994 ], [ 200.0, 41.8340318 ], [ 201.0, 41.881643499999996 ], [ 202.0, 41.9288922 ], [ 203.0, 41.975781899999994 ], [ 204.0, 42.02231679999999 ], [ 205.0, 42.0685009 ], [ 206.0, 42.1143381 ], [ 207.0, 42.1598324 ], [ 208.0, 42.2049875 ], [ 209.0, 42.24980729999999 ], [ 210.0, 42.29427939999999 ], [ 211.0, 42.33837079999999 ], [ 212.0, 42.3821381 ], [ 213.0, 42.425584799999996 ], [ 214.0, 42.468714399999996 ], [ 215.0, 42.5115304 ], [ 216.0, 42.55403629999999 ], [ 217.0, 42.5962353 ], [ 218.0, 42.63813089999999 ], [ 219.0, 42.679726099999996 ], [ 220.0, 42.7210244 ], [ 221.0, 42.7620287 ], [ 222.0, 42.8027369 ], [ 223.0, 42.843146299999994 ], [ 224.0, 42.8832711 ], [ 225.0, 42.923114399999996 ], [ 226.0, 42.962679 ], [ 227.0, 43.001968 ], [ 228.0, 43.0409841 ], [ 229.0, 43.0797302 ], [ 230.0, 43.1182091 ], [ 231.0, 43.1564236 ], [ 232.0, 43.194376299999995 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42.lc_extrap", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.9576144999999999 ], [ 2.0, 1.8586049999999998 ], [ 3.0, 2.7164029999999997 ], [ 4.0, 3.5373265 ], [ 5.0, 4.3256065 ], [ 6.0, 5.084357499999999 ], [ 7.0, 5.8159184999999995 ], [ 8.0, 6.5223415 ], [ 9.0, 7.205397499999999 ], [ 10.0, 7.866719 ], [ 11.0, 8.507426800000001 ], [ 12.0, 9.1287215 ], [ 13.0, 9.731650499999999 ], [ 14.0, 10.3171626 ], [ 15.0, 10.8860439 ], [ 16.0, 11.4390348 ], [ 17.0, 11.9768636 ], [ 18.0, 12.5006355 ], [ 19.0, 13.010669 ], [ 20.0, 13.5074417 ], [ 21.0, 13.9916229 ], [ 22.0, 14.4637581 ], [ 23.0, 14.924381599999998 ], [ 24.0, 15.373693099999999 ], [ 25.0, 15.8124769 ], [ 26.0, 16.2410085 ], [ 27.0, 16.6591064 ], [ 28.0, 17.067784399999997 ], [ 29.0, 17.4668337 ], [ 30.0, 17.8574498 ], [ 31.0, 18.239630899999998 ], [ 32.0, 18.6131915 ], [ 33.0, 18.979094 ], [ 34.0, 19.33702 ], [ 35.0, 19.6881313 ], [ 36.0, 20.0309079 ], [ 37.0, 20.367136499999997 ], [ 38.0, 20.6968419 ], [ 39.0, 21.0199999 ], [ 40.0, 21.336370600000002 ], [ 41.0, 21.646521399999997 ], [ 42.0, 21.950581699999997 ], [ 43.0, 22.248758600000002 ], [ 44.0, 22.5414661 ], [ 45.0, 22.8281723 ], [ 46.0, 23.109641699999997 ], [ 47.0, 23.385900399999997 ], [ 48.0, 23.6570943 ], [ 49.0, 23.923234899999997 ], [ 50.0, 24.184843100000002 ], [ 51.0, 24.441663199999997 ], [ 52.0, 24.6939283 ], [ 53.0, 24.9417825 ], [ 54.0, 25.1853956 ], [ 55.0, 25.4247851 ], [ 56.0, 25.660536699999998 ], [ 57.0, 25.8918898 ], [ 58.0, 26.1199551 ], [ 59.0, 26.3438247 ], [ 60.0, 26.5639413 ], [ 61.0, 26.7810551 ], [ 62.0, 26.994490399999997 ], [ 63.0, 27.2040873 ], [ 64.0, 27.4103501 ], [ 65.0, 27.6133585 ], [ 66.0, 27.8131893 ], [ 67.0, 28.009917399999996 ], [ 68.0, 28.203614899999998 ], [ 69.0, 28.3943263 ], [ 70.0, 28.582429899999998 ], [ 71.0, 28.767752899999998 ], [ 72.0, 28.94999 ], [ 73.0, 29.1296376 ], [ 74.0, 29.3074405 ], [ 75.0, 29.482408899999996 ], [ 76.0, 29.6546786 ], [ 77.0, 29.8243006 ], [ 78.0, 29.9913476 ], [ 79.0, 30.1560268 ], [ 80.0, 30.3183531 ], [ 81.0, 30.4783968 ], [ 82.0, 30.636218999999997 ], [ 83.0, 30.7918658 ], [ 84.0, 30.945382 ], [ 85.0, 31.096811199999998 ], [ 86.0, 31.2461961 ], [ 87.0, 31.393577699999998 ], [ 88.0, 31.5389964 ], [ 89.0, 31.682491199999998 ], [ 90.0, 31.8241031 ], [ 91.0, 31.9640195 ], [ 92.0, 32.1021246 ], [ 93.0, 32.2384535 ], [ 94.0, 32.3730403 ], [ 95.0, 32.5059184 ], [ 96.0, 32.6371202 ], [ 97.0, 32.7666774 ], [ 98.0, 32.8946208 ], [ 99.0, 33.0209805 ], [ 100.0, 33.1457859 ], [ 101.0, 33.269065399999995 ], [ 102.0, 33.3908471 ], [ 103.0, 33.5111582 ], [ 104.0, 33.6300252 ], [ 105.0, 33.747474 ], [ 106.0, 33.8635301 ], [ 107.0, 33.9782179 ], [ 108.0, 34.091561799999994 ], [ 109.0, 34.2035852 ], [ 110.0, 34.3143112 ], [ 111.0, 34.4237622 ], [ 112.0, 34.5319561 ], [ 113.0, 34.638721499999996 ], [ 114.0, 34.7442761 ], [ 115.0, 34.8486405 ], [ 116.0, 34.9518347 ], [ 117.0, 35.053878299999994 ], [ 118.0, 35.1547906 ], [ 119.0, 35.2545902 ], [ 120.0, 35.3532955 ], [ 121.0, 35.4509245 ], [ 122.0, 35.5474946 ], [ 123.0, 35.6430231 ], [ 124.0, 35.737526700000004 ], [ 125.0, 35.831021899999996 ], [ 126.0, 35.923524799999996 ], [ 127.0, 36.015051 ], [ 128.0, 36.1056161 ], [ 129.0, 36.195235 ], [ 130.0, 36.2839227 ], [ 131.0, 36.3716934 ], [ 132.0, 36.4585615 ], [ 133.0, 36.54454079999999 ], [ 134.0, 36.629644799999994 ], [ 135.0, 36.713887 ], [ 136.0, 36.7972802 ], [ 137.0, 36.8798374 ], [ 138.0, 36.9615711 ], [ 139.0, 37.0424935 ], [ 140.0, 37.1226166 ], [ 141.0, 37.201952299999995 ], [ 142.0, 37.280512200000004 ], [ 143.0, 37.358307499999995 ], [ 144.0, 37.4353494 ], [ 145.0, 37.511740499999995 ], [ 146.0, 37.5874261 ], [ 147.0, 37.6623905 ], [ 148.0, 37.736643799999996 ], [ 149.0, 37.8101961 ], [ 150.0, 37.8830574 ], [ 151.0, 37.95523729999999 ], [ 152.0, 38.026745299999995 ], [ 153.0, 38.0975909 ], [ 154.0, 38.1677831 ], [ 155.0, 38.237331 ], [ 156.0, 38.3062435 ], [ 157.0, 38.3745292 ], [ 158.0, 38.442196700000004 ], [ 159.0, 38.5092542 ], [ 160.0, 38.5757101 ], [ 161.0, 38.641572399999994 ], [ 162.0, 38.7068441 ], [ 163.0, 38.7715221 ], [ 164.0, 38.835629899999994 ], [ 165.0, 38.899175 ], [ 166.0, 38.9621649 ], [ 167.0, 39.024606799999994 ], [ 168.0, 39.08650779999999 ], [ 169.0, 39.147875 ], [ 170.0, 39.2087152 ], [ 171.0, 39.269035099999996 ], [ 172.0, 39.3288416 ], [ 173.0, 39.388140899999996 ], [ 174.0, 39.4469397 ], [ 175.0, 39.5052442 ], [ 176.0, 39.5630607 ], [ 177.0, 39.620395200000004 ], [ 178.0, 39.6772537 ], [ 179.0, 39.7336422 ], [ 180.0, 39.7895664 ], [ 181.0, 39.8450322 ], [ 182.0, 39.900045 ], [ 183.0, 39.9546105 ], [ 184.0, 40.0088845 ], [ 185.0, 40.0627322 ], [ 186.0, 40.116147899999994 ], [ 187.0, 40.1691369 ], [ 188.0, 40.2217041 ], [ 189.0, 40.2738547 ], [ 190.0, 40.3255936 ], [ 191.0, 40.3769256 ], [ 192.0, 40.4278555 ], [ 193.0, 40.478387999999995 ], [ 194.0, 40.52852779999999 ], [ 195.0, 40.5782795 ], [ 196.0, 40.627647399999994 ], [ 197.0, 40.6766347 ], [ 198.0, 40.7250733 ], [ 199.0, 40.7731418 ], [ 200.0, 40.8208445 ], [ 201.0, 40.8681857 ], [ 202.0, 40.915169399999996 ], [ 203.0, 40.9617996 ], [ 204.0, 41.008080299999996 ], [ 205.0, 41.0540154 ], [ 206.0, 41.0996089 ], [ 207.0, 41.144864399999996 ], [ 208.0, 41.1897857 ], [ 209.0, 41.2343766 ], [ 210.0, 41.2786406 ], [ 211.0, 41.3225814 ], [ 212.0, 41.3662024 ], [ 213.0, 41.4095072 ], [ 214.0, 41.4524992 ], [ 215.0, 41.4951817 ], [ 216.0, 41.5375582 ], [ 217.0, 41.579631799999994 ], [ 218.0, 41.6214058 ], [ 219.0, 41.6628834 ], [ 220.0, 41.7040677 ], [ 221.0, 41.7449619 ], [ 222.0, 41.785568999999995 ], [ 223.0, 41.825891999999996 ], [ 224.0, 41.865933899999995 ], [ 225.0, 41.905697700000005 ], [ 226.0, 41.9451861 ], [ 227.0, 41.9844021 ], [ 228.0, 42.0233485 ], [ 229.0, 42.062028 ], [ 230.0, 42.100443399999996 ], [ 231.0, 42.138597399999995 ], [ 232.0, 42.1764926 ] ], "color": "#434348", "marker": {} }, { "name": "a perfect library where each read is unique", "data": [ [ 0, 0 ], [ 43.18325608000001, 43.18325608000001 ] ], "color": "#000000", "marker": { "line": {} }, "line": { "dash": "dash", "width": 1 }, "showlegend": false } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "preseq_complexity_plot_molecules", "title": "Preseq: Complexity curve (molecule count)", "xlab": "Total molecules (including duplicates)", "ylab": "Unique molecules", "xmin": 0, "ymin": 0, "tt_label": "{point.y:,.2f} M unique molecules: {point.x:,.2f} M total molecules", "xsuffix": "M", "ysuffix": "M", "extra_series": [ { "name": "a perfect library where each read is unique", "data": [ [ 0, 0 ], [ 43.18325608000001, 43.18325608000001 ] ], "dashStyle": "Dash", "lineWidth": 1, "color": "#000000", "marker": { "enabled": false }, "showInLegend": false } ], "xmax": 232.0 } }, "rseqc_read_distribution_plot": { "id": "rseqc_read_distribution_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 349, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "RSeQC: Read Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "rseqc_read_distribution_plot", "dconfig": {}, "layout": { "title": { "text": "RSeQC: Read Distribution" }, "xaxis": { "title": { "text": "# Tags" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 32030003 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "CDS_Exons", "data": [ 30188954, 30972808 ], "color": "0.49,0.71,0.93", "data_pct": [ 95.7695423903561, 96.69936028416856 ] }, { "name": "5'UTR_Exons", "data": [ 219647, 221695 ], "color": "0.26,0.26,0.28", "data_pct": [ 0.6967943532397494, 0.6921479214347872 ] }, { "name": "3'UTR_Exons", "data": [ 200962, 208436 ], "color": "0.56,0.93,0.49", "data_pct": [ 0.6375192322943929, 0.6507523586557267 ] }, { "name": "Introns", "data": [ 662649, 551523 ], "color": "0.97,0.64,0.36", "data_pct": [ 2.1021460861289554, 1.7218949370688477 ] }, { "name": "TSS_up_1kb", "data": [ 2778, 2592 ], "color": "0.50,0.52,0.91", "data_pct": [ 0.008812752795622174, 0.00809241260451958 ] }, { "name": "TSS_up_1kb-5kb", "data": [ 2023, 2271 ], "color": "0.95,0.36,0.50", "data_pct": [ 0.006417638194940121, 0.007090227247246902 ] }, { "name": "TSS_up_5kb-10kb", "data": [ 2811, 2740 ], "color": "0.89,0.83,0.33", "data_pct": [ 0.008917439923863906, 0.008554479373604805 ] }, { "name": "TES_down_1kb", "data": [ 2422, 2432 ], "color": "0.17,0.56,0.56", "data_pct": [ 0.0076834007454992465, 0.007592880962265286 ] }, { "name": "TES_down_1kb-5kb", "data": [ 3389, 1339 ], "color": "0.96,0.36,0.36", "data_pct": [ 0.010751050836703942, 0.004180455431115632 ] }, { "name": "TES_down_5kb-10kb", "data": [ 610, 660 ], "color": "0.57,0.91,0.88", "data_pct": [ 0.0019351257038623206, 0.0020605680242989674 ] }, { "name": "Other_intergenic", "data": [ 236255, 63507 ], "color": "0.49,0.71,0.93", "data_pct": [ 0.7494805297803157, 0.198273475029022 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": true, "l_active": false, "square": null, "config": { "id": "rseqc_read_distribution_plot", "title": "RSeQC: Read Distribution", "ylab": "# Tags", "cpswitch_counts_label": "Number of Tags", "cpswitch_c_active": false } }, "rseqc_inner_distance_plot": { "id": "rseqc_inner_distance_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "RSeQC: Inner Distance", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Counts", "uid": "rseqc_inner_distance_plot_Counts", "dconfig": { "name": "Counts", "ylab": "Counts", "categories": [] }, "layout": { "title": { "text": "RSeQC: Inner Distance" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Inner Distance (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Counts" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ -247.5, 0.0 ], [ -242.5, 0.0 ], [ -237.5, 0.0 ], [ -232.5, 0.0 ], [ -227.5, 0.0 ], [ -222.5, 0.0 ], [ -217.5, 0.0 ], [ -212.5, 0.0 ], [ -207.5, 0.0 ], [ -202.5, 0.0 ], [ -197.5, 0.0 ], [ -192.5, 0.0 ], [ -187.5, 0.0 ], [ -182.5, 0.0 ], [ -177.5, 0.0 ], [ -172.5, 0.0 ], [ -167.5, 0.0 ], [ -162.5, 0.0 ], [ -157.5, 0.0 ], [ -152.5, 5634.0 ], [ -147.5, 59131.0 ], [ -142.5, 62494.0 ], [ -137.5, 62358.0 ], [ -132.5, 61106.0 ], [ -127.5, 59172.0 ], [ -122.5, 56093.0 ], [ -117.5, 54668.0 ], [ -112.5, 49941.0 ], [ -107.5, 47216.0 ], [ -102.5, 42115.0 ], [ -97.5, 38389.0 ], [ -92.5, 33529.0 ], [ -87.5, 30303.0 ], [ -82.5, 26252.0 ], [ -77.5, 23370.0 ], [ -72.5, 20757.0 ], [ -67.5, 18780.0 ], [ -62.5, 17315.0 ], [ -57.5, 16131.0 ], [ -52.5, 15216.0 ], [ -47.5, 13742.0 ], [ -42.5, 13380.0 ], [ -37.5, 12359.0 ], [ -32.5, 11796.0 ], [ -27.5, 10900.0 ], [ -22.5, 10380.0 ], [ -17.5, 9703.0 ], [ -12.5, 8805.0 ], [ -7.5, 7819.0 ], [ -2.5, 7286.0 ], [ 2.5, 7367.0 ], [ 7.5, 6585.0 ], [ 12.5, 6023.0 ], [ 17.5, 5504.0 ], [ 22.5, 5145.0 ], [ 27.5, 4706.0 ], [ 32.5, 4174.0 ], [ 37.5, 3853.0 ], [ 42.5, 3490.0 ], [ 47.5, 3321.0 ], [ 52.5, 2853.0 ], [ 57.5, 2568.0 ], [ 62.5, 2250.0 ], [ 67.5, 2191.0 ], [ 72.5, 2012.0 ], [ 77.5, 1816.0 ], [ 82.5, 1598.0 ], [ 87.5, 1581.0 ], [ 92.5, 1340.0 ], [ 97.5, 1267.0 ], [ 102.5, 1165.0 ], [ 107.5, 978.0 ], [ 112.5, 961.0 ], [ 117.5, 830.0 ], [ 122.5, 783.0 ], [ 127.5, 694.0 ], [ 132.5, 665.0 ], [ 137.5, 658.0 ], [ 142.5, 593.0 ], [ 147.5, 494.0 ], [ 152.5, 469.0 ], [ 157.5, 434.0 ], [ 162.5, 423.0 ], [ 167.5, 346.0 ], [ 172.5, 335.0 ], [ 177.5, 312.0 ], [ 182.5, 270.0 ], [ 187.5, 277.0 ], [ 192.5, 232.0 ], [ 197.5, 231.0 ], [ 202.5, 274.0 ], [ 207.5, 228.0 ], [ 212.5, 227.0 ], [ 217.5, 191.0 ], [ 222.5, 189.0 ], [ 227.5, 202.0 ], [ 232.5, 194.0 ], [ 237.5, 159.0 ], [ 242.5, 156.0 ], [ 247.5, 153.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ -247.5, 0.0 ], [ -242.5, 0.0 ], [ -237.5, 0.0 ], [ -232.5, 0.0 ], [ -227.5, 0.0 ], [ -222.5, 0.0 ], [ -217.5, 0.0 ], [ -212.5, 0.0 ], [ -207.5, 0.0 ], [ -202.5, 0.0 ], [ -197.5, 0.0 ], [ -192.5, 0.0 ], [ -187.5, 0.0 ], [ -182.5, 0.0 ], [ -177.5, 0.0 ], [ -172.5, 0.0 ], [ -167.5, 0.0 ], [ -162.5, 0.0 ], [ -157.5, 0.0 ], [ -152.5, 5554.0 ], [ -147.5, 59686.0 ], [ -142.5, 62667.0 ], [ -137.5, 62535.0 ], [ -132.5, 61101.0 ], [ -127.5, 59846.0 ], [ -122.5, 57310.0 ], [ -117.5, 56139.0 ], [ -112.5, 51847.0 ], [ -107.5, 49780.0 ], [ -102.5, 45006.0 ], [ -97.5, 40488.0 ], [ -92.5, 36117.0 ], [ -87.5, 31737.0 ], [ -82.5, 27864.0 ], [ -77.5, 23912.0 ], [ -72.5, 20787.0 ], [ -67.5, 17992.0 ], [ -62.5, 15957.0 ], [ -57.5, 14757.0 ], [ -52.5, 13830.0 ], [ -47.5, 12853.0 ], [ -42.5, 12201.0 ], [ -37.5, 11178.0 ], [ -32.5, 10499.0 ], [ -27.5, 9874.0 ], [ -22.5, 9531.0 ], [ -17.5, 8787.0 ], [ -12.5, 8043.0 ], [ -7.5, 6903.0 ], [ -2.5, 6751.0 ], [ 2.5, 6759.0 ], [ 7.5, 6092.0 ], [ 12.5, 5415.0 ], [ 17.5, 5291.0 ], [ 22.5, 4581.0 ], [ 27.5, 4224.0 ], [ 32.5, 3900.0 ], [ 37.5, 3560.0 ], [ 42.5, 3192.0 ], [ 47.5, 2998.0 ], [ 52.5, 2707.0 ], [ 57.5, 2461.0 ], [ 62.5, 2262.0 ], [ 67.5, 2017.0 ], [ 72.5, 1896.0 ], [ 77.5, 1789.0 ], [ 82.5, 1595.0 ], [ 87.5, 1464.0 ], [ 92.5, 1304.0 ], [ 97.5, 1324.0 ], [ 102.5, 1143.0 ], [ 107.5, 1031.0 ], [ 112.5, 949.0 ], [ 117.5, 892.0 ], [ 122.5, 769.0 ], [ 127.5, 740.0 ], [ 132.5, 667.0 ], [ 137.5, 649.0 ], [ 142.5, 585.0 ], [ 147.5, 549.0 ], [ 152.5, 532.0 ], [ 157.5, 475.0 ], [ 162.5, 459.0 ], [ 167.5, 388.0 ], [ 172.5, 333.0 ], [ 177.5, 332.0 ], [ 182.5, 327.0 ], [ 187.5, 300.0 ], [ 192.5, 269.0 ], [ 197.5, 279.0 ], [ 202.5, 244.0 ], [ 207.5, 254.0 ], [ 212.5, 254.0 ], [ 217.5, 211.0 ], [ 222.5, 186.0 ], [ 227.5, 199.0 ], [ 232.5, 187.0 ], [ 237.5, 188.0 ], [ 242.5, 149.0 ], [ 247.5, 187.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Percentages", "uid": "rseqc_inner_distance_plot_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "categories": [] }, "layout": { "title": { "text": "RSeQC: Inner Distance" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Inner Distance (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Percentage" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ -247.5, 0.0 ], [ -242.5, 0.0 ], [ -237.5, 0.0 ], [ -232.5, 0.0 ], [ -227.5, 0.0 ], [ -222.5, 0.0 ], [ -217.5, 0.0 ], [ -212.5, 0.0 ], [ -207.5, 0.0 ], [ -202.5, 0.0 ], [ -197.5, 0.0 ], [ -192.5, 0.0 ], [ -187.5, 0.0 ], [ -182.5, 0.0 ], [ -177.5, 0.0 ], [ -172.5, 0.0 ], [ -167.5, 0.0 ], [ -162.5, 0.0 ], [ -157.5, 0.0 ], [ -152.5, 0.5697199028826775 ], [ -147.5, 5.979429814937097 ], [ -142.5, 6.319502238329792 ], [ -137.5, 6.305749681213705 ], [ -132.5, 6.179145258350887 ], [ -127.5, 5.983575806420624 ], [ -122.5, 5.6722219581821145 ], [ -117.5, 5.528123473693684 ], [ -112.5, 5.050120992166098 ], [ -107.5, 4.77456424112682 ], [ -102.5, 4.25874222752999 ], [ -97.5, 3.881962611246558 ], [ -92.5, 3.390510937833386 ], [ -87.5, 3.06429219330028 ], [ -82.5, 2.6546480103791357 ], [ -77.5, 2.3632151456102544 ], [ -72.5, 2.0989840298430487 ], [ -67.5, 1.8990663429422585 ], [ -62.5, 1.750922988713802 ], [ -57.5, 1.6311948444090292 ], [ -52.5, 1.5386684491059321 ], [ -47.5, 1.38961499918597 ], [ -42.5, 1.3530089280387336 ], [ -37.5, 1.2497636279245672 ], [ -32.5, 1.1928320863336996 ], [ -27.5, 1.1022270041571147 ], [ -22.5, 1.0496436975367756 ], [ -17.5, 0.9811842771868337 ], [ -12.5, 0.8903769515232474 ], [ -7.5, 0.7906709124316038 ], [ -2.5, 0.7367730231457559 ], [ 2.5, 0.7449638843693087 ], [ 7.5, 0.6658866809517984 ], [ 12.5, 0.6090562611044315 ], [ 17.5, 0.5565740762275927 ], [ 22.5, 0.5202713703108583 ], [ 27.5, 0.4758789249140718 ], [ 32.5, 0.4220821573717245 ], [ 37.5, 0.389622077708015 ], [ 42.5, 0.35291488481727806 ], [ 47.5, 0.33582531016566775 ], [ 52.5, 0.28850033420736226 ], [ 57.5, 0.2596806373096762 ], [ 62.5, 0.22752392287646866 ], [ 67.5, 0.22155774000993017 ], [ 72.5, 0.2034569479233133 ], [ 77.5, 0.18363708619718538 ], [ 82.5, 0.16159254611404308 ], [ 87.5, 0.15987347647453198 ], [ 92.5, 0.13550313629087468 ], [ 97.5, 0.12812124901532704 ], [ 102.5, 0.11780683117826045 ], [ 107.5, 0.09889706514363839 ], [ 112.5, 0.09717799550412728 ], [ 117.5, 0.08393104710554178 ], [ 122.5, 0.0791783251610111 ], [ 127.5, 0.070178489989453 ], [ 132.5, 0.06724595942793407 ], [ 137.5, 0.06653810722342951 ], [ 142.5, 0.05996519389588707 ], [ 147.5, 0.049954141289322455 ], [ 152.5, 0.047426097701806134 ], [ 157.5, 0.04388683667928329 ], [ 162.5, 0.04277449750077611 ], [ 167.5, 0.03498812325122585 ], [ 172.5, 0.03387578407271867 ], [ 177.5, 0.031549983972203655 ], [ 182.5, 0.02730287074517624 ], [ 187.5, 0.028010722949680808 ], [ 192.5, 0.023460244492151436 ], [ 197.5, 0.023359122748650783 ], [ 202.5, 0.027707357719178854 ], [ 207.5, 0.023055757518148826 ], [ 212.5, 0.022954635774648173 ], [ 217.5, 0.019314253008624674 ], [ 222.5, 0.01911200952162337 ], [ 227.5, 0.020426592187131852 ], [ 232.5, 0.01961761823912663 ], [ 237.5, 0.016078357216603785 ], [ 242.5, 0.015774991986101827 ], [ 247.5, 0.015471626755599871 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ -247.5, 0.0 ], [ -242.5, 0.0 ], [ -237.5, 0.0 ], [ -232.5, 0.0 ], [ -227.5, 0.0 ], [ -222.5, 0.0 ], [ -217.5, 0.0 ], [ -212.5, 0.0 ], [ -207.5, 0.0 ], [ -202.5, 0.0 ], [ -197.5, 0.0 ], [ -192.5, 0.0 ], [ -187.5, 0.0 ], [ -182.5, 0.0 ], [ -177.5, 0.0 ], [ -172.5, 0.0 ], [ -167.5, 0.0 ], [ -162.5, 0.0 ], [ -157.5, 0.0 ], [ -152.5, 0.560959104727853 ], [ -147.5, 6.0283408579018065 ], [ -142.5, 6.32942459776384 ], [ -137.5, 6.316092476441535 ], [ -132.5, 6.171257158440142 ], [ -127.5, 6.0445010049591446 ], [ -122.5, 5.788362674100334 ], [ -117.5, 5.670090597824441 ], [ -112.5, 5.236594653011342 ], [ -107.5, 5.027825753214355 ], [ -102.5, 4.545647365391025 ], [ -97.5, 4.089325212859437 ], [ -92.5, 3.6478501954367784 ], [ -87.5, 3.2054661697421447 ], [ -82.5, 2.8142896100354515 ], [ -77.5, 2.415133977719197 ], [ -72.5, 2.09950610550556 ], [ -67.5, 1.8172085365976829 ], [ -62.5, 1.6116716662121624 ], [ -57.5, 1.4904705632821258 ], [ -52.5, 1.3968427112686725 ], [ -47.5, 1.298164813299801 ], [ -42.5, 1.2323122140411478 ], [ -37.5, 1.1289882737932915 ], [ -32.5, 1.0604086497187126 ], [ -27.5, 0.9972830752759849 ], [ -22.5, 0.9626397600218162 ], [ -17.5, 0.8874950762051935 ], [ -12.5, 0.8123503923885709 ], [ -7.5, 0.6972093446050359 ], [ -2.5, 0.6818572049005646 ], [ 2.5, 0.6826652122534315 ], [ 7.5, 0.6152975992081527 ], [ 12.5, 0.5469199769717904 ], [ 17.5, 0.5343958630023533 ], [ 22.5, 0.46268521043541494 ], [ 27.5, 0.426627882313729 ], [ 32.5, 0.39390358452261914 ], [ 37.5, 0.3595632720257755 ], [ 42.5, 0.3223949337938975 ], [ 47.5, 0.3028007554868749 ], [ 52.5, 0.273409488026341 ], [ 57.5, 0.24856326192568354 ], [ 62.5, 0.2284640790231191 ], [ 67.5, 0.20371885384156996 ], [ 72.5, 0.19149774262945793 ], [ 77.5, 0.180690644284863 ], [ 82.5, 0.1610964659778404 ], [ 87.5, 0.14786534557464473 ], [ 92.5, 0.13170519851730653 ], [ 97.5, 0.13372521689947378 ], [ 102.5, 0.11544405054085992 ], [ 107.5, 0.10413194760072317 ], [ 112.5, 0.09584987223383733 ], [ 117.5, 0.09009281984466058 ], [ 122.5, 0.07766970679433183 ], [ 127.5, 0.07474068014018928 ], [ 132.5, 0.06736761304527872 ], [ 137.5, 0.06554959650132816 ], [ 142.5, 0.05908553767839288 ], [ 147.5, 0.05544950459049178 ], [ 152.5, 0.05373248896564959 ], [ 157.5, 0.047975436576472845 ], [ 162.5, 0.04635942187073903 ], [ 167.5, 0.03918835661404519 ], [ 172.5, 0.03363330606308518 ], [ 177.5, 0.03353230514397681 ], [ 182.5, 0.033027300548434994 ], [ 187.5, 0.030300275732509166 ], [ 192.5, 0.027169247240149887 ], [ 197.5, 0.028179256431233524 ], [ 202.5, 0.02464422426244079 ], [ 207.5, 0.025654233453524425 ], [ 212.5, 0.025654233453524425 ], [ 217.5, 0.02131119393186478 ], [ 222.5, 0.018786170954155683 ], [ 227.5, 0.020099182902564416 ], [ 232.5, 0.01888717187326405 ], [ 237.5, 0.01898817279237241 ], [ 242.5, 0.015049136947146219 ], [ 247.5, 0.01888717187326405 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "rseqc_inner_distance_plot", "title": "RSeQC: Inner Distance", "ylab": "Counts", "xlab": "Inner Distance (bp)", "tt_label": "{point.x} bp: {point.y:.2f}", "data_labels": [ { "name": "Counts", "ylab": "Counts", "categories": [] }, { "name": "Percentages", "ylab": "Percentage", "categories": [] } ] } }, "rseqc_read_dups_plot": { "id": "rseqc_read_dups_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "RSeQC: Read Duplication", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "log" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "rseqc_read_dups_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "RSeQC: Read Duplication" }, "xaxis": { "hoverformat": null, "ticksuffix": " occurrences", "title": { "text": "Occurrence of read" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": " reads", "title": { "text": "Number of Reads (log10)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 3835018 ], [ 3, 451631 ], [ 5, 122769 ], [ 7, 49780 ], [ 9, 25084 ], [ 11, 14630 ], [ 13, 9119 ], [ 15, 6183 ], [ 17, 4524 ], [ 19, 3433 ], [ 20, 3473 ], [ 22, 2669 ], [ 24, 2116 ], [ 26, 1734 ], [ 28, 1421 ], [ 30, 1141 ], [ 32, 964 ], [ 34, 898 ], [ 36, 655 ], [ 38, 593 ], [ 40, 589 ], [ 42, 492 ], [ 44, 452 ], [ 46, 355 ], [ 48, 325 ], [ 50, 298 ], [ 52, 290 ], [ 54, 273 ], [ 56, 208 ], [ 58, 192 ], [ 59, 186 ], [ 61, 163 ], [ 63, 143 ], [ 65, 157 ], [ 67, 141 ], [ 69, 138 ], [ 71, 126 ], [ 73, 95 ], [ 75, 116 ], [ 77, 103 ], [ 79, 91 ], [ 81, 86 ], [ 83, 80 ], [ 85, 61 ], [ 87, 56 ], [ 89, 62 ], [ 91, 50 ], [ 93, 59 ], [ 95, 58 ], [ 97, 48 ], [ 98, 52 ], [ 100, 33 ], [ 102, 46 ], [ 104, 41 ], [ 106, 45 ], [ 108, 38 ], [ 110, 45 ], [ 112, 34 ], [ 114, 33 ], [ 116, 23 ], [ 118, 23 ], [ 120, 34 ], [ 122, 19 ], [ 124, 31 ], [ 126, 29 ], [ 128, 22 ], [ 130, 13 ], [ 132, 19 ], [ 134, 19 ], [ 136, 21 ], [ 137, 14 ], [ 139, 17 ], [ 141, 21 ], [ 143, 13 ], [ 145, 14 ], [ 147, 12 ], [ 149, 11 ], [ 151, 15 ], [ 153, 9 ], [ 155, 15 ], [ 157, 13 ], [ 159, 12 ], [ 161, 15 ], [ 163, 11 ], [ 165, 8 ], [ 167, 16 ], [ 169, 8 ], [ 171, 8 ], [ 173, 8 ], [ 175, 7 ], [ 176, 13 ], [ 178, 7 ], [ 180, 5 ], [ 182, 9 ], [ 184, 13 ], [ 186, 13 ], [ 188, 8 ], [ 190, 4 ], [ 192, 5 ], [ 194, 5 ], [ 196, 14 ], [ 198, 10 ], [ 200, 13 ], [ 202, 5 ], [ 204, 6 ], [ 206, 6 ], [ 208, 7 ], [ 210, 4 ], [ 212, 4 ], [ 214, 7 ], [ 215, 5 ], [ 217, 5 ], [ 219, 8 ], [ 221, 6 ], [ 223, 4 ], [ 225, 4 ], [ 227, 5 ], [ 229, 1 ], [ 231, 2 ], [ 233, 4 ], [ 235, 3 ], [ 237, 4 ], [ 239, 3 ], [ 241, 1 ], [ 243, 4 ], [ 246, 3 ], [ 248, 4 ], [ 250, 5 ], [ 252, 2 ], [ 254, 2 ], [ 255, 1 ], [ 257, 2 ], [ 259, 4 ], [ 261, 3 ], [ 264, 1 ], [ 266, 3 ], [ 268, 2 ], [ 270, 6 ], [ 272, 1 ], [ 276, 3 ], [ 278, 4 ], [ 281, 5 ], [ 283, 5 ], [ 285, 6 ], [ 288, 4 ], [ 290, 3 ], [ 292, 2 ], [ 294, 1 ], [ 296, 2 ], [ 299, 3 ], [ 300, 1 ], [ 302, 3 ], [ 304, 1 ], [ 306, 2 ], [ 308, 1 ], [ 310, 4 ], [ 312, 4 ], [ 314, 5 ], [ 316, 2 ], [ 318, 1 ], [ 320, 1 ], [ 322, 3 ], [ 324, 1 ], [ 327, 2 ], [ 329, 1 ], [ 333, 1 ], [ 336, 1 ], [ 338, 3 ], [ 341, 1 ], [ 343, 3 ], [ 345, 2 ], [ 348, 2 ], [ 352, 1 ], [ 355, 1 ], [ 358, 1 ], [ 364, 1 ], [ 369, 1 ], [ 374, 1 ], [ 376, 2 ], [ 380, 1 ], [ 383, 1 ], [ 388, 1 ], [ 390, 1 ], [ 393, 1 ], [ 396, 2 ], [ 399, 2 ], [ 404, 2 ], [ 406, 2 ], [ 412, 3 ], [ 417, 2 ], [ 419, 1 ], [ 423, 2 ], [ 432, 1 ], [ 435, 2 ], [ 449, 1 ], [ 451, 1 ], [ 463, 2 ], [ 474, 2 ], [ 482, 1 ], [ 498, 1 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 3518947 ], [ 3, 417925 ], [ 5, 113292 ], [ 7, 46029 ], [ 9, 23655 ], [ 11, 13477 ], [ 13, 8729 ], [ 15, 6025 ], [ 16, 6753 ], [ 18, 4755 ], [ 20, 3556 ], [ 22, 2752 ], [ 24, 2160 ], [ 26, 1888 ], [ 28, 1460 ], [ 30, 1151 ], [ 32, 1043 ], [ 34, 886 ], [ 36, 681 ], [ 38, 662 ], [ 40, 559 ], [ 42, 465 ], [ 44, 464 ], [ 45, 366 ], [ 47, 306 ], [ 49, 254 ], [ 51, 242 ], [ 53, 231 ], [ 55, 245 ], [ 57, 194 ], [ 59, 195 ], [ 61, 169 ], [ 63, 139 ], [ 65, 137 ], [ 67, 125 ], [ 69, 117 ], [ 71, 98 ], [ 73, 115 ], [ 75, 92 ], [ 76, 116 ], [ 78, 102 ], [ 80, 70 ], [ 82, 89 ], [ 84, 80 ], [ 86, 59 ], [ 88, 68 ], [ 90, 65 ], [ 92, 50 ], [ 94, 57 ], [ 96, 57 ], [ 98, 44 ], [ 100, 42 ], [ 102, 44 ], [ 104, 37 ], [ 105, 38 ], [ 107, 26 ], [ 109, 45 ], [ 111, 29 ], [ 113, 26 ], [ 115, 22 ], [ 117, 23 ], [ 119, 22 ], [ 121, 19 ], [ 123, 25 ], [ 125, 22 ], [ 127, 20 ], [ 129, 15 ], [ 131, 25 ], [ 133, 23 ], [ 134, 18 ], [ 136, 22 ], [ 138, 22 ], [ 140, 17 ], [ 142, 14 ], [ 144, 16 ], [ 146, 15 ], [ 148, 11 ], [ 150, 19 ], [ 152, 10 ], [ 154, 15 ], [ 156, 13 ], [ 158, 9 ], [ 160, 17 ], [ 162, 5 ], [ 164, 7 ], [ 165, 15 ], [ 167, 14 ], [ 169, 11 ], [ 171, 12 ], [ 173, 4 ], [ 175, 6 ], [ 177, 8 ], [ 179, 7 ], [ 181, 7 ], [ 183, 9 ], [ 185, 6 ], [ 187, 5 ], [ 189, 11 ], [ 191, 2 ], [ 193, 4 ], [ 194, 6 ], [ 196, 7 ], [ 198, 5 ], [ 200, 13 ], [ 202, 9 ], [ 204, 6 ], [ 206, 3 ], [ 208, 6 ], [ 210, 5 ], [ 212, 4 ], [ 214, 3 ], [ 216, 3 ], [ 218, 4 ], [ 220, 3 ], [ 222, 8 ], [ 223, 7 ], [ 225, 1 ], [ 227, 2 ], [ 229, 1 ], [ 231, 3 ], [ 233, 4 ], [ 235, 1 ], [ 237, 6 ], [ 239, 6 ], [ 241, 6 ], [ 243, 3 ], [ 246, 4 ], [ 248, 2 ], [ 251, 2 ], [ 254, 4 ], [ 256, 4 ], [ 257, 2 ], [ 259, 4 ], [ 261, 3 ], [ 263, 3 ], [ 265, 6 ], [ 268, 2 ], [ 270, 2 ], [ 272, 2 ], [ 274, 1 ], [ 276, 2 ], [ 278, 2 ], [ 281, 5 ], [ 283, 1 ], [ 285, 2 ], [ 287, 1 ], [ 289, 2 ], [ 293, 3 ], [ 297, 1 ], [ 301, 1 ], [ 306, 1 ], [ 308, 3 ], [ 310, 2 ], [ 312, 4 ], [ 314, 4 ], [ 317, 2 ], [ 320, 3 ], [ 322, 5 ], [ 324, 4 ], [ 326, 2 ], [ 328, 1 ], [ 330, 4 ], [ 333, 1 ], [ 336, 3 ], [ 339, 1 ], [ 342, 1 ], [ 349, 2 ], [ 351, 2 ], [ 355, 1 ], [ 357, 1 ], [ 359, 2 ], [ 363, 2 ], [ 366, 2 ], [ 369, 1 ], [ 372, 1 ], [ 374, 1 ], [ 377, 2 ], [ 378, 1 ], [ 382, 1 ], [ 384, 2 ], [ 392, 1 ], [ 395, 1 ], [ 398, 1 ], [ 401, 2 ], [ 404, 1 ], [ 407, 1 ], [ 412, 3 ], [ 415, 1 ], [ 418, 1 ], [ 421, 1 ], [ 428, 1 ], [ 440, 1 ], [ 441, 1 ], [ 447, 1 ], [ 454, 1 ], [ 468, 1 ], [ 475, 1 ], [ 479, 1 ], [ 484, 2 ], [ 490, 1 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": null, "config": { "smooth_points": 200, "id": "rseqc_read_dups_plot", "title": "RSeQC: Read Duplication", "ylab": "Number of Reads (log10)", "xlab": "Occurrence of read", "yLog": true, "tt_label": "{point.x} occurrences: {point.y} reads" } }, "rseqc_junction_annotation_junctions_plot": { "id": "rseqc_junction_annotation_junctions_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "RSeQC: Splicing Junctions", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": "Junctions", "uid": "rseqc_junction_annotation_junctions_plot_Junctions", "dconfig": { "name": "Junctions" }, "layout": { "title": { "text": "RSeQC: Splicing Junctions" }, "xaxis": { "title": { "text": "% Junctions" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 179703 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Known Splicing Junctions", "data": [ 148597, 150896 ], "color": "0.49,0.71,0.93", "data_pct": [ 84.50021040181059, 83.96966105184666 ] }, { "name": "Partial Novel Splicing Junctions", "data": [ 21832, 23555 ], "color": "0.26,0.26,0.28", "data_pct": [ 12.414844132064099, 13.107738880263545 ] }, { "name": "Novel Splicing Junctions", "data": [ 5425, 5252 ], "color": "0.56,0.93,0.49", "data_pct": [ 3.0849454661253084, 2.922600067889796 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] }, { "label": "Events", "uid": "rseqc_junction_annotation_junctions_plot_Events", "dconfig": { "name": "Events" }, "layout": { "title": { "text": "RSeQC: Splicing Junctions" }, "xaxis": { "title": { "text": "% Junctions" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 11739791 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Known Splicing Events", "data": [ 11135135, 11650978 ], "color": "0.49,0.71,0.93", "data_pct": [ 99.26537382253616, 99.2434873840599 ] }, { "name": "Partial Novel Splicing Events", "data": [ 59248, 63942 ], "color": "0.26,0.26,0.28", "data_pct": [ 0.5281727494312034, 0.5446604628651396 ] }, { "name": "Novel Splicing Events", "data": [ 23159, 24871 ], "color": "0.56,0.93,0.49", "data_pct": [ 0.20645342803262962, 0.2118521530749568 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": true, "l_active": false, "square": null, "config": { "id": "rseqc_junction_annotation_junctions_plot", "title": "RSeQC: Splicing Junctions", "ylab": "% Junctions", "cpswitch_c_active": false, "data_labels": [ "Junctions", "Events" ] } }, "rseqc_junction_saturation_plot": { "id": "rseqc_junction_saturation_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "RSeQC: Junction Saturation", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "All Junctions", "uid": "rseqc_junction_saturation_plot_All_Junctions", "dconfig": { "name": "All Junctions", "categories": [] }, "layout": { "title": { "text": "RSeQC: Junction Saturation" }, "xaxis": { "hoverformat": null, "ticksuffix": "% of reads", "title": { "text": "Percent of reads" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Number of Junctions" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 5.0, 95835.0 ], [ 10.0, 114715.0 ], [ 15.0, 125479.0 ], [ 20.0, 133430.0 ], [ 25.0, 139704.0 ], [ 30.0, 144961.0 ], [ 35.0, 149505.0 ], [ 40.0, 153585.0 ], [ 45.0, 157124.0 ], [ 50.0, 160313.0 ], [ 55.0, 163251.0 ], [ 60.0, 165898.0 ], [ 65.0, 168320.0 ], [ 70.0, 170501.0 ], [ 75.0, 172420.0 ], [ 80.0, 174146.0 ], [ 85.0, 175741.0 ], [ 90.0, 177165.0 ], [ 95.0, 178481.0 ], [ 100.0, 179686.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 5.0, 94087.0 ], [ 10.0, 112927.0 ], [ 15.0, 123669.0 ], [ 20.0, 131331.0 ], [ 25.0, 137453.0 ], [ 30.0, 142546.0 ], [ 35.0, 147037.0 ], [ 40.0, 151074.0 ], [ 45.0, 154402.0 ], [ 50.0, 157431.0 ], [ 55.0, 160158.0 ], [ 60.0, 162635.0 ], [ 65.0, 164828.0 ], [ 70.0, 166908.0 ], [ 75.0, 168771.0 ], [ 80.0, 170483.0 ], [ 85.0, 172035.0 ], [ 90.0, 173425.0 ], [ 95.0, 174698.0 ], [ 100.0, 175815.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Known Junctions", "uid": "rseqc_junction_saturation_plot_Known_Junctions", "dconfig": { "name": "Known Junctions", "categories": [] }, "layout": { "title": { "text": "RSeQC: Junction Saturation" }, "xaxis": { "hoverformat": null, "ticksuffix": "% of reads", "title": { "text": "Percent of reads" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Number of Junctions" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 5.0, 91163.0 ], [ 10.0, 106211.0 ], [ 15.0, 113769.0 ], [ 20.0, 118742.0 ], [ 25.0, 122387.0 ], [ 30.0, 125236.0 ], [ 35.0, 127563.0 ], [ 40.0, 129538.0 ], [ 45.0, 131245.0 ], [ 50.0, 132712.0 ], [ 55.0, 133966.0 ], [ 60.0, 135095.0 ], [ 65.0, 136078.0 ], [ 70.0, 136973.0 ], [ 75.0, 137727.0 ], [ 80.0, 138410.0 ], [ 85.0, 139063.0 ], [ 90.0, 139633.0 ], [ 95.0, 140115.0 ], [ 100.0, 140590.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 5.0, 89612.0 ], [ 10.0, 104860.0 ], [ 15.0, 112553.0 ], [ 20.0, 117442.0 ], [ 25.0, 121093.0 ], [ 30.0, 123895.0 ], [ 35.0, 126246.0 ], [ 40.0, 128299.0 ], [ 45.0, 129894.0 ], [ 50.0, 131324.0 ], [ 55.0, 132571.0 ], [ 60.0, 133641.0 ], [ 65.0, 134549.0 ], [ 70.0, 135390.0 ], [ 75.0, 136154.0 ], [ 80.0, 136880.0 ], [ 85.0, 137514.0 ], [ 90.0, 138064.0 ], [ 95.0, 138546.0 ], [ 100.0, 139001.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Novel Junctions", "uid": "rseqc_junction_saturation_plot_Novel_Junctions", "dconfig": { "name": "Novel Junctions", "categories": [] }, "layout": { "title": { "text": "RSeQC: Junction Saturation" }, "xaxis": { "hoverformat": null, "ticksuffix": "% of reads", "title": { "text": "Percent of reads" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Number of Junctions" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 5.0, 4672.0 ], [ 10.0, 8504.0 ], [ 15.0, 11710.0 ], [ 20.0, 14688.0 ], [ 25.0, 17317.0 ], [ 30.0, 19725.0 ], [ 35.0, 21942.0 ], [ 40.0, 24047.0 ], [ 45.0, 25879.0 ], [ 50.0, 27601.0 ], [ 55.0, 29285.0 ], [ 60.0, 30803.0 ], [ 65.0, 32242.0 ], [ 70.0, 33528.0 ], [ 75.0, 34693.0 ], [ 80.0, 35736.0 ], [ 85.0, 36678.0 ], [ 90.0, 37532.0 ], [ 95.0, 38366.0 ], [ 100.0, 39096.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 5.0, 4475.0 ], [ 10.0, 8067.0 ], [ 15.0, 11116.0 ], [ 20.0, 13889.0 ], [ 25.0, 16360.0 ], [ 30.0, 18651.0 ], [ 35.0, 20791.0 ], [ 40.0, 22775.0 ], [ 45.0, 24508.0 ], [ 50.0, 26107.0 ], [ 55.0, 27587.0 ], [ 60.0, 28994.0 ], [ 65.0, 30279.0 ], [ 70.0, 31518.0 ], [ 75.0, 32617.0 ], [ 80.0, 33603.0 ], [ 85.0, 34521.0 ], [ 90.0, 35361.0 ], [ 95.0, 36152.0 ], [ 100.0, 36814.0 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "rseqc_junction_saturation_plot", "title": "RSeQC: Junction Saturation", "ylab": "Number of Junctions", "ymin": 0, "xlab": "Percent of reads", "xmin": 0, "xmax": 100, "tt_label": "{point.x}% of reads: {point.y:.2f}", "data_labels": [ { "name": "All Junctions", "categories": [] }, { "name": "Known Junctions", "categories": [] }, { "name": "Novel Junctions", "categories": [] } ], "cursor": "pointer", "click_func": "single_sample_plot" } }, "rseqc_infer_experiment_plot": { "id": "rseqc_infer_experiment_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "RSeQC: Infer experiment", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "rseqc_infer_experiment_plot", "dconfig": {}, "layout": { "title": { "text": "RSeQC: Infer experiment" }, "xaxis": { "title": { "text": "% Tags" }, "hoverformat": null, "ticksuffix": "%", "autorangeoptions": { "minallowed": 0, "maxallowed": 100.01 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Sense", "data": [ 1, 1.69 ], "color": "0.49,0.71,0.93" }, { "name": "Antisense", "data": [ 95.84, 96.07 ], "color": "0.26,0.26,0.28" }, { "name": "Undetermined", "data": [ 3.17, 2.2399999999999998 ], "color": "0.56,0.93,0.49" } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "rseqc_infer_experiment_plot", "title": "RSeQC: Infer experiment", "ylab": "% Tags", "ymin": 0, "ymax": 100, "tt_percentages": false, "ylab_format": "{value}%", "cpswitch": false } }, "rseqc_bam_stat": { "id": "rseqc_bam_stat", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "RSeQC: Bam Stat", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "label": 1, "uid": "rseqc_bam_stat", "dconfig": { "ylab": null }, "layout": { "title": { "text": "RSeQC: Bam Stat" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "grey", "line": { "width": 2, "color": "grey" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "metrics": [ "total_records", "qc_failed", "optical_pcr_duplicate", "non_primary_hits", "unmapped_reads", "mapq_gte_mapq_cut_unique", "read_1", "read_2", "reads_map_to_sense", "reads_map_to_antisense", "non_splice_reads", "splice_reads", "reads_mapped_in_proper_pairs", "proper_paired_reads_map_to_different_chrom" ], "header_by_metric": { "total_records": { "title": "Total records", "description": "Total records", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "qc_failed": { "title": "QC failed", "description": "QC failed", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "optical_pcr_duplicate": { "title": "Duplicates", "description": "Optical/PCR duplicate", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "non_primary_hits": { "title": "Non primary hit", "description": "Non primary hit", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "unmapped_reads": { "title": "Unmapped", "description": "Unmapped reads", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mapq_gte_mapq_cut_unique": { "title": "Unique", "description": "mapq >= mapq_cut (unique)", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "read_1": { "title": "Read-1", "description": "Read-1", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "read_2": { "title": "Read-2", "description": "Read-2", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "reads_map_to_sense": { "title": "+ve strand", "description": "Reads map to '+'", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "reads_map_to_antisense": { "title": "-ve strand", "description": "Reads map to '-'", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "non_splice_reads": { "title": "Non-splice reads", "description": "Non-splice reads", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "splice_reads": { "title": "Splice reads", "description": "Splice reads", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "reads_mapped_in_proper_pairs": { "title": "Proper pairs", "description": "Reads mapped in proper pairs", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "proper_paired_reads_map_to_different_chrom": { "title": "Different chrom", "description": "Proper-paired reads map to different chrom", "dmax": 23.448462, "dmin": 0.0, "suffix": "M", "hidden": null, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.11724231, 23.56629052155 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" } }, "violin_values_by_sample_by_metric": { "total_records": { "rna_s1221_S42": 23.448462, "rna_s1200_S21": 21.201423 }, "qc_failed": { "rna_s1221_S42": 0.0, "rna_s1200_S21": 0.0 }, "optical_pcr_duplicate": { "rna_s1221_S42": 0.0, "rna_s1200_S21": 0.0 }, "non_primary_hits": { "rna_s1221_S42": 3.505214, "rna_s1200_S21": 1.266553 }, "unmapped_reads": { "rna_s1221_S42": 0.087223, "rna_s1200_S21": 0.076582 }, "mapq_gte_mapq_cut_unique": { "rna_s1221_S42": 18.864613, "rna_s1200_S21": 19.200129 }, "read_1": { "rna_s1221_S42": 9.436036, "rna_s1200_S21": 9.603112999999999 }, "read_2": { "rna_s1221_S42": 9.428576999999999, "rna_s1200_S21": 9.597016 }, "reads_map_to_sense": { "rna_s1221_S42": 9.432352, "rna_s1200_S21": 9.600541 }, "reads_map_to_antisense": { "rna_s1221_S42": 9.432261, "rna_s1200_S21": 9.599587999999999 }, "non_splice_reads": { "rna_s1221_S42": 8.963248, "rna_s1200_S21": 8.867379 }, "splice_reads": { "rna_s1221_S42": 9.901365, "rna_s1200_S21": 10.332749999999999 }, "reads_mapped_in_proper_pairs": { "rna_s1221_S42": 18.817394, "rna_s1200_S21": 19.152518 }, "proper_paired_reads_map_to_different_chrom": { "rna_s1221_S42": 0.0, "rna_s1200_S21": 0.0 } }, "scatter_values_by_sample_by_metric": { "total_records": {}, "qc_failed": {}, "optical_pcr_duplicate": {}, "non_primary_hits": {}, "unmapped_reads": {}, "mapq_gte_mapq_cut_unique": {}, "read_1": {}, "read_2": {}, "reads_map_to_sense": {}, "reads_map_to_antisense": {}, "non_splice_reads": {}, "splice_reads": {}, "reads_mapped_in_proper_pairs": {}, "proper_paired_reads_map_to_different_chrom": {} }, "all_samples": [ "rna_s1200_S21", "rna_s1221_S42" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "plot_type": "violin", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": null, "config": { "title": "RSeQC: Bam Stat" }, "static": false, "violin_height": 70, "extra_height": 63 }, "star_alignment_plot": { "id": "star_alignment_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "STAR: Alignment Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "star_alignment_plot", "dconfig": {}, "layout": { "title": { "text": "STAR: Alignment Scores" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9937706 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Uniquely mapped", "data": [ 9368114, 9534804 ], "color": "0.26,0.48,0.69", "data_pct": [ 94.32247624498011, 95.9457242949228 ] }, { "name": "Mapped to multiple loci", "data": [ 420440, 286932 ], "color": "0.49,0.71,0.93", "data_pct": [ 4.233183105205534, 2.887306185149772 ] }, { "name": "Mapped to too many loci", "data": [ 918, 513 ], "color": "0.97,0.64,0.36", "data_pct": [ 0.009242845805771765, 0.005162157141698496 ] }, { "name": "Unmapped: too many mismatches", "data": [ 30672, 29739 ], "color": "0.90,0.20,0.57", "data_pct": [ 0.30881978927519776, 0.2992541739512117 ] }, { "name": "Unmapped: too short", "data": [ 97428, 71723 ], "color": "0.69,0.03,0.30", "data_pct": [ 0.9809498705498165, 0.7217259194425756 ] }, { "name": "Unmapped: other", "data": [ 14434, 13995 ], "color": "0.50,0.00,0.00", "data_pct": [ 0.1453281441835617, 0.1408272693919502 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "star_alignment_plot", "title": "STAR: Alignment Scores", "ylab": "# Reads", "cpswitch_counts_label": "Number of Reads" } }, "star_gene_counts": { "id": "star_gene_counts", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "STAR: Gene Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": "Unstranded", "uid": "star_gene_counts_Unstranded", "dconfig": { "name": "Unstranded" }, "layout": { "title": { "text": "STAR: Gene Counts" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9887443 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Overlapping Genes", "data": [ 8756965, 8908172 ], "color": "0.18,0.49,0.85", "data_pct": [ 88.74470982836642, 90.09581142465247 ] }, { "name": "No Feature", "data": [ 24739, 18025 ], "color": "0.05,0.14,0.23", "data_pct": [ 0.25070962102097666, 0.18230193589990862 ] }, { "name": "Ambiguous Features", "data": [ 586410, 608607 ], "color": "0.29,0.16,0.44", "data_pct": [ 5.942787859772461, 6.155352804562312 ] }, { "name": "Multimapping", "data": [ 420440, 286932 ], "color": "0.95,0.56,0.26", "data_pct": [ 4.260817052510587, 2.9019838597299628 ] }, { "name": "Unmapped", "data": [ 79037, 65707 ], "color": "0.50,0.00,0.00", "data_pct": [ 0.8009756383295579, 0.6645499751553562 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] }, { "label": "Same Stranded", "uid": "star_gene_counts_Same_Stranded", "dconfig": { "name": "Same Stranded" }, "layout": { "title": { "text": "STAR: Gene Counts" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9887443 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Overlapping Genes", "data": [ 587678, 666133 ], "color": "0.18,0.49,0.85", "data_pct": [ 5.955638007290736, 6.737161468339186 ] }, { "name": "No Feature", "data": [ 8772182, 8859482 ], "color": "0.05,0.14,0.23", "data_pct": [ 88.89892173277146, 89.60336863636029 ] }, { "name": "Ambiguous Features", "data": [ 8254, 9189 ], "color": "0.29,0.16,0.44", "data_pct": [ 0.08364756909766528, 0.09293606041521554 ] }, { "name": "Multimapping", "data": [ 420440, 286932 ], "color": "0.95,0.56,0.26", "data_pct": [ 4.260817052510587, 2.9019838597299628 ] }, { "name": "Unmapped", "data": [ 79037, 65707 ], "color": "0.50,0.00,0.00", "data_pct": [ 0.8009756383295579, 0.6645499751553562 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] }, { "label": "Reverse Stranded", "uid": "star_gene_counts_Reverse_Stranded", "dconfig": { "name": "Reverse Stranded" }, "layout": { "title": { "text": "STAR: Gene Counts" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9887443 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Overlapping Genes", "data": [ 9132606, 9249074 ], "color": "0.18,0.49,0.85", "data_pct": [ 92.55152549391235, 93.54363913905749 ] }, { "name": "No Feature", "data": [ 132462, 182964 ], "color": "0.05,0.14,0.23", "data_pct": [ 1.3423945114871503, 1.8504683162269557 ] }, { "name": "Ambiguous Features", "data": [ 103046, 102766 ], "color": "0.29,0.16,0.44", "data_pct": [ 1.0442873037603606, 1.0393587098302361 ] }, { "name": "Multimapping", "data": [ 420440, 286932 ], "color": "0.95,0.56,0.26", "data_pct": [ 4.260817052510587, 2.9019838597299628 ] }, { "name": "Unmapped", "data": [ 79037, 65707 ], "color": "0.50,0.00,0.00", "data_pct": [ 0.8009756383295579, 0.6645499751553562 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "star_gene_counts", "title": "STAR: Gene Counts", "ylab": "# Reads", "cpswitch_counts_label": "Number of Reads", "data_labels": [ "Unstranded", "Same Stranded", "Reverse Stranded" ] } }, "fastp_filtered_reads_plot": { "id": "fastp_filtered_reads_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "Fastp: Filtered Reads", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "fastp_filtered_reads_plot", "dconfig": {}, "layout": { "title": { "text": "Fastp: Filtered Reads" }, "xaxis": { "title": { "text": "# Reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 20000000 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Passed Filter", "data": [ 19864012, 19875412 ], "color": "0.49,0.71,0.93", "data_pct": [ 99.32006, 99.37706 ] }, { "name": "Low Quality", "data": [ 135928, 124550 ], "color": "0.26,0.26,0.28", "data_pct": [ 0.67964, 0.62275 ] }, { "name": "Too Many N", "data": [ 0, 0 ], "color": "0.56,0.93,0.49", "data_pct": [ 0.0, 0.0 ] }, { "name": "Too Short", "data": [ 60, 38 ], "color": "0.97,0.64,0.36", "data_pct": [ 0.00030000000000000003, 0.00019 ] }, { "name": "Too Long", "data": [ 0, 0 ], "color": "0.50,0.52,0.91", "data_pct": [ 0.0, 0.0 ] } ], "samples": [ "rna_s1221_S42", "rna_s1200_S21" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastp_filtered_reads_plot", "title": "Fastp: Filtered Reads", "ylab": "# Reads", "cpswitch_counts_label": "Number of Reads", "hide_zero_cats": false } }, "fastp-insert-size-plot": { "id": "fastp-insert-size-plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Fastp: Insert Size Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "fastp-insert-size-plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "Fastp: Insert Size Distribution" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Insert size" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Read percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0002830139285304926 ], [ 33, 0.0005660278570609852 ], [ 34, 0.0002830139285304926 ], [ 35, 0.0002830139285304926 ], [ 36, 0.0007075348213262316 ], [ 37, 0.000424520892795739 ], [ 38, 0.0007075348213262316 ], [ 39, 0.0005660278570609852 ], [ 40, 0.0007075348213262316 ], [ 41, 0.0009905487498567242 ], [ 42, 0.0011320557141219704 ], [ 43, 0.0014150696426524633 ], [ 44, 0.0011320557141219704 ], [ 45, 0.0024056183925091875 ], [ 46, 0.00268863232103968 ], [ 47, 0.0028301392853049266 ], [ 48, 0.0019810974997134484 ], [ 49, 0.0024056183925091875 ], [ 50, 0.003396167142365912 ], [ 51, 0.0025471253567744337 ], [ 52, 0.003113153213835419 ], [ 53, 0.0032546601781006657 ], [ 54, 0.0035376741066311577 ], [ 55, 0.004245208927957389 ], [ 56, 0.004386715892222635 ], [ 57, 0.003962194999426897 ], [ 58, 0.005943292499140345 ], [ 59, 0.004952743749283621 ], [ 60, 0.00877343178444527 ], [ 61, 0.00537726464207936 ], [ 62, 0.009056445712975763 ], [ 63, 0.009763980534301995 ], [ 64, 0.013301654640933153 ], [ 65, 0.012877133748137414 ], [ 66, 0.017829877497421036 ], [ 67, 0.01882042624727776 ], [ 68, 0.02377316999656138 ], [ 69, 0.025754267496274828 ], [ 70, 0.027876871960253527 ], [ 71, 0.032829615709537144 ], [ 72, 0.03834838731588175 ], [ 73, 0.046131270350470294 ], [ 74, 0.056178264813302785 ], [ 75, 0.06282909213376936 ], [ 76, 0.07358362141792808 ], [ 77, 0.07655526766749826 ], [ 78, 0.08235705320237335 ], [ 79, 0.09155500587961436 ], [ 80, 0.10613022319893473 ], [ 81, 0.11179050176954458 ], [ 82, 0.11787530123295019 ], [ 83, 0.13089394194535284 ], [ 84, 0.13740326230155417 ], [ 85, 0.15197847962087455 ], [ 86, 0.17278000336786575 ], [ 87, 0.18834576943704284 ], [ 88, 0.19782673604281437 ], [ 89, 0.2184867528255403 ], [ 90, 0.2279677194313118 ], [ 91, 0.23051484478808626 ], [ 92, 0.2627784326405624 ], [ 93, 0.27480652460310834 ], [ 94, 0.2726839201391296 ], [ 95, 0.2941929787074471 ], [ 96, 0.32192834370343537 ], [ 97, 0.33197533816626784 ], [ 98, 0.35249384798472855 ], [ 99, 0.3802292129807169 ], [ 100, 0.3880120960153054 ], [ 101, 0.3980590904781379 ], [ 102, 0.4105117033334796 ], [ 103, 0.42098321868910776 ], [ 104, 0.4355584360084282 ], [ 105, 0.4597561268977853 ], [ 106, 0.47801052528800203 ], [ 107, 0.5146608290327008 ], [ 108, 0.5174909683180058 ], [ 109, 0.5247078234955334 ], [ 110, 0.5504620909918082 ], [ 111, 0.5552733277768266 ], [ 112, 0.5698485450961469 ], [ 113, 0.5691410102748207 ], [ 114, 0.5663108709895157 ], [ 115, 0.5948952777710955 ], [ 116, 0.6057913140195195 ], [ 117, 0.6186684477676568 ], [ 118, 0.662960127582679 ], [ 119, 0.6754127404380207 ], [ 120, 0.6744221916881639 ], [ 121, 0.6781013727590604 ], [ 122, 0.6956482363279509 ], [ 123, 0.6663562947250449 ], [ 124, 0.6713090384743285 ], [ 125, 0.6885728881146885 ], [ 126, 0.6897049438288105 ], [ 127, 0.7110724954328627 ], [ 128, 0.7321570331083844 ], [ 129, 0.7395153952501773 ], [ 130, 0.7389493673931162 ], [ 131, 0.7412134788213602 ], [ 132, 0.7397984091787076 ], [ 133, 0.7416379997141559 ], [ 134, 0.7512604732841927 ], [ 135, 0.7280533311446923 ], [ 136, 0.7266382615020398 ], [ 137, 0.7516849941769884 ], [ 138, 0.7603169189971684 ], [ 139, 0.7638545931037996 ], [ 140, 0.7849391307793213 ], [ 141, 0.7586188354259855 ], [ 142, 0.7587603423902508 ], [ 143, 0.7645621279251258 ], [ 144, 0.7448926598922566 ], [ 145, 0.7495623897130097 ], [ 146, 0.7540906125694976 ], [ 147, 0.7354116932864851 ], [ 148, 0.7249401779308569 ], [ 149, 0.7559302031049459 ], [ 150, 0.7414964927498907 ], [ 151, 0.7631470582824733 ], [ 152, 0.7731940527453058 ], [ 153, 0.7422040275712168 ], [ 154, 0.7461662225706438 ], [ 155, 0.7440436181066651 ], [ 156, 0.7184308575746555 ], [ 157, 0.7225345595383477 ], [ 158, 0.7362607350720766 ], [ 159, 0.720411955074369 ], [ 160, 0.7099404397187408 ], [ 161, 0.7287608659660185 ], [ 162, 0.7146101695394939 ], [ 163, 0.7362607350720766 ], [ 164, 0.7320155261441191 ], [ 165, 0.6984783756132558 ], [ 166, 0.6710260245457981 ], [ 167, 0.7120630441827195 ], [ 168, 0.7048461890051919 ], [ 169, 0.6754127404380207 ], [ 170, 0.6898464507930758 ], [ 171, 0.6925350831141155 ], [ 172, 0.6875823393648318 ], [ 173, 0.6953652223994203 ], [ 174, 0.6775353449019994 ], [ 175, 0.6582903977619259 ], [ 176, 0.6483849102633586 ], [ 177, 0.6533376540126422 ], [ 178, 0.6543282027624989 ], [ 179, 0.6742806847238987 ], [ 180, 0.6472528545492366 ], [ 181, 0.6373473670506694 ], [ 182, 0.6502245007988068 ], [ 183, 0.6464038127636452 ], [ 184, 0.6553187515123557 ], [ 185, 0.6291399631232851 ], [ 186, 0.6374888740149347 ], [ 187, 0.6223476288385533 ], [ 188, 0.62333817758841 ], [ 189, 0.611876113482925 ], [ 190, 0.5950367847353607 ], [ 191, 0.5954613056281565 ], [ 192, 0.6086214533048244 ], [ 193, 0.5892349992004856 ], [ 194, 0.5844237624154672 ], [ 195, 0.5824426649157538 ], [ 196, 0.583716227594141 ], [ 197, 0.582584171880019 ], [ 198, 0.5783389629520617 ], [ 199, 0.5616411411687626 ], [ 200, 0.566452377953781 ], [ 201, 0.5523016815272563 ], [ 202, 0.5538582581341741 ], [ 203, 0.5462168820638508 ], [ 204, 0.5406981104575062 ], [ 205, 0.5254153583168596 ], [ 206, 0.5351793388511615 ], [ 207, 0.5421131801001586 ], [ 208, 0.5087175365335604 ], [ 209, 0.5211701493889022 ], [ 210, 0.5094250713548867 ], [ 211, 0.5053213693911947 ], [ 212, 0.4952743749283621 ], [ 213, 0.507868494747969 ], [ 214, 0.5091420574263562 ], [ 215, 0.5017836952845635 ], [ 216, 0.4873499849295083 ], [ 217, 0.4673975029681086 ], [ 218, 0.4750388790384319 ], [ 219, 0.47418983725284036 ], [ 220, 0.4729162745744532 ], [ 221, 0.4623032522545597 ], [ 222, 0.4666899681467824 ], [ 223, 0.4516902299346663 ], [ 224, 0.44150172850756847 ], [ 225, 0.44588844439979114 ], [ 226, 0.44051117975771176 ], [ 227, 0.44164323547183376 ], [ 228, 0.43612446386548914 ], [ 229, 0.42579445547412614 ], [ 230, 0.4379640544009374 ], [ 231, 0.4181530794038028 ], [ 232, 0.4068325222625831 ], [ 233, 0.4092381406550923 ], [ 234, 0.4218322604746993 ], [ 235, 0.39367237458591525 ], [ 236, 0.4079645779767051 ], [ 237, 0.3834838731588175 ], [ 238, 0.3967855277997506 ], [ 239, 0.3871630542297139 ], [ 240, 0.38532346369426573 ], [ 241, 0.36423892601874397 ], [ 242, 0.3765500319098204 ], [ 243, 0.37258783691039354 ], [ 244, 0.37499345530290273 ], [ 245, 0.3708897533392106 ], [ 246, 0.3608427588763781 ], [ 247, 0.34230534655763084 ], [ 248, 0.336645067987021 ], [ 249, 0.34966370869942365 ], [ 250, 0.3321168451305331 ], [ 251, 0.33254136602332884 ], [ 252, 0.32999424066655436 ], [ 253, 0.3202302601322524 ], [ 254, 0.3190982044181304 ], [ 255, 0.3332489008446551 ], [ 256, 0.30876819602676747 ], [ 257, 0.30508901495587104 ], [ 258, 0.30905120995529795 ], [ 259, 0.31103230745501137 ], [ 260, 0.30423997317027957 ], [ 261, 0.30282490352762714 ], [ 262, 0.2941929787074471 ], [ 263, 0.2899477697794897 ], [ 264, 0.27820269174547424 ], [ 265, 0.28145735192357496 ], [ 266, 0.2865516026371238 ], [ 267, 0.28499502603020604 ], [ 268, 0.2728254271033949 ], [ 269, 0.2711273435322119 ], [ 270, 0.2643350092474801 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0012600277206098534 ], [ 33, 0.0008400184804065689 ], [ 34, 0.000560012320271046 ], [ 35, 0.001400030800677615 ], [ 36, 0.001120024640542092 ], [ 37, 0.0019600431209486607 ], [ 38, 0.0021000462010164226 ], [ 39, 0.002520055441219707 ], [ 40, 0.003500077001694037 ], [ 41, 0.003920086241897321 ], [ 42, 0.003920086241897321 ], [ 43, 0.002520055441219707 ], [ 44, 0.005040110882439414 ], [ 45, 0.004200092402032845 ], [ 46, 0.00560012320271046 ], [ 47, 0.005880129362845983 ], [ 48, 0.006160135522981505 ], [ 49, 0.006440141683117028 ], [ 50, 0.007980175563862405 ], [ 51, 0.008260181723997928 ], [ 52, 0.008260181723997928 ], [ 53, 0.009240203284472259 ], [ 54, 0.009940218684811066 ], [ 55, 0.012040264885827488 ], [ 56, 0.01316028952636958 ], [ 57, 0.01120024640542092 ], [ 58, 0.013580298766572864 ], [ 59, 0.015120332647318241 ], [ 60, 0.017360381928402425 ], [ 61, 0.014840326487182719 ], [ 62, 0.016100354207792572 ], [ 63, 0.020160443529757655 ], [ 64, 0.024080529771654976 ], [ 65, 0.027720609853416775 ], [ 66, 0.032200708415585144 ], [ 67, 0.032620717655788424 ], [ 68, 0.04158091478012516 ], [ 69, 0.043540957901073825 ], [ 70, 0.05334117350581712 ], [ 71, 0.05824128130818878 ], [ 72, 0.06888151539333864 ], [ 73, 0.07588166939672673 ], [ 74, 0.08162179567950495 ], [ 75, 0.09800215604743304 ], [ 76, 0.10878239321265068 ], [ 77, 0.11900261805759726 ], [ 78, 0.13328293222450893 ], [ 79, 0.14238313242891343 ], [ 80, 0.14924328335223375 ], [ 81, 0.173743822364092 ], [ 82, 0.18046397020734456 ], [ 83, 0.19026418581208787 ], [ 84, 0.20566452461954163 ], [ 85, 0.21938482646618224 ], [ 86, 0.2413653100368208 ], [ 87, 0.2592857042854943 ], [ 88, 0.27888613549498087 ], [ 89, 0.29736654206392543 ], [ 90, 0.3073067607487365 ], [ 91, 0.3210270625953771 ], [ 92, 0.33978747532445713 ], [ 93, 0.36190796197516345 ], [ 94, 0.371568174499839 ], [ 95, 0.39914878127318804 ], [ 96, 0.4068489506769149 ], [ 97, 0.4316294958489087 ], [ 98, 0.45206994553880187 ], [ 99, 0.4677502905063911 ], [ 100, 0.47937054615201535 ], [ 101, 0.49589090960001125 ], [ 102, 0.49799095580102765 ], [ 103, 0.5152113346493623 ], [ 104, 0.5252915564142411 ], [ 105, 0.5440519691433211 ], [ 106, 0.5632323911126045 ], [ 107, 0.6053733182130007 ], [ 108, 0.5990731796099514 ], [ 109, 0.6165735646184216 ], [ 110, 0.6059333305332717 ], [ 111, 0.6217536785809288 ], [ 112, 0.6489142761140745 ], [ 113, 0.6465342237529226 ], [ 114, 0.6455542021924482 ], [ 115, 0.6559144301174625 ], [ 116, 0.6694947288840354 ], [ 117, 0.6860150923320313 ], [ 118, 0.7056155235415179 ], [ 119, 0.7239559270303947 ], [ 120, 0.7064555420219245 ], [ 121, 0.7124756744648383 ], [ 122, 0.7317960995141893 ], [ 123, 0.7288560348327663 ], [ 124, 0.7186358099878197 ], [ 125, 0.7443963767202878 ], [ 126, 0.7427163397594747 ], [ 127, 0.7250759516709367 ], [ 128, 0.7595167093676061 ], [ 129, 0.7256359639912078 ], [ 130, 0.7273160009520209 ], [ 131, 0.7698769372926204 ], [ 132, 0.7592367032074706 ], [ 133, 0.758956697047335 ], [ 134, 0.7634367956095034 ], [ 135, 0.7443963767202878 ], [ 136, 0.7546166015652344 ], [ 137, 0.7562966385260476 ], [ 138, 0.7560166323659121 ], [ 139, 0.7740770296946533 ], [ 140, 0.7620367648088258 ], [ 141, 0.752516555364218 ], [ 142, 0.7553166169655732 ], [ 143, 0.7561566354459798 ], [ 144, 0.7634367956095034 ], [ 145, 0.7497164937628629 ], [ 146, 0.7546166015652344 ], [ 147, 0.7537765830848279 ], [ 148, 0.7350161703557478 ], [ 149, 0.7553166169655732 ], [ 150, 0.7450963921206266 ], [ 151, 0.7392162627577806 ], [ 152, 0.727876013272292 ], [ 153, 0.7382362411973064 ], [ 154, 0.7380962381172386 ], [ 155, 0.7350161703557478 ], [ 156, 0.730816077953715 ], [ 157, 0.6972153387374522 ], [ 158, 0.7180757976675487 ], [ 159, 0.7180757976675487 ], [ 160, 0.7130356867851093 ], [ 161, 0.6986153695381299 ], [ 162, 0.7071555574222633 ], [ 163, 0.7030954681002982 ], [ 164, 0.7154157391462612 ], [ 165, 0.683775043050947 ], [ 166, 0.6675346857630868 ], [ 167, 0.6774749044478978 ], [ 168, 0.6582944824786146 ], [ 169, 0.6538143839164462 ], [ 170, 0.6773349013678301 ], [ 171, 0.6566144455178013 ], [ 172, 0.6641746118414605 ], [ 173, 0.653394374676243 ], [ 174, 0.6356139835076372 ], [ 175, 0.6351939742674338 ], [ 176, 0.6312738880255366 ], [ 177, 0.6297338541447912 ], [ 178, 0.6101334229353046 ], [ 179, 0.6097134136951012 ], [ 180, 0.621613675500861 ], [ 181, 0.5990731796099514 ], [ 182, 0.6244137371022163 ], [ 183, 0.5937530625673765 ], [ 184, 0.5930530471670377 ], [ 185, 0.6042532935724586 ], [ 186, 0.6021532473714422 ], [ 187, 0.5765326837190418 ], [ 188, 0.5720525851568734 ], [ 189, 0.5665924650342308 ], [ 190, 0.5591723017906394 ], [ 191, 0.5553922186288098 ], [ 192, 0.5614123510717235 ], [ 193, 0.5626723787923334 ], [ 194, 0.5499320985061671 ], [ 195, 0.5388718551808139 ], [ 196, 0.5280916180155963 ], [ 197, 0.5280916180155963 ], [ 198, 0.5279516149355286 ], [ 199, 0.5254315594943089 ], [ 200, 0.5345317596987134 ], [ 201, 0.523611519453428 ], [ 202, 0.5003710081621796 ], [ 203, 0.5101712237669228 ], [ 204, 0.5033110728436025 ], [ 205, 0.5006510143223151 ], [ 206, 0.4768504907107956 ], [ 207, 0.4914108110378428 ], [ 208, 0.4915508141179106 ], [ 209, 0.48007056155235417 ], [ 210, 0.4557100256205636 ], [ 211, 0.4494098870175144 ], [ 212, 0.4643902165847649 ], [ 213, 0.46663026586584905 ], [ 214, 0.45921010262225764 ], [ 215, 0.4646702227449004 ], [ 216, 0.4482898623769723 ], [ 217, 0.4369496128914836 ], [ 218, 0.4407296960533132 ], [ 219, 0.4249093480056561 ], [ 220, 0.4216892771640976 ], [ 221, 0.41538913856104837 ], [ 222, 0.4194492278830135 ], [ 223, 0.40446889831576294 ], [ 224, 0.4048889075559663 ], [ 225, 0.40124882747420443 ], [ 226, 0.41048903075867665 ], [ 227, 0.40446889831576294 ], [ 228, 0.3885085471880381 ], [ 229, 0.39452867963095184 ], [ 230, 0.39704873507217153 ], [ 231, 0.38948856874851245 ], [ 232, 0.36554804205692526 ], [ 233, 0.3638680050961121 ], [ 234, 0.37492824842146527 ], [ 235, 0.35504781105184313 ], [ 236, 0.3588278942136727 ], [ 237, 0.3540677894913688 ], [ 238, 0.3508477186498103 ], [ 239, 0.3599479188542148 ], [ 240, 0.3395074691643216 ], [ 241, 0.3225670964761225 ], [ 242, 0.33796743528357626 ], [ 243, 0.32438713651700335 ], [ 244, 0.33306732748120454 ], [ 245, 0.3329273244011368 ], [ 246, 0.32508715191734217 ], [ 247, 0.3172469794335475 ], [ 248, 0.3211670656754449 ], [ 249, 0.3015666344659582 ], [ 250, 0.3054867207078556 ], [ 251, 0.3019866437061615 ], [ 252, 0.2986265697845353 ], [ 253, 0.3024066529463648 ], [ 254, 0.2984865667044675 ], [ 255, 0.28070617553586175 ], [ 256, 0.2679658952496955 ], [ 257, 0.285886289498369 ], [ 258, 0.26656586444901786 ], [ 259, 0.2611057443263752 ], [ 260, 0.26614585520881456 ], [ 261, 0.25466560264325816 ], [ 262, 0.2527055595223095 ], [ 263, 0.26376580284766266 ], [ 264, 0.2566256457642068 ], [ 265, 0.25144553180169965 ], [ 266, 0.25424559340305486 ], [ 267, 0.25046551024122526 ], [ 268, 0.23366514063309393 ], [ 269, 0.24080529771654977 ], [ 270, 0.25144553180169965 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastp-insert-size-plot", "title": "Fastp: Insert Size Distribution", "xlab": "Insert size", "ylab": "Read percent", "yCeiling": 100, "ymin": 0, "tt_label": "{point.x}: {point.y:.2f}%", "smooth_points": 300, "smooth_points_sumcounts": false } }, "fastp-seq-quality-plot": { "id": "fastp-seq-quality-plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Fastp: Sequence Quality", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Read 1: Before filtering", "uid": "fastp-seq-quality-plot_Read_1_Before_filtering", "dconfig": { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Sequence Quality", "categories": [] }, "layout": { "title": { "text": "Fastp: Sequence Quality" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "R1 Before filtering: Sequence Quality" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 38.8954 ], [ 2, 39.3616 ], [ 3, 39.4423 ], [ 4, 39.5673 ], [ 5, 39.5511 ], [ 6, 39.555 ], [ 7, 39.5643 ], [ 8, 39.6038 ], [ 9, 39.6073 ], [ 10, 39.6097 ], [ 11, 39.6238 ], [ 12, 39.6432 ], [ 13, 39.6579 ], [ 14, 39.6478 ], [ 15, 39.633 ], [ 16, 39.7363 ], [ 17, 39.7687 ], [ 18, 39.7515 ], [ 19, 39.7685 ], [ 20, 39.7769 ], [ 21, 39.7603 ], [ 22, 39.7798 ], [ 23, 39.7859 ], [ 24, 39.7864 ], [ 25, 39.7887 ], [ 26, 39.6507 ], [ 27, 39.6556 ], [ 28, 39.6593 ], [ 29, 39.6574 ], [ 30, 39.6631 ], [ 31, 39.6645 ], [ 32, 39.6754 ], [ 33, 39.6786 ], [ 34, 39.6709 ], [ 35, 39.686 ], [ 36, 39.6823 ], [ 37, 39.695 ], [ 38, 39.6881 ], [ 39, 39.6979 ], [ 40, 39.6996 ], [ 41, 39.701 ], [ 42, 39.7012 ], [ 43, 39.7036 ], [ 44, 39.7047 ], [ 45, 39.7061 ], [ 46, 39.7101 ], [ 47, 39.7102 ], [ 48, 39.693 ], [ 49, 39.7118 ], [ 50, 39.6925 ], [ 51, 39.7156 ], [ 52, 39.7167 ], [ 53, 39.7153 ], [ 54, 39.7149 ], [ 55, 39.7056 ], [ 56, 39.7173 ], [ 57, 39.7172 ], [ 58, 39.7152 ], [ 59, 39.7179 ], [ 60, 39.7085 ], [ 61, 39.7148 ], [ 62, 39.7181 ], [ 63, 39.7116 ], [ 64, 39.7126 ], [ 65, 39.7168 ], [ 66, 39.7175 ], [ 67, 39.7185 ], [ 68, 39.7165 ], [ 69, 39.7157 ], [ 70, 39.7183 ], [ 71, 39.7154 ], [ 72, 39.7145 ], [ 73, 39.7149 ], [ 74, 39.7155 ], [ 75, 39.7148 ], [ 76, 39.7157 ], [ 77, 39.7066 ], [ 78, 39.7041 ], [ 79, 39.7079 ], [ 80, 39.7113 ], [ 81, 39.7107 ], [ 82, 39.7035 ], [ 83, 39.7088 ], [ 84, 39.7091 ], [ 85, 39.7059 ], [ 86, 39.7084 ], [ 87, 39.7068 ], [ 88, 39.6922 ], [ 89, 39.7068 ], [ 90, 39.706 ], [ 91, 39.7065 ], [ 92, 39.7052 ], [ 93, 39.7043 ], [ 94, 39.6982 ], [ 95, 39.7022 ], [ 96, 39.7021 ], [ 97, 39.7022 ], [ 98, 39.6982 ], [ 99, 39.6934 ], [ 100, 39.6972 ], [ 101, 39.6966 ], [ 102, 39.6954 ], [ 103, 39.695 ], [ 104, 39.6946 ], [ 105, 39.69 ], [ 106, 39.6906 ], [ 107, 39.6799 ], [ 108, 39.6837 ], [ 109, 39.6836 ], [ 110, 39.6808 ], [ 111, 39.6743 ], [ 112, 39.6757 ], [ 113, 39.6595 ], [ 114, 39.6662 ], [ 115, 39.6598 ], [ 116, 39.655 ], [ 117, 39.64 ], [ 118, 39.6417 ], [ 119, 39.6331 ], [ 120, 39.6252 ], [ 121, 39.6152 ], [ 122, 39.6007 ], [ 123, 39.5878 ], [ 124, 39.5718 ], [ 125, 39.5487 ], [ 126, 39.527 ], [ 127, 39.5082 ], [ 128, 39.4777 ], [ 129, 39.4621 ], [ 130, 39.4346 ], [ 131, 39.3933 ], [ 132, 39.3753 ], [ 133, 39.3441 ], [ 134, 39.3119 ], [ 135, 39.2762 ], [ 136, 39.2359 ], [ 137, 39.203 ], [ 138, 39.1641 ], [ 139, 39.1144 ], [ 140, 39.0851 ], [ 141, 39.0337 ], [ 142, 38.9917 ], [ 143, 38.9617 ], [ 144, 38.9122 ], [ 145, 38.8747 ], [ 146, 38.8341 ], [ 147, 38.7825 ], [ 148, 38.7479 ], [ 149, 38.6782 ], [ 150, 38.6463 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 38.8374 ], [ 2, 39.3348 ], [ 3, 39.42 ], [ 4, 39.5583 ], [ 5, 39.5402 ], [ 6, 39.5475 ], [ 7, 39.5457 ], [ 8, 39.591 ], [ 9, 39.5924 ], [ 10, 39.6007 ], [ 11, 39.6112 ], [ 12, 39.6328 ], [ 13, 39.6471 ], [ 14, 39.6387 ], [ 15, 39.6236 ], [ 16, 39.7281 ], [ 17, 39.7612 ], [ 18, 39.7443 ], [ 19, 39.7602 ], [ 20, 39.7683 ], [ 21, 39.7509 ], [ 22, 39.7696 ], [ 23, 39.7779 ], [ 24, 39.7757 ], [ 25, 39.7774 ], [ 26, 39.6334 ], [ 27, 39.6365 ], [ 28, 39.6416 ], [ 29, 39.6385 ], [ 30, 39.6435 ], [ 31, 39.6461 ], [ 32, 39.6563 ], [ 33, 39.6598 ], [ 34, 39.6527 ], [ 35, 39.6668 ], [ 36, 39.6646 ], [ 37, 39.6763 ], [ 38, 39.6686 ], [ 39, 39.6788 ], [ 40, 39.68 ], [ 41, 39.6822 ], [ 42, 39.681 ], [ 43, 39.683 ], [ 44, 39.6872 ], [ 45, 39.6858 ], [ 46, 39.6907 ], [ 47, 39.6908 ], [ 48, 39.6748 ], [ 49, 39.6913 ], [ 50, 39.6724 ], [ 51, 39.6949 ], [ 52, 39.6954 ], [ 53, 39.6951 ], [ 54, 39.6948 ], [ 55, 39.6836 ], [ 56, 39.6952 ], [ 57, 39.6962 ], [ 58, 39.6942 ], [ 59, 39.6973 ], [ 60, 39.6881 ], [ 61, 39.6944 ], [ 62, 39.6984 ], [ 63, 39.6913 ], [ 64, 39.6928 ], [ 65, 39.6968 ], [ 66, 39.6965 ], [ 67, 39.697 ], [ 68, 39.6946 ], [ 69, 39.6942 ], [ 70, 39.696 ], [ 71, 39.6918 ], [ 72, 39.694 ], [ 73, 39.6926 ], [ 74, 39.6922 ], [ 75, 39.6921 ], [ 76, 39.6911 ], [ 77, 39.6843 ], [ 78, 39.6801 ], [ 79, 39.684 ], [ 80, 39.6871 ], [ 81, 39.6866 ], [ 82, 39.6785 ], [ 83, 39.6825 ], [ 84, 39.6858 ], [ 85, 39.6824 ], [ 86, 39.682 ], [ 87, 39.6812 ], [ 88, 39.665 ], [ 89, 39.6775 ], [ 90, 39.6772 ], [ 91, 39.677 ], [ 92, 39.6747 ], [ 93, 39.6758 ], [ 94, 39.6669 ], [ 95, 39.6687 ], [ 96, 39.6683 ], [ 97, 39.6667 ], [ 98, 39.6626 ], [ 99, 39.6553 ], [ 100, 39.6579 ], [ 101, 39.6543 ], [ 102, 39.6519 ], [ 103, 39.6513 ], [ 104, 39.6498 ], [ 105, 39.6455 ], [ 106, 39.6425 ], [ 107, 39.6277 ], [ 108, 39.6331 ], [ 109, 39.6298 ], [ 110, 39.6215 ], [ 111, 39.614 ], [ 112, 39.6125 ], [ 113, 39.5901 ], [ 114, 39.5964 ], [ 115, 39.5861 ], [ 116, 39.577 ], [ 117, 39.5599 ], [ 118, 39.5559 ], [ 119, 39.5428 ], [ 120, 39.5264 ], [ 121, 39.5084 ], [ 122, 39.4883 ], [ 123, 39.4639 ], [ 124, 39.4399 ], [ 125, 39.4083 ], [ 126, 39.3756 ], [ 127, 39.3476 ], [ 128, 39.3027 ], [ 129, 39.2773 ], [ 130, 39.2332 ], [ 131, 39.1776 ], [ 132, 39.147 ], [ 133, 39.1022 ], [ 134, 39.057 ], [ 135, 39.0058 ], [ 136, 38.9519 ], [ 137, 38.9065 ], [ 138, 38.8512 ], [ 139, 38.7858 ], [ 140, 38.7427 ], [ 141, 38.6787 ], [ 142, 38.6283 ], [ 143, 38.5891 ], [ 144, 38.5275 ], [ 145, 38.4821 ], [ 146, 38.4369 ], [ 147, 38.3725 ], [ 148, 38.3329 ], [ 149, 38.2514 ], [ 150, 38.2142 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 1: After filtering", "uid": "fastp-seq-quality-plot_Read_1_After_filtering", "dconfig": { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Sequence Quality", "categories": [] }, "layout": { "title": { "text": "Fastp: Sequence Quality" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "R1 After filtering: Sequence Quality" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 38.9431 ], [ 2, 39.3967 ], [ 3, 39.4763 ], [ 4, 39.5977 ], [ 5, 39.5814 ], [ 6, 39.5851 ], [ 7, 39.5933 ], [ 8, 39.6325 ], [ 9, 39.6355 ], [ 10, 39.6376 ], [ 11, 39.6506 ], [ 12, 39.6697 ], [ 13, 39.6845 ], [ 14, 39.6741 ], [ 15, 39.6593 ], [ 16, 39.7607 ], [ 17, 39.7931 ], [ 18, 39.7757 ], [ 19, 39.7926 ], [ 20, 39.8012 ], [ 21, 39.7844 ], [ 22, 39.804 ], [ 23, 39.8101 ], [ 24, 39.8106 ], [ 25, 39.8129 ], [ 26, 39.7045 ], [ 27, 39.7094 ], [ 28, 39.7131 ], [ 29, 39.7114 ], [ 30, 39.7172 ], [ 31, 39.7185 ], [ 32, 39.729 ], [ 33, 39.7325 ], [ 34, 39.7249 ], [ 35, 39.7395 ], [ 36, 39.7359 ], [ 37, 39.7486 ], [ 38, 39.7418 ], [ 39, 39.7516 ], [ 40, 39.7533 ], [ 41, 39.7549 ], [ 42, 39.755 ], [ 43, 39.7572 ], [ 44, 39.7588 ], [ 45, 39.76 ], [ 46, 39.7641 ], [ 47, 39.7643 ], [ 48, 39.7474 ], [ 49, 39.7658 ], [ 50, 39.7466 ], [ 51, 39.7701 ], [ 52, 39.7712 ], [ 53, 39.77 ], [ 54, 39.7694 ], [ 55, 39.7603 ], [ 56, 39.7723 ], [ 57, 39.7723 ], [ 58, 39.7703 ], [ 59, 39.7732 ], [ 60, 39.7637 ], [ 61, 39.7705 ], [ 62, 39.7738 ], [ 63, 39.7673 ], [ 64, 39.7686 ], [ 65, 39.7727 ], [ 66, 39.7737 ], [ 67, 39.7748 ], [ 68, 39.773 ], [ 69, 39.7725 ], [ 70, 39.7748 ], [ 71, 39.7723 ], [ 72, 39.7719 ], [ 73, 39.7721 ], [ 74, 39.7732 ], [ 75, 39.7725 ], [ 76, 39.7735 ], [ 77, 39.7647 ], [ 78, 39.7625 ], [ 79, 39.7664 ], [ 80, 39.7701 ], [ 81, 39.7696 ], [ 82, 39.7626 ], [ 83, 39.7684 ], [ 84, 39.7687 ], [ 85, 39.7661 ], [ 86, 39.7687 ], [ 87, 39.7674 ], [ 88, 39.753 ], [ 89, 39.7682 ], [ 90, 39.7675 ], [ 91, 39.7683 ], [ 92, 39.7675 ], [ 93, 39.767 ], [ 94, 39.7611 ], [ 95, 39.766 ], [ 96, 39.7664 ], [ 97, 39.7666 ], [ 98, 39.7634 ], [ 99, 39.7593 ], [ 100, 39.7639 ], [ 101, 39.7636 ], [ 102, 39.7638 ], [ 103, 39.7636 ], [ 104, 39.7648 ], [ 105, 39.7615 ], [ 106, 39.7629 ], [ 107, 39.7536 ], [ 108, 39.7596 ], [ 109, 39.761 ], [ 110, 39.7605 ], [ 111, 39.7566 ], [ 112, 39.7609 ], [ 113, 39.7477 ], [ 114, 39.7584 ], [ 115, 39.7564 ], [ 116, 39.7569 ], [ 117, 39.7479 ], [ 118, 39.7564 ], [ 119, 39.7556 ], [ 120, 39.756 ], [ 121, 39.7568 ], [ 122, 39.7536 ], [ 123, 39.7531 ], [ 124, 39.7525 ], [ 125, 39.745 ], [ 126, 39.7419 ], [ 127, 39.7448 ], [ 128, 39.7366 ], [ 129, 39.7442 ], [ 130, 39.7418 ], [ 131, 39.7278 ], [ 132, 39.7354 ], [ 133, 39.7332 ], [ 134, 39.7337 ], [ 135, 39.7306 ], [ 136, 39.7255 ], [ 137, 39.7297 ], [ 138, 39.7282 ], [ 139, 39.7145 ], [ 140, 39.7267 ], [ 141, 39.7127 ], [ 142, 39.7118 ], [ 143, 39.7179 ], [ 144, 39.7098 ], [ 145, 39.7103 ], [ 146, 39.7169 ], [ 147, 39.7082 ], [ 148, 39.7109 ], [ 149, 39.6947 ], [ 150, 39.697 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 38.8868 ], [ 2, 39.3723 ], [ 3, 39.4564 ], [ 4, 39.5908 ], [ 5, 39.5725 ], [ 6, 39.5798 ], [ 7, 39.5773 ], [ 8, 39.6219 ], [ 9, 39.6233 ], [ 10, 39.6307 ], [ 11, 39.6404 ], [ 12, 39.6617 ], [ 13, 39.6757 ], [ 14, 39.6674 ], [ 15, 39.6518 ], [ 16, 39.7547 ], [ 17, 39.7874 ], [ 18, 39.7709 ], [ 19, 39.7859 ], [ 20, 39.7945 ], [ 21, 39.777 ], [ 22, 39.7957 ], [ 23, 39.8036 ], [ 24, 39.8022 ], [ 25, 39.804 ], [ 26, 39.6921 ], [ 27, 39.6954 ], [ 28, 39.7002 ], [ 29, 39.6972 ], [ 30, 39.7028 ], [ 31, 39.7054 ], [ 32, 39.7156 ], [ 33, 39.7189 ], [ 34, 39.7122 ], [ 35, 39.7261 ], [ 36, 39.7237 ], [ 37, 39.7358 ], [ 38, 39.7279 ], [ 39, 39.7386 ], [ 40, 39.7396 ], [ 41, 39.7423 ], [ 42, 39.7408 ], [ 43, 39.743 ], [ 44, 39.7475 ], [ 45, 39.7464 ], [ 46, 39.7513 ], [ 47, 39.7511 ], [ 48, 39.7358 ], [ 49, 39.7526 ], [ 50, 39.7337 ], [ 51, 39.7567 ], [ 52, 39.7573 ], [ 53, 39.757 ], [ 54, 39.7568 ], [ 55, 39.7456 ], [ 56, 39.7574 ], [ 57, 39.7588 ], [ 58, 39.7568 ], [ 59, 39.7604 ], [ 60, 39.7516 ], [ 61, 39.7576 ], [ 62, 39.7619 ], [ 63, 39.7551 ], [ 64, 39.7564 ], [ 65, 39.7609 ], [ 66, 39.7607 ], [ 67, 39.761 ], [ 68, 39.7589 ], [ 69, 39.7592 ], [ 70, 39.7611 ], [ 71, 39.7576 ], [ 72, 39.7598 ], [ 73, 39.7583 ], [ 74, 39.7584 ], [ 75, 39.7587 ], [ 76, 39.758 ], [ 77, 39.7514 ], [ 78, 39.7476 ], [ 79, 39.752 ], [ 80, 39.7552 ], [ 81, 39.755 ], [ 82, 39.7475 ], [ 83, 39.7523 ], [ 84, 39.7563 ], [ 85, 39.7536 ], [ 86, 39.7543 ], [ 87, 39.7539 ], [ 88, 39.7384 ], [ 89, 39.7518 ], [ 90, 39.7528 ], [ 91, 39.7533 ], [ 92, 39.7519 ], [ 93, 39.7546 ], [ 94, 39.7467 ], [ 95, 39.7501 ], [ 96, 39.7509 ], [ 97, 39.7508 ], [ 98, 39.7489 ], [ 99, 39.7431 ], [ 100, 39.7477 ], [ 101, 39.746 ], [ 102, 39.7463 ], [ 103, 39.7473 ], [ 104, 39.7486 ], [ 105, 39.7476 ], [ 106, 39.747 ], [ 107, 39.7361 ], [ 108, 39.7456 ], [ 109, 39.7464 ], [ 110, 39.7423 ], [ 111, 39.7413 ], [ 112, 39.7445 ], [ 113, 39.7283 ], [ 114, 39.7413 ], [ 115, 39.7386 ], [ 116, 39.739 ], [ 117, 39.7325 ], [ 118, 39.7399 ], [ 119, 39.7406 ], [ 120, 39.7387 ], [ 121, 39.7367 ], [ 122, 39.7351 ], [ 123, 39.732 ], [ 124, 39.7315 ], [ 125, 39.7251 ], [ 126, 39.7217 ], [ 127, 39.7249 ], [ 128, 39.7145 ], [ 129, 39.7258 ], [ 130, 39.7199 ], [ 131, 39.7042 ], [ 132, 39.7141 ], [ 133, 39.7093 ], [ 134, 39.7125 ], [ 135, 39.7087 ], [ 136, 39.7038 ], [ 137, 39.7089 ], [ 138, 39.7041 ], [ 139, 39.6881 ], [ 140, 39.701 ], [ 141, 39.6863 ], [ 142, 39.6864 ], [ 143, 39.6955 ], [ 144, 39.6832 ], [ 145, 39.6845 ], [ 146, 39.6914 ], [ 147, 39.6834 ], [ 148, 39.6872 ], [ 149, 39.6686 ], [ 150, 39.6686 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: Before filtering", "uid": "fastp-seq-quality-plot_Read_2_Before_filtering", "dconfig": { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Sequence Quality", "categories": [] }, "layout": { "title": { "text": "Fastp: Sequence Quality" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "R2 Before filtering: Sequence Quality" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 38.4865 ], [ 2, 39.2239 ], [ 3, 39.31 ], [ 4, 39.4314 ], [ 5, 39.4678 ], [ 6, 39.4765 ], [ 7, 39.5318 ], [ 8, 39.5331 ], [ 9, 39.5646 ], [ 10, 39.5802 ], [ 11, 39.6028 ], [ 12, 39.617 ], [ 13, 39.6244 ], [ 14, 39.6153 ], [ 15, 39.6069 ], [ 16, 39.625 ], [ 17, 39.6353 ], [ 18, 39.6444 ], [ 19, 39.6484 ], [ 20, 39.6579 ], [ 21, 39.6532 ], [ 22, 39.6663 ], [ 23, 39.6694 ], [ 24, 39.6682 ], [ 25, 39.6711 ], [ 26, 39.483 ], [ 27, 39.4838 ], [ 28, 39.492 ], [ 29, 39.4881 ], [ 30, 39.4951 ], [ 31, 39.4869 ], [ 32, 39.5021 ], [ 33, 39.5122 ], [ 34, 39.5199 ], [ 35, 39.5148 ], [ 36, 39.5072 ], [ 37, 39.5179 ], [ 38, 39.5242 ], [ 39, 39.5154 ], [ 40, 39.5288 ], [ 41, 39.5288 ], [ 42, 39.5296 ], [ 43, 39.5271 ], [ 44, 39.5338 ], [ 45, 39.536 ], [ 46, 39.4935 ], [ 47, 39.5397 ], [ 48, 39.5436 ], [ 49, 39.5409 ], [ 50, 39.5471 ], [ 51, 39.5474 ], [ 52, 39.5502 ], [ 53, 39.551 ], [ 54, 39.5506 ], [ 55, 39.5528 ], [ 56, 39.5526 ], [ 57, 39.5437 ], [ 58, 39.5595 ], [ 59, 39.5603 ], [ 60, 39.5503 ], [ 61, 39.5623 ], [ 62, 39.5543 ], [ 63, 39.5566 ], [ 64, 39.559 ], [ 65, 39.5591 ], [ 66, 39.5612 ], [ 67, 39.5656 ], [ 68, 39.5671 ], [ 69, 39.5645 ], [ 70, 39.5514 ], [ 71, 39.5585 ], [ 72, 39.5592 ], [ 73, 39.5686 ], [ 74, 39.5613 ], [ 75, 39.5598 ], [ 76, 39.57 ], [ 77, 39.5669 ], [ 78, 39.5659 ], [ 79, 39.5671 ], [ 80, 39.5652 ], [ 81, 39.5521 ], [ 82, 39.5403 ], [ 83, 39.5626 ], [ 84, 39.5549 ], [ 85, 39.5643 ], [ 86, 39.559 ], [ 87, 39.5395 ], [ 88, 39.5601 ], [ 89, 39.5583 ], [ 90, 39.5536 ], [ 91, 39.5574 ], [ 92, 39.5479 ], [ 93, 39.5482 ], [ 94, 39.5441 ], [ 95, 39.5449 ], [ 96, 39.533 ], [ 97, 39.536 ], [ 98, 39.5306 ], [ 99, 39.5239 ], [ 100, 39.5184 ], [ 101, 39.5145 ], [ 102, 39.5095 ], [ 103, 39.5038 ], [ 104, 39.4987 ], [ 105, 39.4864 ], [ 106, 39.4832 ], [ 107, 39.4735 ], [ 108, 39.4646 ], [ 109, 39.4574 ], [ 110, 39.4503 ], [ 111, 39.4347 ], [ 112, 39.423 ], [ 113, 39.4199 ], [ 114, 39.3895 ], [ 115, 39.3948 ], [ 116, 39.377 ], [ 117, 39.3666 ], [ 118, 39.355 ], [ 119, 39.3423 ], [ 120, 39.3271 ], [ 121, 39.3174 ], [ 122, 39.3017 ], [ 123, 39.2856 ], [ 124, 39.2689 ], [ 125, 39.2577 ], [ 126, 39.2188 ], [ 127, 39.2235 ], [ 128, 39.2028 ], [ 129, 39.1929 ], [ 130, 39.1749 ], [ 131, 39.1492 ], [ 132, 39.1415 ], [ 133, 39.1317 ], [ 134, 39.1189 ], [ 135, 39.0991 ], [ 136, 39.0886 ], [ 137, 39.0706 ], [ 138, 39.0535 ], [ 139, 39.0332 ], [ 140, 39.0187 ], [ 141, 39.0037 ], [ 142, 38.9897 ], [ 143, 38.9811 ], [ 144, 38.9615 ], [ 145, 38.9542 ], [ 146, 38.9432 ], [ 147, 38.9146 ], [ 148, 38.9046 ], [ 149, 38.8926 ], [ 150, 38.8686 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 38.4185 ], [ 2, 39.2229 ], [ 3, 39.2835 ], [ 4, 39.4314 ], [ 5, 39.4671 ], [ 6, 39.4764 ], [ 7, 39.5327 ], [ 8, 39.5338 ], [ 9, 39.5603 ], [ 10, 39.5685 ], [ 11, 39.5972 ], [ 12, 39.6059 ], [ 13, 39.617 ], [ 14, 39.6093 ], [ 15, 39.6031 ], [ 16, 39.6217 ], [ 17, 39.6267 ], [ 18, 39.6344 ], [ 19, 39.6436 ], [ 20, 39.6471 ], [ 21, 39.6439 ], [ 22, 39.6544 ], [ 23, 39.6577 ], [ 24, 39.6568 ], [ 25, 39.6585 ], [ 26, 39.4681 ], [ 27, 39.4712 ], [ 28, 39.4782 ], [ 29, 39.4725 ], [ 30, 39.4797 ], [ 31, 39.472 ], [ 32, 39.486 ], [ 33, 39.4947 ], [ 34, 39.5032 ], [ 35, 39.4975 ], [ 36, 39.4878 ], [ 37, 39.5007 ], [ 38, 39.5043 ], [ 39, 39.497 ], [ 40, 39.5085 ], [ 41, 39.5103 ], [ 42, 39.5072 ], [ 43, 39.5055 ], [ 44, 39.5122 ], [ 45, 39.5132 ], [ 46, 39.4713 ], [ 47, 39.5167 ], [ 48, 39.5199 ], [ 49, 39.5164 ], [ 50, 39.5213 ], [ 51, 39.5208 ], [ 52, 39.5267 ], [ 53, 39.5266 ], [ 54, 39.5249 ], [ 55, 39.5242 ], [ 56, 39.5264 ], [ 57, 39.5172 ], [ 58, 39.5324 ], [ 59, 39.5319 ], [ 60, 39.5221 ], [ 61, 39.5327 ], [ 62, 39.5263 ], [ 63, 39.5274 ], [ 64, 39.5297 ], [ 65, 39.5298 ], [ 66, 39.5308 ], [ 67, 39.533 ], [ 68, 39.5347 ], [ 69, 39.5323 ], [ 70, 39.5174 ], [ 71, 39.5261 ], [ 72, 39.5247 ], [ 73, 39.5333 ], [ 74, 39.5265 ], [ 75, 39.5258 ], [ 76, 39.5308 ], [ 77, 39.529 ], [ 78, 39.5277 ], [ 79, 39.5271 ], [ 80, 39.5248 ], [ 81, 39.5116 ], [ 82, 39.4976 ], [ 83, 39.5201 ], [ 84, 39.5104 ], [ 85, 39.5172 ], [ 86, 39.5119 ], [ 87, 39.4915 ], [ 88, 39.5095 ], [ 89, 39.5066 ], [ 90, 39.4997 ], [ 91, 39.5005 ], [ 92, 39.4921 ], [ 93, 39.4878 ], [ 94, 39.482 ], [ 95, 39.4784 ], [ 96, 39.4662 ], [ 97, 39.4666 ], [ 98, 39.4567 ], [ 99, 39.4471 ], [ 100, 39.436 ], [ 101, 39.4315 ], [ 102, 39.42 ], [ 103, 39.4127 ], [ 104, 39.4012 ], [ 105, 39.387 ], [ 106, 39.3765 ], [ 107, 39.3611 ], [ 108, 39.3518 ], [ 109, 39.3369 ], [ 110, 39.3243 ], [ 111, 39.3026 ], [ 112, 39.2861 ], [ 113, 39.2771 ], [ 114, 39.2392 ], [ 115, 39.2453 ], [ 116, 39.2185 ], [ 117, 39.2012 ], [ 118, 39.1855 ], [ 119, 39.165 ], [ 120, 39.1498 ], [ 121, 39.1317 ], [ 122, 39.1094 ], [ 123, 39.0901 ], [ 124, 39.0667 ], [ 125, 39.0609 ], [ 126, 39.0176 ], [ 127, 39.0199 ], [ 128, 38.9997 ], [ 129, 38.9853 ], [ 130, 38.9695 ], [ 131, 38.9427 ], [ 132, 38.9342 ], [ 133, 38.9322 ], [ 134, 38.915 ], [ 135, 38.8956 ], [ 136, 38.8865 ], [ 137, 38.8715 ], [ 138, 38.8614 ], [ 139, 38.8465 ], [ 140, 38.8345 ], [ 141, 38.8193 ], [ 142, 38.8139 ], [ 143, 38.8055 ], [ 144, 38.7932 ], [ 145, 38.7896 ], [ 146, 38.786 ], [ 147, 38.76 ], [ 148, 38.7582 ], [ 149, 38.7529 ], [ 150, 38.733 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: After filtering", "uid": "fastp-seq-quality-plot_Read_2_After_filtering", "dconfig": { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Sequence Quality", "categories": [] }, "layout": { "title": { "text": "Fastp: Sequence Quality" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "R2 After filtering: Sequence Quality" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 38.5598 ], [ 2, 39.3045 ], [ 3, 39.3922 ], [ 4, 39.5105 ], [ 5, 39.5469 ], [ 6, 39.5582 ], [ 7, 39.6134 ], [ 8, 39.6138 ], [ 9, 39.6458 ], [ 10, 39.6605 ], [ 11, 39.6813 ], [ 12, 39.6966 ], [ 13, 39.7037 ], [ 14, 39.6958 ], [ 15, 39.6873 ], [ 16, 39.7041 ], [ 17, 39.7152 ], [ 18, 39.7241 ], [ 19, 39.7274 ], [ 20, 39.7376 ], [ 21, 39.7329 ], [ 22, 39.7462 ], [ 23, 39.749 ], [ 24, 39.749 ], [ 25, 39.7514 ], [ 26, 39.6091 ], [ 27, 39.6102 ], [ 28, 39.6184 ], [ 29, 39.6149 ], [ 30, 39.6227 ], [ 31, 39.6147 ], [ 32, 39.6302 ], [ 33, 39.6407 ], [ 34, 39.6479 ], [ 35, 39.6435 ], [ 36, 39.6363 ], [ 37, 39.647 ], [ 38, 39.6537 ], [ 39, 39.6452 ], [ 40, 39.6583 ], [ 41, 39.6588 ], [ 42, 39.6602 ], [ 43, 39.657 ], [ 44, 39.6646 ], [ 45, 39.6669 ], [ 46, 39.6247 ], [ 47, 39.6707 ], [ 48, 39.675 ], [ 49, 39.6723 ], [ 50, 39.6784 ], [ 51, 39.6796 ], [ 52, 39.6823 ], [ 53, 39.6834 ], [ 54, 39.6833 ], [ 55, 39.6854 ], [ 56, 39.6857 ], [ 57, 39.6772 ], [ 58, 39.693 ], [ 59, 39.6937 ], [ 60, 39.6844 ], [ 61, 39.6957 ], [ 62, 39.6883 ], [ 63, 39.6912 ], [ 64, 39.6931 ], [ 65, 39.6934 ], [ 66, 39.6967 ], [ 67, 39.7003 ], [ 68, 39.7025 ], [ 69, 39.7003 ], [ 70, 39.6869 ], [ 71, 39.6946 ], [ 72, 39.6956 ], [ 73, 39.7047 ], [ 74, 39.6982 ], [ 75, 39.6968 ], [ 76, 39.7071 ], [ 77, 39.7045 ], [ 78, 39.7044 ], [ 79, 39.7053 ], [ 80, 39.7041 ], [ 81, 39.6915 ], [ 82, 39.6806 ], [ 83, 39.7037 ], [ 84, 39.697 ], [ 85, 39.7072 ], [ 86, 39.7028 ], [ 87, 39.6846 ], [ 88, 39.7064 ], [ 89, 39.7065 ], [ 90, 39.7041 ], [ 91, 39.7089 ], [ 92, 39.7019 ], [ 93, 39.7052 ], [ 94, 39.7041 ], [ 95, 39.7085 ], [ 96, 39.6999 ], [ 97, 39.7069 ], [ 98, 39.7054 ], [ 99, 39.7035 ], [ 100, 39.7018 ], [ 101, 39.7037 ], [ 102, 39.7053 ], [ 103, 39.7047 ], [ 104, 39.7055 ], [ 105, 39.701 ], [ 106, 39.706 ], [ 107, 39.7053 ], [ 108, 39.7036 ], [ 109, 39.7057 ], [ 110, 39.7042 ], [ 111, 39.7015 ], [ 112, 39.6994 ], [ 113, 39.7063 ], [ 114, 39.6879 ], [ 115, 39.7031 ], [ 116, 39.7011 ], [ 117, 39.6969 ], [ 118, 39.7021 ], [ 119, 39.7032 ], [ 120, 39.6991 ], [ 121, 39.7009 ], [ 122, 39.6957 ], [ 123, 39.6954 ], [ 124, 39.6898 ], [ 125, 39.6925 ], [ 126, 39.671 ], [ 127, 39.6823 ], [ 128, 39.6806 ], [ 129, 39.6754 ], [ 130, 39.6733 ], [ 131, 39.6516 ], [ 132, 39.6581 ], [ 133, 39.6593 ], [ 134, 39.6485 ], [ 135, 39.6417 ], [ 136, 39.6377 ], [ 137, 39.6306 ], [ 138, 39.6217 ], [ 139, 39.6083 ], [ 140, 39.6012 ], [ 141, 39.5856 ], [ 142, 39.5765 ], [ 143, 39.57 ], [ 144, 39.5543 ], [ 145, 39.5544 ], [ 146, 39.5417 ], [ 147, 39.5196 ], [ 148, 39.5106 ], [ 149, 39.499 ], [ 150, 39.4745 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 38.4989 ], [ 2, 39.3091 ], [ 3, 39.3719 ], [ 4, 39.5158 ], [ 5, 39.5515 ], [ 6, 39.5632 ], [ 7, 39.6189 ], [ 8, 39.6198 ], [ 9, 39.6469 ], [ 10, 39.6544 ], [ 11, 39.6801 ], [ 12, 39.6906 ], [ 13, 39.7019 ], [ 14, 39.6942 ], [ 15, 39.6892 ], [ 16, 39.7063 ], [ 17, 39.7115 ], [ 18, 39.7198 ], [ 19, 39.7281 ], [ 20, 39.7318 ], [ 21, 39.7292 ], [ 22, 39.7393 ], [ 23, 39.7431 ], [ 24, 39.743 ], [ 25, 39.744 ], [ 26, 39.6031 ], [ 27, 39.6064 ], [ 28, 39.6135 ], [ 29, 39.6086 ], [ 30, 39.6166 ], [ 31, 39.6084 ], [ 32, 39.6234 ], [ 33, 39.6326 ], [ 34, 39.6406 ], [ 35, 39.6356 ], [ 36, 39.6262 ], [ 37, 39.6391 ], [ 38, 39.6433 ], [ 39, 39.6365 ], [ 40, 39.6477 ], [ 41, 39.6501 ], [ 42, 39.6482 ], [ 43, 39.6461 ], [ 44, 39.6533 ], [ 45, 39.6546 ], [ 46, 39.6127 ], [ 47, 39.6583 ], [ 48, 39.6619 ], [ 49, 39.6589 ], [ 50, 39.6638 ], [ 51, 39.6637 ], [ 52, 39.6697 ], [ 53, 39.67 ], [ 54, 39.6694 ], [ 55, 39.6682 ], [ 56, 39.6706 ], [ 57, 39.6623 ], [ 58, 39.6777 ], [ 59, 39.678 ], [ 60, 39.6685 ], [ 61, 39.6787 ], [ 62, 39.6734 ], [ 63, 39.6751 ], [ 64, 39.6776 ], [ 65, 39.6784 ], [ 66, 39.6803 ], [ 67, 39.6825 ], [ 68, 39.6852 ], [ 69, 39.6832 ], [ 70, 39.6684 ], [ 71, 39.6787 ], [ 72, 39.6779 ], [ 73, 39.6871 ], [ 74, 39.6816 ], [ 75, 39.6819 ], [ 76, 39.6876 ], [ 77, 39.6866 ], [ 78, 39.6867 ], [ 79, 39.6869 ], [ 80, 39.6857 ], [ 81, 39.6736 ], [ 82, 39.6618 ], [ 83, 39.6859 ], [ 84, 39.6782 ], [ 85, 39.6872 ], [ 86, 39.6839 ], [ 87, 39.6653 ], [ 88, 39.6867 ], [ 89, 39.6871 ], [ 90, 39.6845 ], [ 91, 39.6876 ], [ 92, 39.6834 ], [ 93, 39.6835 ], [ 94, 39.6835 ], [ 95, 39.6858 ], [ 96, 39.6788 ], [ 97, 39.6858 ], [ 98, 39.683 ], [ 99, 39.6814 ], [ 100, 39.6776 ], [ 101, 39.6825 ], [ 102, 39.6816 ], [ 103, 39.6821 ], [ 104, 39.6813 ], [ 105, 39.6788 ], [ 106, 39.6821 ], [ 107, 39.6796 ], [ 108, 39.6784 ], [ 109, 39.6804 ], [ 110, 39.6795 ], [ 111, 39.6761 ], [ 112, 39.6742 ], [ 113, 39.6785 ], [ 114, 39.661 ], [ 115, 39.6797 ], [ 116, 39.6752 ], [ 117, 39.6689 ], [ 118, 39.6756 ], [ 119, 39.6759 ], [ 120, 39.6715 ], [ 121, 39.6728 ], [ 122, 39.6672 ], [ 123, 39.667 ], [ 124, 39.6613 ], [ 125, 39.6646 ], [ 126, 39.6443 ], [ 127, 39.653 ], [ 128, 39.6515 ], [ 129, 39.6466 ], [ 130, 39.6452 ], [ 131, 39.6231 ], [ 132, 39.6292 ], [ 133, 39.6338 ], [ 134, 39.6228 ], [ 135, 39.613 ], [ 136, 39.6111 ], [ 137, 39.6013 ], [ 138, 39.5928 ], [ 139, 39.5798 ], [ 140, 39.5746 ], [ 141, 39.5566 ], [ 142, 39.5477 ], [ 143, 39.5433 ], [ 144, 39.5282 ], [ 145, 39.5252 ], [ 146, 39.5168 ], [ 147, 39.4934 ], [ 148, 39.4839 ], [ 149, 39.4716 ], [ 150, 39.447 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastp-seq-quality-plot", "title": "Fastp: Sequence Quality", "xlab": "Read Position", "ylab": "R1 Before filtering: Sequence Quality", "ymin": 0, "data_labels": [ { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Sequence Quality", "categories": [] }, { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Sequence Quality", "categories": [] }, { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Sequence Quality", "categories": [] }, { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Sequence Quality", "categories": [] } ] } }, "fastp-seq-content-gc-plot": { "id": "fastp-seq-content-gc-plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Fastp: Read GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Read 1: Before filtering", "uid": "fastp-seq-content-gc-plot_Read_1_Before_filtering", "dconfig": { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R1 Before filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 83.62849999999999 ], [ 2, 55.95329999999999 ], [ 3, 62.131099999999996 ], [ 4, 60.5622 ], [ 5, 50.788900000000005 ], [ 6, 47.462199999999996 ], [ 7, 36.6344 ], [ 8, 45.4557 ], [ 9, 46.761399999999995 ], [ 10, 43.6959 ], [ 11, 54.831399999999995 ], [ 12, 53.3695 ], [ 13, 50.960499999999996 ], [ 14, 49.6106 ], [ 15, 50.59669999999999 ], [ 16, 51.7029 ], [ 17, 51.524300000000004 ], [ 18, 51.998900000000006 ], [ 19, 52.582300000000004 ], [ 20, 51.3238 ], [ 21, 51.9328 ], [ 22, 52.662600000000005 ], [ 23, 51.4239 ], [ 24, 52.113299999999995 ], [ 25, 52.882799999999996 ], [ 26, 51.81099999999999 ], [ 27, 52.467 ], [ 28, 53.2615 ], [ 29, 52.129999999999995 ], [ 30, 52.869200000000006 ], [ 31, 53.4223 ], [ 32, 52.366 ], [ 33, 52.723200000000006 ], [ 34, 53.5328 ], [ 35, 52.47389999999999 ], [ 36, 52.9053 ], [ 37, 53.690099999999994 ], [ 38, 52.622899999999994 ], [ 39, 52.9876 ], [ 40, 53.6687 ], [ 41, 52.564699999999995 ], [ 42, 52.8717 ], [ 43, 53.6961 ], [ 44, 52.5611 ], [ 45, 53.185300000000005 ], [ 46, 53.876400000000004 ], [ 47, 52.775499999999994 ], [ 48, 53.024899999999995 ], [ 49, 53.8609 ], [ 50, 52.603500000000004 ], [ 51, 53.439499999999995 ], [ 52, 54.022999999999996 ], [ 53, 52.8035 ], [ 54, 53.4069 ], [ 55, 54.202600000000004 ], [ 56, 53.0284 ], [ 57, 53.4363 ], [ 58, 54.1082 ], [ 59, 53.1043 ], [ 60, 53.2652 ], [ 61, 54.0906 ], [ 62, 53.122499999999995 ], [ 63, 53.45419999999999 ], [ 64, 54.203100000000006 ], [ 65, 53.1081 ], [ 66, 53.6067 ], [ 67, 54.2889 ], [ 68, 53.131099999999996 ], [ 69, 53.480399999999996 ], [ 70, 54.0953 ], [ 71, 53.1405 ], [ 72, 53.4779 ], [ 73, 54.2044 ], [ 74, 53.13250000000001 ], [ 75, 53.806200000000004 ], [ 76, 54.2632 ], [ 77, 53.196200000000005 ], [ 78, 53.5837 ], [ 79, 54.12010000000001 ], [ 80, 53.2419 ], [ 81, 53.661899999999996 ], [ 82, 54.1951 ], [ 83, 53.093999999999994 ], [ 84, 53.5919 ], [ 85, 54.3115 ], [ 86, 53.0953 ], [ 87, 53.5219 ], [ 88, 54.167100000000005 ], [ 89, 52.9511 ], [ 90, 53.4073 ], [ 91, 53.997499999999995 ], [ 92, 53.0708 ], [ 93, 53.47389999999999 ], [ 94, 54.276500000000006 ], [ 95, 53.1736 ], [ 96, 53.5563 ], [ 97, 54.167 ], [ 98, 53.0828 ], [ 99, 53.394200000000005 ], [ 100, 54.11129999999999 ], [ 101, 53.1673 ], [ 102, 53.4328 ], [ 103, 53.86919999999999 ], [ 104, 53.0605 ], [ 105, 53.394600000000004 ], [ 106, 54.0058 ], [ 107, 53.029700000000005 ], [ 108, 53.4248 ], [ 109, 53.8555 ], [ 110, 52.7845 ], [ 111, 53.3761 ], [ 112, 53.79429999999999 ], [ 113, 53.051700000000004 ], [ 114, 53.3975 ], [ 115, 53.8921 ], [ 116, 53.021300000000004 ], [ 117, 53.3023 ], [ 118, 53.7753 ], [ 119, 52.881699999999995 ], [ 120, 53.2072 ], [ 121, 53.80350000000001 ], [ 122, 52.8257 ], [ 123, 53.17659999999999 ], [ 124, 53.7408 ], [ 125, 52.872 ], [ 126, 53.2292 ], [ 127, 53.6869 ], [ 128, 52.7706 ], [ 129, 53.1184 ], [ 130, 53.449400000000004 ], [ 131, 52.580499999999994 ], [ 132, 52.788199999999996 ], [ 133, 53.2848 ], [ 134, 52.5674 ], [ 135, 52.63099999999999 ], [ 136, 53.073 ], [ 137, 52.3546 ], [ 138, 52.42289999999999 ], [ 139, 52.8397 ], [ 140, 51.99 ], [ 141, 52.174699999999994 ], [ 142, 52.5447 ], [ 143, 51.744800000000005 ], [ 144, 51.995599999999996 ], [ 145, 52.31679999999999 ], [ 146, 51.5347 ], [ 147, 51.6954 ], [ 148, 51.9896 ], [ 149, 51.241499999999995 ], [ 150, 51.3248 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 85.3182 ], [ 2, 56.7122 ], [ 3, 64.66 ], [ 4, 62.685199999999995 ], [ 5, 51.8861 ], [ 6, 48.8017 ], [ 7, 35.493900000000004 ], [ 8, 43.8133 ], [ 9, 45.862199999999994 ], [ 10, 43.215900000000005 ], [ 11, 53.1073 ], [ 12, 52.572700000000005 ], [ 13, 50.40219999999999 ], [ 14, 48.8338 ], [ 15, 50.0104 ], [ 16, 51.159200000000006 ], [ 17, 50.9776 ], [ 18, 51.73910000000001 ], [ 19, 52.4833 ], [ 20, 50.9362 ], [ 21, 51.816700000000004 ], [ 22, 52.516799999999996 ], [ 23, 51.028099999999995 ], [ 24, 51.925 ], [ 25, 52.656099999999995 ], [ 26, 51.4062 ], [ 27, 52.2695 ], [ 28, 52.9546 ], [ 29, 51.6787 ], [ 30, 52.7974 ], [ 31, 53.176 ], [ 32, 51.998900000000006 ], [ 33, 52.649100000000004 ], [ 34, 53.406699999999994 ], [ 35, 52.185 ], [ 36, 52.8623 ], [ 37, 53.6141 ], [ 38, 52.3417 ], [ 39, 53.040600000000005 ], [ 40, 53.598800000000004 ], [ 41, 52.303 ], [ 42, 52.7841 ], [ 43, 53.509499999999996 ], [ 44, 52.173700000000004 ], [ 45, 53.046099999999996 ], [ 46, 53.7548 ], [ 47, 52.644000000000005 ], [ 48, 53.081 ], [ 49, 53.7177 ], [ 50, 52.341800000000006 ], [ 51, 53.4387 ], [ 52, 53.8753 ], [ 53, 52.4829 ], [ 54, 53.3129 ], [ 55, 54.027 ], [ 56, 52.7739 ], [ 57, 53.4566 ], [ 58, 53.997099999999996 ], [ 59, 52.88270000000001 ], [ 60, 53.2397 ], [ 61, 53.9848 ], [ 62, 52.8729 ], [ 63, 53.4567 ], [ 64, 54.13099999999999 ], [ 65, 52.9428 ], [ 66, 53.6293 ], [ 67, 54.1967 ], [ 68, 52.936099999999996 ], [ 69, 53.45100000000001 ], [ 70, 53.952 ], [ 71, 52.8811 ], [ 72, 53.349199999999996 ], [ 73, 53.97539999999999 ], [ 74, 52.722 ], [ 75, 53.627199999999995 ], [ 76, 54.0373 ], [ 77, 52.9272 ], [ 78, 53.3984 ], [ 79, 53.9006 ], [ 80, 52.9373 ], [ 81, 53.5327 ], [ 82, 54.0395 ], [ 83, 52.7838 ], [ 84, 53.428399999999996 ], [ 85, 54.1153 ], [ 86, 52.7875 ], [ 87, 53.370799999999996 ], [ 88, 53.918699999999994 ], [ 89, 52.6138 ], [ 90, 53.278499999999994 ], [ 91, 53.756499999999996 ], [ 92, 52.60510000000001 ], [ 93, 53.3019 ], [ 94, 53.9508 ], [ 95, 52.7536 ], [ 96, 53.3694 ], [ 97, 53.915 ], [ 98, 52.7374 ], [ 99, 53.1876 ], [ 100, 53.9229 ], [ 101, 52.86450000000001 ], [ 102, 53.2227 ], [ 103, 53.6927 ], [ 104, 52.653099999999995 ], [ 105, 53.156400000000005 ], [ 106, 53.7361 ], [ 107, 52.614799999999995 ], [ 108, 53.259100000000004 ], [ 109, 53.5865 ], [ 110, 52.4305 ], [ 111, 53.1941 ], [ 112, 53.523900000000005 ], [ 113, 52.7678 ], [ 114, 53.204499999999996 ], [ 115, 53.639 ], [ 116, 52.699600000000004 ], [ 117, 53.0694 ], [ 118, 53.5409 ], [ 119, 52.50280000000001 ], [ 120, 53.004799999999996 ], [ 121, 53.596999999999994 ], [ 122, 52.5371 ], [ 123, 53.0571 ], [ 124, 53.466 ], [ 125, 52.6282 ], [ 126, 53.1004 ], [ 127, 53.4358 ], [ 128, 52.4733 ], [ 129, 52.9122 ], [ 130, 53.2115 ], [ 131, 52.2373 ], [ 132, 52.5335 ], [ 133, 52.9963 ], [ 134, 52.1068 ], [ 135, 52.3355 ], [ 136, 52.603100000000005 ], [ 137, 51.81679999999999 ], [ 138, 52.0255 ], [ 139, 52.2927 ], [ 140, 51.470400000000005 ], [ 141, 51.7032 ], [ 142, 52.0043 ], [ 143, 51.1116 ], [ 144, 51.478699999999996 ], [ 145, 51.759699999999995 ], [ 146, 50.827299999999994 ], [ 147, 51.135200000000005 ], [ 148, 51.3942 ], [ 149, 50.542 ], [ 150, 50.761599999999994 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 1: After filtering", "uid": "fastp-seq-content-gc-plot_Read_1_After_filtering", "dconfig": { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R1 After filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 83.648 ], [ 2, 55.9576 ], [ 3, 62.1317 ], [ 4, 60.554399999999994 ], [ 5, 50.77310000000001 ], [ 6, 47.4418 ], [ 7, 36.609 ], [ 8, 45.4325 ], [ 9, 46.739799999999995 ], [ 10, 43.6753 ], [ 11, 54.8133 ], [ 12, 53.354800000000004 ], [ 13, 50.942699999999995 ], [ 14, 49.591 ], [ 15, 50.5792 ], [ 16, 51.68770000000001 ], [ 17, 51.507400000000004 ], [ 18, 51.981100000000005 ], [ 19, 52.5663 ], [ 20, 51.307 ], [ 21, 51.915800000000004 ], [ 22, 52.647200000000005 ], [ 23, 51.4058 ], [ 24, 52.0961 ], [ 25, 52.868700000000004 ], [ 26, 51.795899999999996 ], [ 27, 52.4508 ], [ 28, 53.243700000000004 ], [ 29, 52.11280000000001 ], [ 30, 52.8516 ], [ 31, 53.406699999999994 ], [ 32, 52.3487 ], [ 33, 52.707 ], [ 34, 53.5198 ], [ 35, 52.45649999999999 ], [ 36, 52.8918 ], [ 37, 53.676100000000005 ], [ 38, 52.60979999999999 ], [ 39, 52.9721 ], [ 40, 53.6559 ], [ 41, 52.5491 ], [ 42, 52.8563 ], [ 43, 53.6825 ], [ 44, 52.54600000000001 ], [ 45, 53.168499999999995 ], [ 46, 53.8651 ], [ 47, 52.760600000000004 ], [ 48, 53.011399999999995 ], [ 49, 53.849000000000004 ], [ 50, 52.5894 ], [ 51, 53.426399999999994 ], [ 52, 54.008599999999994 ], [ 53, 52.79089999999999 ], [ 54, 53.393100000000004 ], [ 55, 54.191599999999994 ], [ 56, 53.0145 ], [ 57, 53.4228 ], [ 58, 54.098400000000005 ], [ 59, 53.0914 ], [ 60, 53.2533 ], [ 61, 54.079299999999996 ], [ 62, 53.111200000000004 ], [ 63, 53.4445 ], [ 64, 54.195899999999995 ], [ 65, 53.0996 ], [ 66, 53.59739999999999 ], [ 67, 54.282799999999995 ], [ 68, 53.1279 ], [ 69, 53.4755 ], [ 70, 54.095099999999995 ], [ 71, 53.13870000000001 ], [ 72, 53.4767 ], [ 73, 54.212700000000005 ], [ 74, 53.1361 ], [ 75, 53.8162 ], [ 76, 54.28150000000001 ], [ 77, 53.2106 ], [ 78, 53.601 ], [ 79, 54.1452 ], [ 80, 53.2596 ], [ 81, 53.6879 ], [ 82, 54.2283 ], [ 83, 53.116600000000005 ], [ 84, 53.62479999999999 ], [ 85, 54.367200000000004 ], [ 86, 53.1337 ], [ 87, 53.5721 ], [ 88, 54.2358 ], [ 89, 52.9973 ], [ 90, 53.463499999999996 ], [ 91, 54.0649 ], [ 92, 53.1188 ], [ 93, 53.5371 ], [ 94, 54.370799999999996 ], [ 95, 53.2466 ], [ 96, 53.6482 ], [ 97, 54.2906 ], [ 98, 53.174699999999994 ], [ 99, 53.4991 ], [ 100, 54.2566 ], [ 101, 53.2636 ], [ 102, 53.53639999999999 ], [ 103, 54.0077 ], [ 104, 53.1482 ], [ 105, 53.52289999999999 ], [ 106, 54.1845 ], [ 107, 53.1544 ], [ 108, 53.601200000000006 ], [ 109, 54.070499999999996 ], [ 110, 52.89509999999999 ], [ 111, 53.552200000000006 ], [ 112, 54.0073 ], [ 113, 53.1797 ], [ 114, 53.5649 ], [ 115, 54.1265 ], [ 116, 53.1596 ], [ 117, 53.493900000000004 ], [ 118, 54.0397 ], [ 119, 53.02329999999999 ], [ 120, 53.4262 ], [ 121, 54.1165 ], [ 122, 52.94950000000001 ], [ 123, 53.3561 ], [ 124, 54.0132 ], [ 125, 52.9915 ], [ 126, 53.440200000000004 ], [ 127, 54.064800000000005 ], [ 128, 53.0184 ], [ 129, 53.5006 ], [ 130, 53.9964 ], [ 131, 52.953399999999995 ], [ 132, 53.27309999999999 ], [ 133, 53.9406 ], [ 134, 53.038399999999996 ], [ 135, 53.202799999999996 ], [ 136, 53.851099999999995 ], [ 137, 52.952799999999996 ], [ 138, 53.203599999999994 ], [ 139, 53.8543 ], [ 140, 52.829 ], [ 141, 53.250699999999995 ], [ 142, 53.8152 ], [ 143, 52.8129 ], [ 144, 53.246300000000005 ], [ 145, 53.7825 ], [ 146, 52.82249999999999 ], [ 147, 53.1161 ], [ 148, 53.8382 ], [ 149, 52.867200000000004 ], [ 150, 53.1182 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 85.3385 ], [ 2, 56.715199999999996 ], [ 3, 64.65809999999999 ], [ 4, 62.671200000000006 ], [ 5, 51.8691 ], [ 6, 48.7797 ], [ 7, 35.4594 ], [ 8, 43.7818 ], [ 9, 45.8309 ], [ 10, 43.187 ], [ 11, 53.085499999999996 ], [ 12, 52.546800000000005 ], [ 13, 50.376200000000004 ], [ 14, 48.809000000000005 ], [ 15, 49.9831 ], [ 16, 51.1332 ], [ 17, 50.9515 ], [ 18, 51.71170000000001 ], [ 19, 52.458400000000005 ], [ 20, 50.90860000000001 ], [ 21, 51.79129999999999 ], [ 22, 52.4919 ], [ 23, 51.0026 ], [ 24, 51.8963 ], [ 25, 52.6332 ], [ 26, 51.378 ], [ 27, 52.245799999999996 ], [ 28, 52.9304 ], [ 29, 51.6523 ], [ 30, 52.7715 ], [ 31, 53.15109999999999 ], [ 32, 51.9722 ], [ 33, 52.6235 ], [ 34, 53.38230000000001 ], [ 35, 52.1601 ], [ 36, 52.835100000000004 ], [ 37, 53.5906 ], [ 38, 52.3191 ], [ 39, 53.016799999999996 ], [ 40, 53.575300000000006 ], [ 41, 52.2772 ], [ 42, 52.7609 ], [ 43, 53.4895 ], [ 44, 52.14959999999999 ], [ 45, 53.0212 ], [ 46, 53.732800000000005 ], [ 47, 52.619499999999995 ], [ 48, 53.0608 ], [ 49, 53.697399999999995 ], [ 50, 52.32019999999999 ], [ 51, 53.4174 ], [ 52, 53.856899999999996 ], [ 53, 52.4606 ], [ 54, 53.2936 ], [ 55, 54.0106 ], [ 56, 52.751999999999995 ], [ 57, 53.4396 ], [ 58, 53.9832 ], [ 59, 52.8636 ], [ 60, 53.2202 ], [ 61, 53.969199999999994 ], [ 62, 52.8571 ], [ 63, 53.44219999999999 ], [ 64, 54.1194 ], [ 65, 52.9334 ], [ 66, 53.6197 ], [ 67, 54.191199999999995 ], [ 68, 52.9293 ], [ 69, 53.4435 ], [ 70, 53.9526 ], [ 71, 52.87779999999999 ], [ 72, 53.3503 ], [ 73, 53.9867 ], [ 74, 52.7292 ], [ 75, 53.6428 ], [ 76, 54.0617 ], [ 77, 52.944100000000006 ], [ 78, 53.424400000000006 ], [ 79, 53.935100000000006 ], [ 80, 52.9632 ], [ 81, 53.568000000000005 ], [ 82, 54.09 ], [ 83, 52.813900000000004 ], [ 84, 53.4708 ], [ 85, 54.1847 ], [ 86, 52.8365 ], [ 87, 53.4314 ], [ 88, 54.00430000000001 ], [ 89, 52.659800000000004 ], [ 90, 53.3432 ], [ 91, 53.83520000000001 ], [ 92, 52.642900000000004 ], [ 93, 53.3741 ], [ 94, 54.057599999999994 ], [ 95, 52.81439999999999 ], [ 96, 53.4683 ], [ 97, 54.060399999999994 ], [ 98, 52.80820000000001 ], [ 99, 53.29580000000001 ], [ 100, 54.0841 ], [ 101, 52.945699999999995 ], [ 102, 53.3215 ], [ 103, 53.8293 ], [ 104, 52.7183 ], [ 105, 53.2659 ], [ 106, 53.913599999999995 ], [ 107, 52.6837 ], [ 108, 53.4119 ], [ 109, 53.78849999999999 ], [ 110, 52.463 ], [ 111, 53.3344 ], [ 112, 53.7067 ], [ 113, 52.813 ], [ 114, 53.3348 ], [ 115, 53.8261 ], [ 116, 52.749199999999995 ], [ 117, 53.1802 ], [ 118, 53.74640000000001 ], [ 119, 52.524800000000006 ], [ 120, 53.116 ], [ 121, 53.8186 ], [ 122, 52.4915 ], [ 123, 53.1061 ], [ 124, 53.6265 ], [ 125, 52.5827 ], [ 126, 53.2065 ], [ 127, 53.703599999999994 ], [ 128, 52.546099999999996 ], [ 129, 53.2196 ], [ 130, 53.6788 ], [ 131, 52.5242 ], [ 132, 52.9646 ], [ 133, 53.6102 ], [ 134, 52.5266 ], [ 135, 52.910900000000005 ], [ 136, 53.4057 ], [ 137, 52.4114 ], [ 138, 52.8467 ], [ 139, 53.384699999999995 ], [ 140, 52.3605 ], [ 141, 52.869699999999995 ], [ 142, 53.3811 ], [ 143, 52.190599999999996 ], [ 144, 52.856899999999996 ], [ 145, 53.351099999999995 ], [ 146, 52.162 ], [ 147, 52.741899999999994 ], [ 148, 53.434099999999994 ], [ 149, 52.2639 ], [ 150, 52.7359 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: Before filtering", "uid": "fastp-seq-content-gc-plot_Read_2_Before_filtering", "dconfig": { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R2 Before filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 76.9347 ], [ 2, 59.046699999999994 ], [ 3, 51.363499999999995 ], [ 4, 56.2319 ], [ 5, 52.487899999999996 ], [ 6, 48.1533 ], [ 7, 50.576 ], [ 8, 53.800599999999996 ], [ 9, 53.7435 ], [ 10, 49.4658 ], [ 11, 59.57639999999999 ], [ 12, 57.4661 ], [ 13, 55.4496 ], [ 14, 54.381299999999996 ], [ 15, 52.9702 ], [ 16, 55.041700000000006 ], [ 17, 54.5712 ], [ 18, 52.7345 ], [ 19, 54.5481 ], [ 20, 54.1018 ], [ 21, 52.7118 ], [ 22, 54.565799999999996 ], [ 23, 54.1563 ], [ 24, 52.762600000000006 ], [ 25, 54.6845 ], [ 26, 54.1846 ], [ 27, 52.8389 ], [ 28, 54.9834 ], [ 29, 54.4944 ], [ 30, 53.0535 ], [ 31, 54.9613 ], [ 32, 54.479699999999994 ], [ 33, 52.919700000000006 ], [ 34, 54.915000000000006 ], [ 35, 54.5284 ], [ 36, 53.111 ], [ 37, 55.035599999999995 ], [ 38, 54.5529 ], [ 39, 53.1284 ], [ 40, 54.924099999999996 ], [ 41, 54.5223 ], [ 42, 53.0883 ], [ 43, 54.9814 ], [ 44, 54.6115 ], [ 45, 53.114700000000006 ], [ 46, 55.014399999999995 ], [ 47, 54.57340000000001 ], [ 48, 53.230900000000005 ], [ 49, 55.1006 ], [ 50, 54.6844 ], [ 51, 53.281 ], [ 52, 55.20890000000001 ], [ 53, 54.6765 ], [ 54, 53.2884 ], [ 55, 55.2222 ], [ 56, 54.6616 ], [ 57, 53.37070000000001 ], [ 58, 55.1851 ], [ 59, 54.662 ], [ 60, 53.270799999999994 ], [ 61, 55.164500000000004 ], [ 62, 54.7338 ], [ 63, 53.36070000000001 ], [ 64, 55.145500000000006 ], [ 65, 54.69070000000001 ], [ 66, 53.2713 ], [ 67, 55.1015 ], [ 68, 54.646899999999995 ], [ 69, 53.22409999999999 ], [ 70, 55.016 ], [ 71, 54.634499999999996 ], [ 72, 53.30200000000001 ], [ 73, 55.030699999999996 ], [ 74, 54.52 ], [ 75, 53.1621 ], [ 76, 54.909200000000006 ], [ 77, 54.44179999999999 ], [ 78, 53.1639 ], [ 79, 54.82979999999999 ], [ 80, 54.4247 ], [ 81, 53.049 ], [ 82, 54.7256 ], [ 83, 54.2874 ], [ 84, 53.0026 ], [ 85, 54.7539 ], [ 86, 54.18770000000001 ], [ 87, 52.8753 ], [ 88, 54.614200000000004 ], [ 89, 54.089200000000005 ], [ 90, 52.961800000000004 ], [ 91, 54.599 ], [ 92, 54.1763 ], [ 93, 52.8304 ], [ 94, 54.4018 ], [ 95, 54.0116 ], [ 96, 52.7777 ], [ 97, 54.439899999999994 ], [ 98, 53.9153 ], [ 99, 52.616600000000005 ], [ 100, 54.2191 ], [ 101, 53.867399999999996 ], [ 102, 52.6084 ], [ 103, 54.176100000000005 ], [ 104, 53.831799999999994 ], [ 105, 52.574299999999994 ], [ 106, 54.1281 ], [ 107, 53.666199999999996 ], [ 108, 52.552200000000006 ], [ 109, 53.998599999999996 ], [ 110, 53.543600000000005 ], [ 111, 52.505100000000006 ], [ 112, 53.904300000000006 ], [ 113, 53.5899 ], [ 114, 52.4791 ], [ 115, 53.9153 ], [ 116, 53.5419 ], [ 117, 52.3969 ], [ 118, 53.8277 ], [ 119, 53.35530000000001 ], [ 120, 52.2892 ], [ 121, 53.672799999999995 ], [ 122, 53.2817 ], [ 123, 52.274100000000004 ], [ 124, 53.695899999999995 ], [ 125, 53.1951 ], [ 126, 52.2661 ], [ 127, 53.5923 ], [ 128, 53.136700000000005 ], [ 129, 52.142999999999994 ], [ 130, 53.3776 ], [ 131, 53.0636 ], [ 132, 52.1109 ], [ 133, 53.3234 ], [ 134, 52.991699999999994 ], [ 135, 52.103500000000004 ], [ 136, 53.28190000000001 ], [ 137, 52.916799999999995 ], [ 138, 52.040299999999995 ], [ 139, 53.1337 ], [ 140, 52.8095 ], [ 141, 51.9853 ], [ 142, 53.00280000000001 ], [ 143, 52.7247 ], [ 144, 51.8664 ], [ 145, 52.897099999999995 ], [ 146, 52.6083 ], [ 147, 51.8146 ], [ 148, 52.873599999999996 ], [ 149, 52.585 ], [ 150, 51.784600000000005 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 75.38810000000001 ], [ 2, 59.1516 ], [ 3, 48.8844 ], [ 4, 54.9772 ], [ 5, 51.876999999999995 ], [ 6, 47.3076 ], [ 7, 49.8909 ], [ 8, 53.0659 ], [ 9, 53.0768 ], [ 10, 48.8457 ], [ 11, 58.538599999999995 ], [ 12, 56.892399999999995 ], [ 13, 55.1231 ], [ 14, 54.2158 ], [ 15, 52.432500000000005 ], [ 16, 54.608599999999996 ], [ 17, 54.3893 ], [ 18, 52.2836 ], [ 19, 54.2755 ], [ 20, 54.03059999999999 ], [ 21, 52.4448 ], [ 22, 54.45140000000001 ], [ 23, 54.199299999999994 ], [ 24, 52.447 ], [ 25, 54.4825 ], [ 26, 54.116 ], [ 27, 52.459599999999995 ], [ 28, 54.6064 ], [ 29, 54.3421 ], [ 30, 52.731399999999994 ], [ 31, 54.705499999999994 ], [ 32, 54.49119999999999 ], [ 33, 52.643499999999996 ], [ 34, 54.75299999999999 ], [ 35, 54.583099999999995 ], [ 36, 52.844 ], [ 37, 54.894299999999994 ], [ 38, 54.5271 ], [ 39, 52.8824 ], [ 40, 54.7878 ], [ 41, 54.5299 ], [ 42, 52.907000000000004 ], [ 43, 54.8358 ], [ 44, 54.61240000000001 ], [ 45, 52.892300000000006 ], [ 46, 54.8432 ], [ 47, 54.5894 ], [ 48, 53.0707 ], [ 49, 54.9638 ], [ 50, 54.6511 ], [ 51, 53.01820000000001 ], [ 52, 55.046099999999996 ], [ 53, 54.676 ], [ 54, 53.05760000000001 ], [ 55, 55.0697 ], [ 56, 54.703599999999994 ], [ 57, 53.1711 ], [ 58, 55.024499999999996 ], [ 59, 54.681900000000006 ], [ 60, 53.0872 ], [ 61, 54.981700000000004 ], [ 62, 54.74020000000001 ], [ 63, 53.091 ], [ 64, 54.9357 ], [ 65, 54.7351 ], [ 66, 53.0915 ], [ 67, 54.934799999999996 ], [ 68, 54.65 ], [ 69, 52.97500000000001 ], [ 70, 54.8536 ], [ 71, 54.5481 ], [ 72, 52.971500000000006 ], [ 73, 54.767500000000005 ], [ 74, 54.4118 ], [ 75, 52.900800000000004 ], [ 76, 54.674800000000005 ], [ 77, 54.410599999999995 ], [ 78, 52.8729 ], [ 79, 54.576800000000006 ], [ 80, 54.260799999999996 ], [ 81, 52.701100000000004 ], [ 82, 54.410000000000004 ], [ 83, 54.1254 ], [ 84, 52.6126 ], [ 85, 54.4338 ], [ 86, 54.0765 ], [ 87, 52.6188 ], [ 88, 54.399 ], [ 89, 53.954299999999996 ], [ 90, 52.62 ], [ 91, 54.2999 ], [ 92, 54.027800000000006 ], [ 93, 52.5119 ], [ 94, 54.077799999999996 ], [ 95, 53.8277 ], [ 96, 52.4076 ], [ 97, 54.0975 ], [ 98, 53.7413 ], [ 99, 52.3407 ], [ 100, 53.9645 ], [ 101, 53.7125 ], [ 102, 52.2997 ], [ 103, 53.840900000000005 ], [ 104, 53.5416 ], [ 105, 52.2311 ], [ 106, 53.778999999999996 ], [ 107, 53.459999999999994 ], [ 108, 52.203 ], [ 109, 53.670300000000005 ], [ 110, 53.3513 ], [ 111, 52.1949 ], [ 112, 53.562799999999996 ], [ 113, 53.3978 ], [ 114, 52.15539999999999 ], [ 115, 53.559 ], [ 116, 53.325 ], [ 117, 52.019499999999994 ], [ 118, 53.4012 ], [ 119, 53.118900000000004 ], [ 120, 51.8958 ], [ 121, 53.3389 ], [ 122, 53.04259999999999 ], [ 123, 51.9021 ], [ 124, 53.306 ], [ 125, 52.962900000000005 ], [ 126, 51.8746 ], [ 127, 53.207800000000006 ], [ 128, 52.794799999999995 ], [ 129, 51.75189999999999 ], [ 130, 53.012800000000006 ], [ 131, 52.769200000000005 ], [ 132, 51.7625 ], [ 133, 53.0098 ], [ 134, 52.7474 ], [ 135, 51.7998 ], [ 136, 52.9492 ], [ 137, 52.681999999999995 ], [ 138, 51.7324 ], [ 139, 52.8113 ], [ 140, 52.5706 ], [ 141, 51.6558 ], [ 142, 52.65990000000001 ], [ 143, 52.436499999999995 ], [ 144, 51.5791 ], [ 145, 52.6508 ], [ 146, 52.346599999999995 ], [ 147, 51.558899999999994 ], [ 148, 52.5687 ], [ 149, 52.3704 ], [ 150, 51.524 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: After filtering", "uid": "fastp-seq-content-gc-plot_Read_2_After_filtering", "dconfig": { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R2 After filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 76.8971 ], [ 2, 58.932300000000005 ], [ 3, 51.2187 ], [ 4, 56.1087 ], [ 5, 52.3509 ], [ 6, 48.0004 ], [ 7, 50.437200000000004 ], [ 8, 53.669500000000006 ], [ 9, 53.6159 ], [ 10, 49.3231 ], [ 11, 59.467400000000005 ], [ 12, 57.3528 ], [ 13, 55.3283 ], [ 14, 54.2577 ], [ 15, 52.8405 ], [ 16, 54.9218 ], [ 17, 54.4501 ], [ 18, 52.6072 ], [ 19, 54.427899999999994 ], [ 20, 53.980399999999996 ], [ 21, 52.586999999999996 ], [ 22, 54.4465 ], [ 23, 54.03790000000001 ], [ 24, 52.638799999999996 ], [ 25, 54.567699999999995 ], [ 26, 54.066 ], [ 27, 52.716300000000004 ], [ 28, 54.869 ], [ 29, 54.381 ], [ 30, 52.9328 ], [ 31, 54.849599999999995 ], [ 32, 54.366099999999996 ], [ 33, 52.8003 ], [ 34, 54.8041 ], [ 35, 54.416 ], [ 36, 52.9937 ], [ 37, 54.9277 ], [ 38, 54.442 ], [ 39, 53.0121 ], [ 40, 54.81700000000001 ], [ 41, 54.4152 ], [ 42, 52.9733 ], [ 43, 54.8763 ], [ 44, 54.506299999999996 ], [ 45, 53.0 ], [ 46, 54.9107 ], [ 47, 54.4698 ], [ 48, 53.120599999999996 ], [ 49, 54.9996 ], [ 50, 54.5822 ], [ 51, 53.1716 ], [ 52, 55.1074 ], [ 53, 54.5767 ], [ 54, 53.1831 ], [ 55, 55.1249 ], [ 56, 54.5627 ], [ 57, 53.2667 ], [ 58, 55.0898 ], [ 59, 54.567299999999996 ], [ 60, 53.167699999999996 ], [ 61, 55.0694 ], [ 62, 54.6414 ], [ 63, 53.26220000000001 ], [ 64, 55.0551 ], [ 65, 54.6044 ], [ 66, 53.175700000000006 ], [ 67, 55.0176 ], [ 68, 54.561800000000005 ], [ 69, 53.13099999999999 ], [ 70, 54.9364 ], [ 71, 54.555 ], [ 72, 53.217800000000004 ], [ 73, 54.958 ], [ 74, 54.446799999999996 ], [ 75, 53.083000000000006 ], [ 76, 54.846700000000006 ], [ 77, 54.3815 ], [ 78, 53.0898 ], [ 79, 54.7782 ], [ 80, 54.36919999999999 ], [ 81, 52.977799999999995 ], [ 82, 54.6782 ], [ 83, 54.2384 ], [ 84, 52.9342 ], [ 85, 54.7206 ], [ 86, 54.1475 ], [ 87, 52.81249999999999 ], [ 88, 54.588 ], [ 89, 54.0528 ], [ 90, 52.8944 ], [ 91, 54.5747 ], [ 92, 54.1414 ], [ 93, 52.7556 ], [ 94, 54.3821 ], [ 95, 53.991699999999994 ], [ 96, 52.708200000000005 ], [ 97, 54.445100000000004 ], [ 98, 53.896 ], [ 99, 52.5332 ], [ 100, 54.2216 ], [ 101, 53.8426 ], [ 102, 52.5043 ], [ 103, 54.185 ], [ 104, 53.8205 ], [ 105, 52.4794 ], [ 106, 54.1653 ], [ 107, 53.6732 ], [ 108, 52.4598 ], [ 109, 54.049499999999995 ], [ 110, 53.534400000000005 ], [ 111, 52.3883 ], [ 112, 53.9645 ], [ 113, 53.605999999999995 ], [ 114, 52.3685 ], [ 115, 54.0185 ], [ 116, 53.60080000000001 ], [ 117, 52.310900000000004 ], [ 118, 53.95290000000001 ], [ 119, 53.409099999999995 ], [ 120, 52.174699999999994 ], [ 121, 53.8085 ], [ 122, 53.357600000000005 ], [ 123, 52.160700000000006 ], [ 124, 53.8855 ], [ 125, 53.2988 ], [ 126, 52.1895 ], [ 127, 53.8247 ], [ 128, 53.2874 ], [ 129, 52.044599999999996 ], [ 130, 53.602700000000006 ], [ 131, 53.219899999999996 ], [ 132, 51.9903 ], [ 133, 53.595800000000004 ], [ 134, 53.1783 ], [ 135, 52.0212 ], [ 136, 53.6064 ], [ 137, 53.135200000000005 ], [ 138, 51.963300000000004 ], [ 139, 53.4847 ], [ 140, 53.0549 ], [ 141, 51.894600000000004 ], [ 142, 53.386 ], [ 143, 52.9828 ], [ 144, 51.751999999999995 ], [ 145, 53.2945 ], [ 146, 52.9664 ], [ 147, 51.6354 ], [ 148, 53.369200000000006 ], [ 149, 52.913399999999996 ], [ 150, 51.607499999999995 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 75.3436 ], [ 2, 59.0258 ], [ 3, 48.713699999999996 ], [ 4, 54.8335 ], [ 5, 51.7293 ], [ 6, 47.1365 ], [ 7, 49.7373 ], [ 8, 52.9196 ], [ 9, 52.9292 ], [ 10, 48.6869 ], [ 11, 58.4156 ], [ 12, 56.761399999999995 ], [ 13, 54.9879 ], [ 14, 54.076299999999996 ], [ 15, 52.288199999999996 ], [ 16, 54.4717 ], [ 17, 54.252900000000004 ], [ 18, 52.13870000000001 ], [ 19, 54.1414 ], [ 20, 53.89659999999999 ], [ 21, 52.3019 ], [ 22, 54.3177 ], [ 23, 54.0671 ], [ 24, 52.3071 ], [ 25, 54.352500000000006 ], [ 26, 53.987399999999994 ], [ 27, 52.3214 ], [ 28, 54.47689999999999 ], [ 29, 54.2149 ], [ 30, 52.5963 ], [ 31, 54.5786 ], [ 32, 54.364599999999996 ], [ 33, 52.5081 ], [ 34, 54.62780000000001 ], [ 35, 54.4598 ], [ 36, 52.7144 ], [ 37, 54.7732 ], [ 38, 54.40390000000001 ], [ 39, 52.754599999999996 ], [ 40, 54.6708 ], [ 41, 54.407300000000006 ], [ 42, 52.782 ], [ 43, 54.718999999999994 ], [ 44, 54.494600000000005 ], [ 45, 52.7651 ], [ 46, 54.7278 ], [ 47, 54.474000000000004 ], [ 48, 52.947 ], [ 49, 54.8509 ], [ 50, 54.5404 ], [ 51, 52.8957 ], [ 52, 54.9367 ], [ 53, 54.5626 ], [ 54, 52.9382 ], [ 55, 54.961499999999994 ], [ 56, 54.5953 ], [ 57, 53.054100000000005 ], [ 58, 54.91780000000001 ], [ 59, 54.57379999999999 ], [ 60, 52.9744 ], [ 61, 54.8775 ], [ 62, 54.6389 ], [ 63, 52.9799 ], [ 64, 54.83670000000001 ], [ 65, 54.6394 ], [ 66, 52.985400000000006 ], [ 67, 54.84250000000001 ], [ 68, 54.5606 ], [ 69, 52.873000000000005 ], [ 70, 54.768499999999996 ], [ 71, 54.464800000000004 ], [ 72, 52.8779 ], [ 73, 54.697700000000005 ], [ 74, 54.3411 ], [ 75, 52.8147 ], [ 76, 54.6146 ], [ 77, 54.3513 ], [ 78, 52.7927 ], [ 79, 54.5276 ], [ 80, 54.212700000000005 ], [ 81, 52.6203 ], [ 82, 54.3705 ], [ 83, 54.076800000000006 ], [ 84, 52.534099999999995 ], [ 85, 54.4064 ], [ 86, 54.047999999999995 ], [ 87, 52.5443 ], [ 88, 54.38269999999999 ], [ 89, 53.9273 ], [ 90, 52.5308 ], [ 91, 54.2735 ], [ 92, 53.9938 ], [ 93, 52.4097 ], [ 94, 54.0629 ], [ 95, 53.7951 ], [ 96, 52.3056 ], [ 97, 54.0996 ], [ 98, 53.7138 ], [ 99, 52.2168 ], [ 100, 53.967299999999994 ], [ 101, 53.681400000000004 ], [ 102, 52.1475 ], [ 103, 53.8465 ], [ 104, 53.527100000000004 ], [ 105, 52.0929 ], [ 106, 53.817499999999995 ], [ 107, 53.4667 ], [ 108, 52.0539 ], [ 109, 53.715 ], [ 110, 53.352500000000006 ], [ 111, 52.0374 ], [ 112, 53.629400000000004 ], [ 113, 53.4343 ], [ 114, 52.0102 ], [ 115, 53.6712 ], [ 116, 53.412000000000006 ], [ 117, 51.8484 ], [ 118, 53.5395 ], [ 119, 53.205999999999996 ], [ 120, 51.7324 ], [ 121, 53.500400000000006 ], [ 122, 53.154599999999995 ], [ 123, 51.739000000000004 ], [ 124, 53.5382 ], [ 125, 53.103500000000004 ], [ 126, 51.734700000000004 ], [ 127, 53.4512 ], [ 128, 52.947500000000005 ], [ 129, 51.5732 ], [ 130, 53.2671 ], [ 131, 52.9762 ], [ 132, 51.5765 ], [ 133, 53.269200000000005 ], [ 134, 52.9381 ], [ 135, 51.625299999999996 ], [ 136, 53.271100000000004 ], [ 137, 52.8706 ], [ 138, 51.505599999999994 ], [ 139, 53.0847 ], [ 140, 52.7657 ], [ 141, 51.44879999999999 ], [ 142, 52.9579 ], [ 143, 52.6326 ], [ 144, 51.294200000000004 ], [ 145, 52.9563 ], [ 146, 52.553000000000004 ], [ 147, 51.1582 ], [ 148, 52.9026 ], [ 149, 52.567299999999996 ], [ 150, 51.098200000000006 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastp-seq-content-gc-plot", "title": "Fastp: Read GC Content", "xlab": "Read Position", "ylab": "R1 Before filtering: Base Content Percent", "ymax": 100, "ymin": 0, "tt_label": "{point.x}: {point.y:.2f}%", "data_labels": [ { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Base Content Percent", "categories": [] }, { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Base Content Percent", "categories": [] }, { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Base Content Percent", "categories": [] }, { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Base Content Percent", "categories": [] } ] } }, "fastp-seq-content-n-plot": { "id": "fastp-seq-content-n-plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "Fastp: Read N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Read 1: Before filtering", "uid": "fastp-seq-content-n-plot_Read_1_Before_filtering", "dconfig": { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R1 Before filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 1: After filtering", "uid": "fastp-seq-content-n-plot_Read_1_After_filtering", "dconfig": { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R1 After filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: Before filtering", "uid": "fastp-seq-content-n-plot_Read_2_Before_filtering", "dconfig": { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R2 Before filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#434348", "marker": {} } ] }, { "label": "Read 2: After filtering", "uid": "fastp-seq-content-n-plot_Read_2_After_filtering", "dconfig": { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Base Content Percent", "categories": [] }, "layout": { "title": { "text": "Fastp: Read N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Position" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "R2 After filtering: Base Content Percent" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 11, 0.0 ], [ 12, 0.0 ], [ 13, 0.0 ], [ 14, 0.0 ], [ 15, 0.0 ], [ 16, 0.0 ], [ 17, 0.0 ], [ 18, 0.0 ], [ 19, 0.0 ], [ 20, 0.0 ], [ 21, 0.0 ], [ 22, 0.0 ], [ 23, 0.0 ], [ 24, 0.0 ], [ 25, 0.0 ], [ 26, 0.0 ], [ 27, 0.0 ], [ 28, 0.0 ], [ 29, 0.0 ], [ 30, 0.0 ], [ 31, 0.0 ], [ 32, 0.0 ], [ 33, 0.0 ], [ 34, 0.0 ], [ 35, 0.0 ], [ 36, 0.0 ], [ 37, 0.0 ], [ 38, 0.0 ], [ 39, 0.0 ], [ 40, 0.0 ], [ 41, 0.0 ], [ 42, 0.0 ], [ 43, 0.0 ], [ 44, 0.0 ], [ 45, 0.0 ], [ 46, 0.0 ], [ 47, 0.0 ], [ 48, 0.0 ], [ 49, 0.0 ], [ 50, 0.0 ], [ 51, 0.0 ], [ 52, 0.0 ], [ 53, 0.0 ], [ 54, 0.0 ], [ 55, 0.0 ], [ 56, 0.0 ], [ 57, 0.0 ], [ 58, 0.0 ], [ 59, 0.0 ], [ 60, 0.0 ], [ 61, 0.0 ], [ 62, 0.0 ], [ 63, 0.0 ], [ 64, 0.0 ], [ 65, 0.0 ], [ 66, 0.0 ], [ 67, 0.0 ], [ 68, 0.0 ], [ 69, 0.0 ], [ 70, 0.0 ], [ 71, 0.0 ], [ 72, 0.0 ], [ 73, 0.0 ], [ 74, 0.0 ], [ 75, 0.0 ], [ 76, 0.0 ], [ 77, 0.0 ], [ 78, 0.0 ], [ 79, 0.0 ], [ 80, 0.0 ], [ 81, 0.0 ], [ 82, 0.0 ], [ 83, 0.0 ], [ 84, 0.0 ], [ 85, 0.0 ], [ 86, 0.0 ], [ 87, 0.0 ], [ 88, 0.0 ], [ 89, 0.0 ], [ 90, 0.0 ], [ 91, 0.0 ], [ 92, 0.0 ], [ 93, 0.0 ], [ 94, 0.0 ], [ 95, 0.0 ], [ 96, 0.0 ], [ 97, 0.0 ], [ 98, 0.0 ], [ 99, 0.0 ], [ 100, 0.0 ], [ 101, 0.0 ], [ 102, 0.0 ], [ 103, 0.0 ], [ 104, 0.0 ], [ 105, 0.0 ], [ 106, 0.0 ], [ 107, 0.0 ], [ 108, 0.0 ], [ 109, 0.0 ], [ 110, 0.0 ], [ 111, 0.0 ], [ 112, 0.0 ], [ 113, 0.0 ], [ 114, 0.0 ], [ 115, 0.0 ], [ 116, 0.0 ], [ 117, 0.0 ], [ 118, 0.0 ], [ 119, 0.0 ], [ 120, 0.0 ], [ 121, 0.0 ], [ 122, 0.0 ], [ 123, 0.0 ], [ 124, 0.0 ], [ 125, 0.0 ], [ 126, 0.0 ], [ 127, 0.0 ], [ 128, 0.0 ], [ 129, 0.0 ], [ 130, 0.0 ], [ 131, 0.0 ], [ 132, 0.0 ], [ 133, 0.0 ], [ 134, 0.0 ], [ 135, 0.0 ], [ 136, 0.0 ], [ 137, 0.0 ], [ 138, 0.0 ], [ 139, 0.0 ], [ 140, 0.0 ], [ 141, 0.0 ], [ 142, 0.0 ], [ 143, 0.0 ], [ 144, 0.0 ], [ 145, 0.0 ], [ 146, 0.0 ], [ 147, 0.0 ], [ 148, 0.0 ], [ 149, 0.0 ], [ 150, 0.0 ] ], "color": "#434348", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastp-seq-content-n-plot", "title": "Fastp: Read N Content", "xlab": "Read Position", "ylab": "R1 Before filtering: Base Content Percent", "yCeiling": 100, "yMinRange": 5, "ymin": 0, "tt_label": "{point.x}: {point.y:.2f}%", "data_labels": [ { "name": "Read 1: Before filtering", "ylab": "R1 Before filtering: Base Content Percent", "categories": [] }, { "name": "Read 1: After filtering", "ylab": "R1 After filtering: Base Content Percent", "categories": [] }, { "name": "Read 2: Before filtering", "ylab": "R2 Before filtering: Base Content Percent", "categories": [] }, { "name": "Read 2: After filtering", "ylab": "R2 After filtering: Base Content Percent", "categories": [] } ] } }, "fastqc_sequence_counts_plot": { "id": "fastqc_sequence_counts_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 380, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_counts_plot", "dconfig": {}, "layout": { "title": { "text": "FastQC: Sequence Counts" }, "xaxis": { "title": { "text": "Number of reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 10000000 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Unique Reads", "data": [ 4690735, 4145006, 4734931, 4183693, 4838842, 4440350, 4881418, 4474998 ], "color": "0.49,0.71,0.93", "data_pct": [ 47.22847529492028, 41.733824969497604, 47.34931, 41.83693, 48.691740327194225, 44.68184106070355, 48.81418, 44.74998 ] }, { "name": "Duplicate Reads", "data": [ 5241271, 5787000, 5265069, 5816307, 5098864, 5497356, 5118582, 5525002 ], "color": "0.26,0.26,0.28", "data_pct": [ 52.77152470507972, 58.266175030502396, 52.65069, 58.16307, 51.308259672805775, 55.31815893929646, 51.18582000000001, 55.25002 ] } ], "samples": [ "rna_s1221_S42_trimmed_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_2", "rna_s1221_S42_1", "rna_s1200_S21_trimmed_2", "rna_s1200_S21_trimmed_1", "rna_s1200_S21_2", "rna_s1200_S21_1" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_counts_plot", "title": "FastQC: Sequence Counts", "ylab": "Number of reads", "cpswitch_counts_label": "Number of reads", "hide_zero_cats": false } }, "fastqc_per_base_sequence_quality_plot": { "id": "fastqc_per_base_sequence_quality_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Mean Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_base_sequence_quality_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Mean Quality Scores" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Phred Score" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 41.766738593999996 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 1, 38.8954434 ], [ 2, 39.3616132 ], [ 3, 39.442277 ], [ 4, 39.5672692 ], [ 5, 39.5511056 ], [ 6, 39.5549756 ], [ 7, 39.5642928 ], [ 8, 39.603835 ], [ 9, 39.6072964 ], [ 12, 39.63645368 ], [ 17, 39.731583320000006 ], [ 22, 39.77784628 ], [ 27, 39.6823294 ], [ 32, 39.670493640000004 ], [ 37, 39.68985552 ], [ 42, 39.70200808 ], [ 47, 39.70625004 ], [ 52, 39.71098704 ], [ 57, 39.71463188 ], [ 62, 39.71313248 ], [ 67, 39.7169994 ], [ 72, 39.715704519999996 ], [ 77, 39.70980968 ], [ 82, 39.70867880000001 ], [ 87, 39.704032919999996 ], [ 92, 39.70402336 ], [ 97, 39.699620120000006 ], [ 102, 39.69577751999999 ], [ 107, 39.68553544 ], [ 112, 39.671307 ], [ 117, 39.645911919999996 ], [ 122, 39.600139 ], [ 127, 39.50473248 ], [ 132, 39.371828199999996 ], [ 137, 39.19872736 ], [ 142, 38.99686644 ], [ 147, 38.78348304 ], [ 150, 38.646308 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 1, 38.4864876 ], [ 2, 39.2239422 ], [ 3, 39.310031 ], [ 4, 39.431364 ], [ 5, 39.4678302 ], [ 6, 39.4764932 ], [ 7, 39.5317878 ], [ 8, 39.5330652 ], [ 9, 39.5645534 ], [ 12, 39.607947079999995 ], [ 17, 39.63200776 ], [ 22, 39.66299532 ], [ 27, 39.52360412 ], [ 32, 39.503228719999996 ], [ 37, 39.51588372 ], [ 42, 39.529597720000005 ], [ 47, 39.530745360000004 ], [ 52, 39.5492546 ], [ 57, 39.5537834 ], [ 62, 39.556474480000006 ], [ 67, 39.56349788 ], [ 72, 39.55982428 ], [ 77, 39.56594836000001 ], [ 82, 39.55501372 ], [ 87, 39.556236 ], [ 92, 39.55023428 ], [ 97, 39.533677919999995 ], [ 102, 39.5089924 ], [ 107, 39.47303292 ], [ 112, 39.42348052 ], [ 117, 39.36713792 ], [ 122, 39.3001368 ], [ 127, 39.2191518 ], [ 132, 39.14326731999999 ], [ 137, 39.0689872 ], [ 142, 38.99092784 ], [ 147, 38.92184368 ], [ 150, 38.868565 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 1, 38.94306794747198 ], [ 2, 39.39670523559462 ], [ 3, 39.47628456708218 ], [ 4, 39.59774559641833 ], [ 5, 39.58142271465869 ], [ 6, 39.58508553181187 ], [ 7, 39.59326850683649 ], [ 8, 39.63249486350271 ], [ 9, 39.635484889571096 ], [ 12, 39.66327625309101 ], [ 17, 39.75626978283675 ], [ 22, 39.80205356055406 ], [ 27, 39.73025252253767 ], [ 32, 39.72439460358404 ], [ 37, 39.74347277170697 ], [ 42, 39.75583839896649 ], [ 47, 39.760332920822194 ], [ 52, 39.76545823408362 ], [ 57, 39.76967942530913 ], [ 62, 39.76880745533617 ], [ 67, 39.77333886588867 ], [ 72, 39.772878776986374 ], [ 77, 39.76791594013832 ], [ 82, 39.7678818949237 ], [ 87, 39.76467587602449 ], [ 92, 39.766284196368005 ], [ 97, 39.76434309170602 ], [ 102, 39.763928020467894 ], [ 107, 39.75972969733292 ], [ 112, 39.75681886979599 ], [ 117, 39.75461865760445 ], [ 122, 39.754396492737335 ], [ 127, 39.742481928113584 ], [ 132, 39.73437040281548 ], [ 137, 39.72571135784959 ], [ 142, 39.715775764667185 ], [ 147, 39.70821165695177 ], [ 150, 39.69699054000168 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 1, 38.55978894928065 ], [ 2, 39.30448737364539 ], [ 3, 39.39223076231074 ], [ 4, 39.510513190871215 ], [ 5, 39.54694453629439 ], [ 6, 39.5582058877572 ], [ 7, 39.6133659015471 ], [ 8, 39.61380081077061 ], [ 9, 39.6457580854173 ], [ 12, 39.68760432236574 ], [ 17, 39.7116128590245 ], [ 22, 39.742937683400484 ], [ 27, 39.64081064854827 ], [ 32, 39.63123260046743 ], [ 37, 39.64516179599552 ], [ 42, 39.65977627596425 ], [ 47, 39.66191889995811 ], [ 52, 39.6813844955296 ], [ 57, 39.68699661778756 ], [ 62, 39.69054729283711 ], [ 67, 39.69864900759071 ], [ 72, 39.69599614292183 ], [ 77, 39.70361384460513 ], [ 82, 39.69537312407714 ], [ 87, 39.7014991479501 ], [ 92, 39.7048192412924 ], [ 97, 39.704836485389094 ], [ 102, 39.70420606111101 ], [ 107, 39.70431610819084 ], [ 112, 39.6998588225954 ], [ 117, 39.70126648221349 ], [ 122, 39.69617588583934 ], [ 127, 39.680323494553065 ], [ 132, 39.65815704757692 ], [ 137, 39.62799233367437 ], [ 142, 39.57751194795751 ], [ 147, 39.525079330368655 ], [ 150, 39.47454521504531 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 1, 38.8374422 ], [ 2, 39.3347924 ], [ 3, 39.4200068 ], [ 4, 39.5583492 ], [ 5, 39.5402486 ], [ 6, 39.5474558 ], [ 7, 39.5456758 ], [ 8, 39.590989 ], [ 9, 39.5924106 ], [ 12, 39.62612312 ], [ 17, 39.723491960000004 ], [ 22, 39.76848268 ], [ 27, 39.665461799999996 ], [ 32, 39.65167044 ], [ 37, 39.671032319999995 ], [ 42, 39.68269204 ], [ 47, 39.68668712 ], [ 52, 39.6905114 ], [ 57, 39.69332088 ], [ 62, 39.69300267999999 ], [ 67, 39.695798079999996 ], [ 72, 39.69331832 ], [ 77, 39.686316839999996 ], [ 82, 39.68410132 ], [ 87, 39.677625559999996 ], [ 92, 39.67433624 ], [ 97, 39.66432004 ], [ 102, 39.65304244 ], [ 107, 39.635699839999994 ], [ 112, 39.6068876 ], [ 117, 39.56433412 ], [ 122, 39.48538771999999 ], [ 127, 39.342285319999995 ], [ 132, 39.143409919999996 ], [ 137, 38.900227439999995 ], [ 142, 38.633241399999996 ], [ 147, 38.37516304 ], [ 150, 38.214155 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 1, 38.4185352 ], [ 2, 39.2229156 ], [ 3, 39.2835262 ], [ 4, 39.4314298 ], [ 5, 39.4671192 ], [ 6, 39.4763512 ], [ 7, 39.5327252 ], [ 8, 39.5338204 ], [ 9, 39.5602728 ], [ 12, 39.59956704 ], [ 17, 39.625916360000005 ], [ 22, 39.6520006 ], [ 27, 39.509665399999996 ], [ 32, 39.48712176 ], [ 37, 39.497463440000004 ], [ 42, 39.5087644 ], [ 47, 39.507510399999994 ], [ 52, 39.52405236 ], [ 57, 39.526422600000004 ], [ 62, 39.52764072000001 ], [ 67, 39.53212956 ], [ 72, 39.525580919999996 ], [ 77, 39.528069239999994 ], [ 82, 39.51291088 ], [ 87, 39.50735288 ], [ 92, 39.492422680000004 ], [ 97, 39.46299032 ], [ 102, 39.4202954 ], [ 107, 39.36264852000001 ], [ 112, 39.28583348 ], [ 117, 39.20311475999999 ], [ 122, 39.10955223999999 ], [ 127, 39.01667896 ], [ 132, 38.93874099999999 ], [ 137, 38.87228512 ], [ 142, 38.813305400000004 ], [ 147, 38.76933624000001 ], [ 150, 38.7329934 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 1, 38.88678681829229 ], [ 2, 39.37229840578026 ], [ 3, 39.45641897517984 ], [ 4, 39.59082767368445 ], [ 5, 39.57253469238742 ], [ 6, 39.57983573509722 ], [ 7, 39.57732526540963 ], [ 8, 39.6219468655174 ], [ 9, 39.62334456906289 ], [ 12, 39.655177614673214 ], [ 17, 39.75015081572302 ], [ 22, 39.79460996441105 ], [ 27, 39.7177865939076 ], [ 32, 39.710983830263956 ], [ 37, 39.730423389299574 ], [ 42, 39.74263859167057 ], [ 47, 39.747419416169805 ], [ 52, 39.752281501490955 ], [ 57, 39.75580567691223 ], [ 62, 39.75653614171501 ], [ 67, 39.76014430568049 ], [ 72, 39.759037296441974 ], [ 77, 39.75351892005919 ], [ 82, 39.75326868702665 ], [ 87, 39.75039149158128 ], [ 92, 39.751845369698216 ], [ 97, 39.74875447924235 ], [ 102, 39.74717572341797 ], [ 107, 39.74454724028804 ], [ 112, 39.73954651373164 ], [ 117, 39.73811176871098 ], [ 122, 39.73480046158572 ], [ 127, 39.72239541150465 ], [ 132, 39.71202989556686 ], [ 137, 39.702701200907725 ], [ 142, 39.69047640456341 ], [ 147, 39.68299301781765 ], [ 150, 39.66862967920953 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 1, 38.498900624909005 ], [ 2, 39.30910734447804 ], [ 3, 39.371919831703686 ], [ 4, 39.51578442461674 ], [ 5, 39.551455566982135 ], [ 6, 39.563159345654846 ], [ 7, 39.61885685530194 ], [ 8, 39.619765433085725 ], [ 9, 39.646874558875616 ], [ 12, 39.684223428781664 ], [ 17, 39.710981426526715 ], [ 22, 39.737268059527175 ], [ 27, 39.63511155094139 ], [ 32, 39.624342432755064 ], [ 37, 39.63614565804456 ], [ 42, 39.6490580015017 ], [ 47, 39.649272663052535 ], [ 52, 39.66730035987424 ], [ 57, 39.67134964505194 ], [ 62, 39.67465411832068 ], [ 67, 39.681925646409766 ], [ 72, 39.67876141755537 ], [ 77, 39.6859209505747 ], [ 82, 39.67702972813373 ], [ 87, 39.68203692625376 ], [ 92, 39.68451130343087 ], [ 97, 39.682972729662325 ], [ 102, 39.681027551278326 ], [ 107, 39.679851836497924 ], [ 112, 39.67386090284102 ], [ 117, 39.67507006577069 ], [ 122, 39.6679497505624 ], [ 127, 39.652008572714024 ], [ 132, 39.630803686418304 ], [ 137, 39.59959828029385 ], [ 142, 39.55011519618961 ], [ 147, 39.498174762377396 ], [ 150, 39.44704549711975 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_base_sequence_quality_plot", "title": "FastQC: Mean Quality Scores", "ylab": "Phred Score", "xlab": "Position (bp)", "ymin": 0, "xmin": 0, "xDecimals": false, "tt_label": "Base {point.x}: {point.y:.2f}", "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_1": "#5cb85c", "rna_s1200_S21_1": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1221_S42_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c", "rna_s1200_S21_2": "#5cb85c" }, "yPlotBands": [ { "from": 28, "to": 100, "color": "#c3e6c3" }, { "from": 20, "to": 28, "color": "#e6dcc3" }, { "from": 0, "to": 20, "color": "#e6c3c3" } ] } }, "fastqc_per_sequence_quality_scores_plot": { "id": "fastqc_per_sequence_quality_scores_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_sequence_quality_scores_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence Quality Scores" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Mean Sequence Quality (Phred Score)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 40.0 ] }, "yaxis": { "hoverformat": null, "ticksuffix": " reads", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
Phred %{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 16.0, 5.0 ], [ 17.0, 83.0 ], [ 18.0, 782.0 ], [ 19.0, 3465.0 ], [ 20.0, 7397.0 ], [ 21.0, 7121.0 ], [ 22.0, 5304.0 ], [ 23.0, 4494.0 ], [ 24.0, 4805.0 ], [ 25.0, 5247.0 ], [ 26.0, 6082.0 ], [ 27.0, 6707.0 ], [ 28.0, 7792.0 ], [ 29.0, 8890.0 ], [ 30.0, 10848.0 ], [ 31.0, 12715.0 ], [ 32.0, 16954.0 ], [ 33.0, 23946.0 ], [ 34.0, 38952.0 ], [ 35.0, 67833.0 ], [ 36.0, 99782.0 ], [ 37.0, 151904.0 ], [ 38.0, 396046.0 ], [ 39.0, 3027000.0 ], [ 40.0, 6085846.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 5.0, 6.0 ], [ 6.0, 5.0 ], [ 7.0, 8.0 ], [ 8.0, 14.0 ], [ 9.0, 17.0 ], [ 10.0, 16.0 ], [ 11.0, 24.0 ], [ 12.0, 38.0 ], [ 13.0, 33.0 ], [ 14.0, 152.0 ], [ 15.0, 733.0 ], [ 16.0, 2801.0 ], [ 17.0, 6447.0 ], [ 18.0, 10444.0 ], [ 19.0, 12715.0 ], [ 20.0, 13876.0 ], [ 21.0, 10750.0 ], [ 22.0, 8975.0 ], [ 23.0, 8233.0 ], [ 24.0, 8736.0 ], [ 25.0, 8661.0 ], [ 26.0, 9665.0 ], [ 27.0, 10098.0 ], [ 28.0, 11601.0 ], [ 29.0, 12424.0 ], [ 30.0, 14643.0 ], [ 31.0, 16860.0 ], [ 32.0, 21195.0 ], [ 33.0, 26316.0 ], [ 34.0, 35995.0 ], [ 35.0, 49820.0 ], [ 36.0, 78424.0 ], [ 37.0, 140174.0 ], [ 38.0, 406596.0 ], [ 39.0, 4190121.0 ], [ 40.0, 4883384.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 20.0, 217.0 ], [ 21.0, 1320.0 ], [ 22.0, 2098.0 ], [ 23.0, 2624.0 ], [ 24.0, 3342.0 ], [ 25.0, 4015.0 ], [ 26.0, 4811.0 ], [ 27.0, 5566.0 ], [ 28.0, 6677.0 ], [ 29.0, 7780.0 ], [ 30.0, 9474.0 ], [ 31.0, 11060.0 ], [ 32.0, 14252.0 ], [ 33.0, 18391.0 ], [ 34.0, 25774.0 ], [ 35.0, 37612.0 ], [ 36.0, 57989.0 ], [ 37.0, 86507.0 ], [ 38.0, 205023.0 ], [ 39.0, 2850206.0 ], [ 40.0, 6582968.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 19.0, 3.0 ], [ 20.0, 580.0 ], [ 21.0, 3415.0 ], [ 22.0, 5656.0 ], [ 23.0, 6518.0 ], [ 24.0, 7522.0 ], [ 25.0, 7766.0 ], [ 26.0, 8605.0 ], [ 27.0, 8996.0 ], [ 28.0, 10147.0 ], [ 29.0, 10800.0 ], [ 30.0, 12369.0 ], [ 31.0, 13965.0 ], [ 32.0, 16788.0 ], [ 33.0, 20340.0 ], [ 34.0, 27088.0 ], [ 35.0, 37573.0 ], [ 36.0, 56343.0 ], [ 37.0, 86283.0 ], [ 38.0, 213244.0 ], [ 39.0, 3370681.0 ], [ 40.0, 6013024.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 15.0, 2.0 ], [ 16.0, 6.0 ], [ 17.0, 86.0 ], [ 18.0, 803.0 ], [ 19.0, 3662.0 ], [ 20.0, 7914.0 ], [ 21.0, 8344.0 ], [ 22.0, 6186.0 ], [ 23.0, 5184.0 ], [ 24.0, 5361.0 ], [ 25.0, 5619.0 ], [ 26.0, 6652.0 ], [ 27.0, 7271.0 ], [ 28.0, 8514.0 ], [ 29.0, 9708.0 ], [ 30.0, 11814.0 ], [ 31.0, 14720.0 ], [ 32.0, 21663.0 ], [ 33.0, 33077.0 ], [ 34.0, 51384.0 ], [ 35.0, 88525.0 ], [ 36.0, 124314.0 ], [ 37.0, 190707.0 ], [ 38.0, 499067.0 ], [ 39.0, 3088887.0 ], [ 40.0, 5800530.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 4.0, 2.0 ], [ 5.0, 4.0 ], [ 6.0, 3.0 ], [ 7.0, 5.0 ], [ 8.0, 14.0 ], [ 9.0, 10.0 ], [ 10.0, 20.0 ], [ 11.0, 23.0 ], [ 12.0, 30.0 ], [ 13.0, 46.0 ], [ 14.0, 147.0 ], [ 15.0, 798.0 ], [ 16.0, 2969.0 ], [ 17.0, 6726.0 ], [ 18.0, 11006.0 ], [ 19.0, 13992.0 ], [ 20.0, 14917.0 ], [ 21.0, 11901.0 ], [ 22.0, 9871.0 ], [ 23.0, 8888.0 ], [ 24.0, 9554.0 ], [ 25.0, 9777.0 ], [ 26.0, 10988.0 ], [ 27.0, 11801.0 ], [ 28.0, 12864.0 ], [ 29.0, 14335.0 ], [ 30.0, 17048.0 ], [ 31.0, 19721.0 ], [ 32.0, 24834.0 ], [ 33.0, 30792.0 ], [ 34.0, 41694.0 ], [ 35.0, 57393.0 ], [ 36.0, 92377.0 ], [ 37.0, 169518.0 ], [ 38.0, 503309.0 ], [ 39.0, 4243385.0 ], [ 40.0, 4649238.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 20.0, 190.0 ], [ 21.0, 1375.0 ], [ 22.0, 2243.0 ], [ 23.0, 2840.0 ], [ 24.0, 3643.0 ], [ 25.0, 4145.0 ], [ 26.0, 5166.0 ], [ 27.0, 5809.0 ], [ 28.0, 7002.0 ], [ 29.0, 8249.0 ], [ 30.0, 9928.0 ], [ 31.0, 11879.0 ], [ 32.0, 15163.0 ], [ 33.0, 19501.0 ], [ 34.0, 27333.0 ], [ 35.0, 39480.0 ], [ 36.0, 61042.0 ], [ 37.0, 92744.0 ], [ 38.0, 222708.0 ], [ 39.0, 2922299.0 ], [ 40.0, 6469267.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 19.0, 2.0 ], [ 20.0, 578.0 ], [ 21.0, 3634.0 ], [ 22.0, 5858.0 ], [ 23.0, 6769.0 ], [ 24.0, 7799.0 ], [ 25.0, 8361.0 ], [ 26.0, 9386.0 ], [ 27.0, 10097.0 ], [ 28.0, 10893.0 ], [ 29.0, 12005.0 ], [ 30.0, 13618.0 ], [ 31.0, 15026.0 ], [ 32.0, 17875.0 ], [ 33.0, 21638.0 ], [ 34.0, 28818.0 ], [ 35.0, 39637.0 ], [ 36.0, 59322.0 ], [ 37.0, 90306.0 ], [ 38.0, 221392.0 ], [ 39.0, 3274143.0 ], [ 40.0, 6074849.0 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_sequence_quality_scores_plot", "title": "FastQC: Per Sequence Quality Scores", "ylab": "Count", "xlab": "Mean Sequence Quality (Phred Score)", "ymin": 0, "xmin": 0, "xDecimals": false, "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_1": "#5cb85c", "rna_s1200_S21_1": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1221_S42_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c", "rna_s1200_S21_2": "#5cb85c" }, "tt_label": "Phred {point.x}: {point.y} reads", "xPlotBands": [ { "from": 28, "to": 100, "color": "#c3e6c3" }, { "from": 20, "to": 28, "color": "#e6dcc3" }, { "from": 0, "to": 20, "color": "#e6c3c3" } ] } }, "fastqc_per_sequence_gc_content_plot": { "id": "fastqc_per_sequence_gc_content_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Percentages", "uid": "fastqc_per_sequence_gc_content_plot_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "% GC", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.00010500002100000419 ], [ 2.0, 0.00035000007000001403 ], [ 3.0, 0.0008300001660000332 ], [ 4.0, 0.0008800001760000352 ], [ 5.0, 0.0004650000930000186 ], [ 6.0, 0.00026500005300001057 ], [ 7.0, 0.00019000003800000758 ], [ 8.0, 0.0001350000270000054 ], [ 9.0, 0.0001200000240000048 ], [ 10.0, 0.00015500003100000622 ], [ 11.0, 0.0001600000320000064 ], [ 12.0, 0.0001700000340000068 ], [ 13.0, 0.00025000005000001 ], [ 14.0, 0.00039500007900001584 ], [ 15.0, 0.00047000009400001885 ], [ 16.0, 0.0006300001260000252 ], [ 17.0, 0.0014400002880000575 ], [ 18.0, 0.0026600005320001063 ], [ 19.0, 0.004375000875000174 ], [ 20.0, 0.0071650014330002865 ], [ 21.0, 0.011135002227000446 ], [ 22.0, 0.016640003328000665 ], [ 23.0, 0.024105004821000964 ], [ 24.0, 0.033820006764001355 ], [ 25.0, 0.04700500940100188 ], [ 26.0, 0.06449501289900259 ], [ 27.0, 0.08665001733000346 ], [ 28.0, 0.11839002367800473 ], [ 29.0, 0.1607900321580064 ], [ 30.0, 0.21548504309700864 ], [ 31.0, 0.2833850566770113 ], [ 32.0, 0.3729850745970149 ], [ 33.0, 0.48862509772501955 ], [ 34.0, 0.6365951273190255 ], [ 35.0, 0.798785159757032 ], [ 36.0, 0.9776401955280392 ], [ 37.0, 1.2171852434370487 ], [ 38.0, 1.4804352960870593 ], [ 39.0, 1.7144953428990684 ], [ 40.0, 1.9416853883370777 ], [ 41.0, 2.182865436573087 ], [ 42.0, 2.400690480138096 ], [ 43.0, 2.582060516412103 ], [ 44.0, 2.719260543852109 ], [ 45.0, 2.848975569795114 ], [ 46.0, 2.9676905935381184 ], [ 47.0, 3.0102906020581206 ], [ 48.0, 3.0242006048401207 ], [ 49.0, 3.0635106127021228 ], [ 50.0, 3.1181556236311248 ], [ 51.0, 3.1901956380391274 ], [ 52.0, 3.273070654614131 ], [ 53.0, 3.3371906674381338 ], [ 54.0, 3.4641656928331384 ], [ 55.0, 3.5843207168641436 ], [ 56.0, 3.568785713757143 ], [ 57.0, 3.5191507038301406 ], [ 58.0, 3.476450695290139 ], [ 59.0, 3.450490690098138 ], [ 60.0, 3.4518806903761377 ], [ 61.0, 3.3338206667641335 ], [ 62.0, 3.1062556212511243 ], [ 63.0, 2.896940579388116 ], [ 64.0, 2.6788655357731073 ], [ 65.0, 2.4581854916370984 ], [ 66.0, 2.198080439616088 ], [ 67.0, 1.8867203773440755 ], [ 68.0, 1.627055325411065 ], [ 69.0, 1.3687952737590547 ], [ 70.0, 1.0918402183680436 ], [ 71.0, 0.875675175135035 ], [ 72.0, 0.7070401414080283 ], [ 73.0, 0.5678451135690228 ], [ 74.0, 0.46485009297001856 ], [ 75.0, 0.3818750763750153 ], [ 76.0, 0.3059250611850123 ], [ 77.0, 0.24781004956200992 ], [ 78.0, 0.20177504035500804 ], [ 79.0, 0.1594100318820064 ], [ 80.0, 0.1277300255460051 ], [ 81.0, 0.10176502035300407 ], [ 82.0, 0.07701001540200308 ], [ 83.0, 0.05628001125600225 ], [ 84.0, 0.038840007768001554 ], [ 85.0, 0.02853000570600114 ], [ 86.0, 0.02176500435300087 ], [ 87.0, 0.015440003088000616 ], [ 88.0, 0.01051000210200042 ], [ 89.0, 0.0067300013460002694 ], [ 90.0, 0.004280000856000171 ], [ 91.0, 0.0027200005440001086 ], [ 92.0, 0.0018950003790000757 ], [ 93.0, 0.0012600002520000504 ], [ 94.0, 0.0005600001120000224 ], [ 95.0, 0.0002600000520000104 ], [ 96.0, 0.0001150000230000046 ], [ 97.0, 8.00000160000032e-05 ], [ 98.0, 0.0002300000460000092 ], [ 99.0, 0.0002300000460000092 ], [ 100.0, 6.00000120000024e-05 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.502826064414131e-05 ], [ 2.0, 2.5047101073568846e-05 ], [ 3.0, 2.5047101073568846e-05 ], [ 4.0, 4.007536171771015e-05 ], [ 5.0, 4.007536171771015e-05 ], [ 6.0, 4.007536171771015e-05 ], [ 7.0, 3.005652128828262e-05 ], [ 8.0, 5.009420214713769e-05 ], [ 9.0, 0.00010018840429427538 ], [ 10.0, 8.516014365013407e-05 ], [ 11.0, 6.5122462791279e-05 ], [ 12.0, 0.00013525434579727177 ], [ 13.0, 0.00024045217030626095 ], [ 14.0, 0.0003105840533122537 ], [ 15.0, 0.00038071593631824646 ], [ 16.0, 0.0005911115853362248 ], [ 17.0, 0.0009067050588631923 ], [ 18.0, 0.00160802388892312 ], [ 19.0, 0.0027451622776631453 ], [ 20.0, 0.004202903560144852 ], [ 21.0, 0.006772736130293016 ], [ 22.0, 0.010675074477555042 ], [ 23.0, 0.016020125846654635 ], [ 24.0, 0.022732748934371085 ], [ 25.0, 0.03305215457668145 ], [ 26.0, 0.04665773987984405 ], [ 27.0, 0.0628682236946578 ], [ 28.0, 0.08559095378859946 ], [ 29.0, 0.11803696851930055 ], [ 30.0, 0.15943481717369512 ], [ 31.0, 0.21588096415308988 ], [ 32.0, 0.2893791775433703 ], [ 33.0, 0.38575541305424854 ], [ 34.0, 0.5142620698223008 ], [ 35.0, 0.6703255471914936 ], [ 36.0, 0.8523929248952655 ], [ 37.0, 1.060980173215732 ], [ 38.0, 1.2964680080892117 ], [ 39.0, 1.5410679783332557 ], [ 40.0, 1.7727386350031233 ], [ 41.0, 2.014162632831039 ], [ 42.0, 2.241845791009994 ], [ 43.0, 2.436045984473803 ], [ 44.0, 2.592905959657135 ], [ 45.0, 2.7153411991249543 ], [ 46.0, 2.812358640423316 ], [ 47.0, 2.862117211416068 ], [ 48.0, 2.908474386083029 ], [ 49.0, 2.986791661719864 ], [ 50.0, 3.069071388746538 ], [ 51.0, 3.1316941508506746 ], [ 52.0, 3.1993914556323166 ], [ 53.0, 3.2907181955667637 ], [ 54.0, 3.370628466831877 ], [ 55.0, 3.4562645054024093 ], [ 56.0, 3.481201399231254 ], [ 57.0, 3.4565901177163654 ], [ 58.0, 3.451495537358001 ], [ 59.0, 3.4766328079954354 ], [ 60.0, 3.484758087583701 ], [ 61.0, 3.3971082620868542 ], [ 62.0, 3.219945106773287 ], [ 63.0, 3.025243971288007 ], [ 64.0, 2.841743899402827 ], [ 65.0, 2.5898051285442274 ], [ 66.0, 2.3137910841337135 ], [ 67.0, 2.0702080261932565 ], [ 68.0, 1.8140563329340824 ], [ 69.0, 1.5397104254550682 ], [ 70.0, 1.2873608821388622 ], [ 71.0, 1.0584053312253694 ], [ 72.0, 0.8737781397918787 ], [ 73.0, 0.7313002100449896 ], [ 74.0, 0.6111843321365829 ], [ 75.0, 0.5100992416238737 ], [ 76.0, 0.4156065481137279 ], [ 77.0, 0.3431102187663902 ], [ 78.0, 0.2979903708924633 ], [ 79.0, 0.2526751556301625 ], [ 80.0, 0.21433806272695805 ], [ 81.0, 0.17638168576007182 ], [ 82.0, 0.13962256022450217 ], [ 83.0, 0.11268690772998624 ], [ 84.0, 0.08334172411219297 ], [ 85.0, 0.05876550853880722 ], [ 86.0, 0.044238189916137295 ], [ 87.0, 0.0328517777680929 ], [ 88.0, 0.02335391704099559 ], [ 89.0, 0.017167283075824085 ], [ 90.0, 0.01237326793034301 ], [ 91.0, 0.008626221609737111 ], [ 92.0, 0.006582378162133892 ], [ 93.0, 0.00537009847017316 ], [ 94.0, 0.0045485535549601025 ], [ 95.0, 0.004232960081433135 ], [ 96.0, 0.004433336890021685 ], [ 97.0, 0.005911115853362248 ], [ 98.0, 0.010354471583813361 ], [ 99.0, 0.024471017748876764 ], [ 100.0, 0.20600739690988906 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 9.992220556685592e-05 ], [ 2.0, 0.0003447316092056529 ], [ 3.0, 0.0008293543062049041 ], [ 4.0, 0.0008743192987099894 ], [ 5.0, 0.00045964214560753727 ], [ 6.0, 0.0002647938447521682 ], [ 7.0, 0.00017985997002034068 ], [ 8.0, 0.0001298988672369127 ], [ 9.0, 0.0001249027569585699 ], [ 10.0, 0.00014988330835028388 ], [ 11.0, 0.00015487941862862668 ], [ 12.0, 0.00016487163918531226 ], [ 13.0, 0.000244809403638797 ], [ 14.0, 0.0003996888222674237 ], [ 15.0, 0.0004696343661642228 ], [ 16.0, 0.0006045293436794783 ], [ 17.0, 0.0013939147676576401 ], [ 18.0, 0.0026129656755732827 ], [ 19.0, 0.004326631501044862 ], [ 20.0, 0.007104468815803456 ], [ 21.0, 0.011031411494580893 ], [ 22.0, 0.016487163918531226 ], [ 23.0, 0.023931368233261995 ], [ 24.0, 0.0336338143938037 ], [ 25.0, 0.046698642771670115 ], [ 26.0, 0.06418003263559156 ], [ 27.0, 0.08649765724894883 ], [ 28.0, 0.11826292639865234 ], [ 29.0, 0.16088474318319473 ], [ 30.0, 0.21622665673639788 ], [ 31.0, 0.28463339866746745 ], [ 32.0, 0.3746732981037613 ], [ 33.0, 0.4906729865463244 ], [ 34.0, 0.6391024268056105 ], [ 35.0, 0.8025002134588116 ], [ 36.0, 0.9820853974138434 ], [ 37.0, 1.2232376483288934 ], [ 38.0, 1.4873570181934854 ], [ 39.0, 1.7208252515004443 ], [ 40.0, 1.9471540432196515 ], [ 41.0, 2.1875119126004448 ], [ 42.0, 2.404657853628058 ], [ 43.0, 2.584003224289729 ], [ 44.0, 2.7190680695544485 ], [ 45.0, 2.847872788640404 ], [ 46.0, 2.9624785623153094 ], [ 47.0, 3.001912860742269 ], [ 48.0, 3.016366607777515 ], [ 49.0, 3.056270540570639 ], [ 50.0, 3.108629776287671 ], [ 51.0, 3.175842447862217 ], [ 52.0, 3.255465457368166 ], [ 53.0, 3.3165279171900717 ], [ 54.0, 3.4409910164441477 ], [ 55.0, 3.5591740050783462 ], [ 56.0, 3.5418924596255583 ], [ 57.0, 3.4919363529524086 ], [ 58.0, 3.4457023484366243 ], [ 59.0, 3.4168348232483603 ], [ 60.0, 3.422275587341475 ], [ 61.0, 3.312875760576603 ], [ 62.0, 3.092971966675345 ], [ 63.0, 2.888421219659434 ], [ 64.0, 2.676491217762411 ], [ 65.0, 2.4617683902197944 ], [ 66.0, 2.207071684340157 ], [ 67.0, 1.9021191051706694 ], [ 68.0, 1.646113418398106 ], [ 69.0, 1.387414828185516 ], [ 70.0, 1.1100407777524808 ], [ 71.0, 0.8936992104796809 ], [ 72.0, 0.7235466827301604 ], [ 73.0, 0.5827313145350687 ], [ 74.0, 0.48115040035580303 ], [ 75.0, 0.39906930459290924 ], [ 76.0, 0.3205054704659687 ], [ 77.0, 0.26050218602307174 ], [ 78.0, 0.2132189983488355 ], [ 79.0, 0.16928320456108897 ], [ 80.0, 0.13694837883965438 ], [ 81.0, 0.11012925886551025 ], [ 82.0, 0.08444925203482828 ], [ 83.0, 0.06271617232403712 ], [ 84.0, 0.04446038536697254 ], [ 85.0, 0.03323412557153628 ], [ 86.0, 0.025914824013764083 ], [ 87.0, 0.01906515682215611 ], [ 88.0, 0.013424548317907093 ], [ 89.0, 0.009617512285809883 ], [ 90.0, 0.0072993171166588254 ], [ 91.0, 0.005245915792259936 ], [ 92.0, 0.003767067149870468 ], [ 93.0, 0.0027328723222535094 ], [ 94.0, 0.0017336502665849505 ], [ 95.0, 0.0012040625770806139 ], [ 96.0, 0.0008193620856482187 ], [ 97.0, 0.0006544904464629063 ], [ 98.0, 0.0006444982259062207 ], [ 99.0, 0.00040968104282410934 ], [ 100.0, 0.00010991442612354151 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.5008150175953053e-05 ], [ 2.0, 2.0010866901270736e-05 ], [ 3.0, 2.501358362658842e-05 ], [ 4.0, 3.501901707722378e-05 ], [ 5.0, 1.5008150175953053e-05 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 1.0005433450635368e-05 ], [ 9.0, 1.0005433450635368e-05 ], [ 10.0, 1.0005433450635368e-05 ], [ 11.0, 2.0010866901270736e-05 ], [ 12.0, 5.502988397849452e-05 ], [ 13.0, 0.00011005976795698904 ], [ 14.0, 0.00017509508538611894 ], [ 15.0, 0.00023512768608993117 ], [ 16.0, 0.0004052200547507324 ], [ 17.0, 0.0007404020753470172 ], [ 18.0, 0.0014207715499902221 ], [ 19.0, 0.0024813474957575713 ], [ 20.0, 0.0038821081788465227 ], [ 21.0, 0.006443499142209176 ], [ 22.0, 0.01036562905485824 ], [ 23.0, 0.015678514217145622 ], [ 24.0, 0.022382154629071317 ], [ 25.0, 0.032752786400654876 ], [ 26.0, 0.04647023566147596 ], [ 27.0, 0.06286914108706733 ], [ 28.0, 0.08579659183919827 ], [ 29.0, 0.11850935650605061 ], [ 30.0, 0.16074229110118252 ], [ 31.0, 0.21792334327156362 ], [ 32.0, 0.29216365947527806 ], [ 33.0, 0.38946149706598165 ], [ 34.0, 0.5188867814666754 ], [ 35.0, 0.676747507734075 ], [ 36.0, 0.8600470485497148 ], [ 37.0, 1.0705963873681603 ], [ 38.0, 1.3078352199161754 ], [ 39.0, 1.5533835649449432 ], [ 40.0, 1.7852794960303193 ], [ 41.0, 2.025875151501023 ], [ 42.0, 2.2535337815200545 ], [ 43.0, 2.445868228741618 ], [ 44.0, 2.6012576129467107 ], [ 45.0, 2.722753591337776 ], [ 46.0, 2.8158741604628394 ], [ 47.0, 2.862914705831001 ], [ 48.0, 2.9077940775738265 ], [ 49.0, 2.987037110502859 ], [ 50.0, 3.067966058968323 ], [ 51.0, 3.1253021953571887 ], [ 52.0, 3.189742189496006 ], [ 53.0, 3.2779250772131805 ], [ 54.0, 3.356727871070385 ], [ 55.0, 3.441273783728253 ], [ 56.0, 3.4635058568555657 ], [ 57.0, 3.435875852381636 ], [ 58.0, 3.427386242098772 ], [ 59.0, 3.4516444154998367 ], [ 60.0, 3.4627554493467674 ], [ 61.0, 3.3795302539043828 ], [ 62.0, 3.20760188820539 ], [ 63.0, 3.017563687960747 ], [ 64.0, 2.8389066682662016 ], [ 65.0, 2.5916573995508263 ], [ 66.0, 2.3201399520009343 ], [ 67.0, 2.082505904831619 ], [ 68.0, 1.8305240660940925 ], [ 69.0, 1.5553996597852464 ], [ 70.0, 1.2999759519407013 ], [ 71.0, 1.0710416291567135 ], [ 72.0, 0.8861362162722467 ], [ 73.0, 0.7421380180507025 ], [ 74.0, 0.6233735229916606 ], [ 75.0, 0.5226638325942903 ], [ 76.0, 0.4257061797409083 ], [ 77.0, 0.3516209477556787 ], [ 78.0, 0.30523575827853316 ], [ 79.0, 0.25903066660349905 ], [ 80.0, 0.22025460926556167 ], [ 81.0, 0.18156359811195472 ], [ 82.0, 0.14374806238527832 ], [ 83.0, 0.11549271832068406 ], [ 84.0, 0.0852913174499412 ], [ 85.0, 0.06020269307247301 ], [ 86.0, 0.045359632548455445 ], [ 87.0, 0.03347818032582594 ], [ 88.0, 0.0235377821926197 ], [ 89.0, 0.01731940530304982 ], [ 90.0, 0.012626857014701835 ], [ 91.0, 0.008609675484271734 ], [ 92.0, 0.00591821388605082 ], [ 93.0, 0.004292330950322573 ], [ 94.0, 0.0032017387042033176 ], [ 95.0, 0.0027214778985728202 ], [ 96.0, 0.002546382813186701 ], [ 97.0, 0.0029115811341348923 ], [ 98.0, 0.004542466786588457 ], [ 99.0, 0.010660789341651985 ], [ 100.0, 0.13795491641736046 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.50000030000006e-05 ], [ 3.0, 3.00000060000012e-05 ], [ 4.0, 4.5000009000001796e-05 ], [ 5.0, 3.50000070000014e-05 ], [ 6.0, 2.00000040000008e-05 ], [ 7.0, 3.50000070000014e-05 ], [ 8.0, 4.5000009000001796e-05 ], [ 9.0, 3.00000060000012e-05 ], [ 10.0, 1.00000020000004e-05 ], [ 11.0, 4.5000009000001796e-05 ], [ 12.0, 5.50000110000022e-05 ], [ 13.0, 6.00000120000024e-05 ], [ 14.0, 0.0001150000230000046 ], [ 15.0, 0.0002200000440000088 ], [ 16.0, 0.0004600000920000184 ], [ 17.0, 0.0009650001930000385 ], [ 18.0, 0.001970000394000079 ], [ 19.0, 0.00374500074900015 ], [ 20.0, 0.00600500120100024 ], [ 21.0, 0.009225001845000368 ], [ 22.0, 0.014580002916000584 ], [ 23.0, 0.021375004275000855 ], [ 24.0, 0.0300200060040012 ], [ 25.0, 0.04142000828400166 ], [ 26.0, 0.057770011554002305 ], [ 27.0, 0.08261001652200331 ], [ 28.0, 0.11563002312600464 ], [ 29.0, 0.15470503094100618 ], [ 30.0, 0.20794504158900834 ], [ 31.0, 0.2801900560380112 ], [ 32.0, 0.3723800744760149 ], [ 33.0, 0.48849009769801954 ], [ 34.0, 0.6464051292810259 ], [ 35.0, 0.8173601634720328 ], [ 36.0, 0.9992151998430401 ], [ 37.0, 1.2489902497980498 ], [ 38.0, 1.522495304499061 ], [ 39.0, 1.7720953544190707 ], [ 40.0, 2.0130754026150806 ], [ 41.0, 2.24667044933409 ], [ 42.0, 2.4608254921650983 ], [ 43.0, 2.6639755327951065 ], [ 44.0, 2.8320505664101137 ], [ 45.0, 2.965540593108119 ], [ 46.0, 3.070885614177123 ], [ 47.0, 3.124820624964125 ], [ 48.0, 3.1386556277311253 ], [ 49.0, 3.171965634393127 ], [ 50.0, 3.2338006467601295 ], [ 51.0, 3.3199256639851327 ], [ 52.0, 3.4072456814491363 ], [ 53.0, 3.4414456882891375 ], [ 54.0, 3.5176707035341406 ], [ 55.0, 3.596730719346144 ], [ 56.0, 3.5624207124841427 ], [ 57.0, 3.4724956944991394 ], [ 58.0, 3.4049706809941362 ], [ 59.0, 3.351405670281134 ], [ 60.0, 3.3227706645541333 ], [ 61.0, 3.201635640327128 ], [ 62.0, 2.945855589171118 ], [ 63.0, 2.716030543206109 ], [ 64.0, 2.4874104974820996 ], [ 65.0, 2.25650045130009 ], [ 66.0, 1.9905403981080796 ], [ 67.0, 1.6858603371720675 ], [ 68.0, 1.4571652914330582 ], [ 69.0, 1.225160245032049 ], [ 70.0, 0.973140194628039 ], [ 71.0, 0.7796101559220312 ], [ 72.0, 0.6294001258800251 ], [ 73.0, 0.5085651017130204 ], [ 74.0, 0.41654008330801673 ], [ 75.0, 0.3560100712020143 ], [ 76.0, 0.3514850702970141 ], [ 77.0, 0.30358506071701213 ], [ 78.0, 0.23734004746800952 ], [ 79.0, 0.19887003977400794 ], [ 80.0, 0.14626002925200585 ], [ 81.0, 0.13862002772400556 ], [ 82.0, 0.1577100315420063 ], [ 83.0, 0.13300002660000532 ], [ 84.0, 0.09872501974500394 ], [ 85.0, 0.09047001809400362 ], [ 86.0, 0.09148001829600366 ], [ 87.0, 0.07205501441100289 ], [ 88.0, 0.03682500736500147 ], [ 89.0, 0.030350006070001212 ], [ 90.0, 0.023605004721000945 ], [ 91.0, 0.01893500378700076 ], [ 92.0, 0.014395002879000576 ], [ 93.0, 0.007180001436000287 ], [ 94.0, 0.0020700004140000827 ], [ 95.0, 0.0006550001310000261 ], [ 96.0, 0.0002850000570000114 ], [ 97.0, 0.000125000025000005 ], [ 98.0, 0.0001700000340000068 ], [ 99.0, 0.0001700000340000068 ], [ 100.0, 5.50000110000022e-05 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 1.502878161967985e-05 ], [ 7.0, 5.009593873226616e-05 ], [ 8.0, 6.512472035194602e-05 ], [ 9.0, 6.01151264787194e-05 ], [ 10.0, 0.00011522065908421217 ], [ 11.0, 0.00011522065908421217 ], [ 12.0, 0.00011021106521098556 ], [ 13.0, 0.0001803453794361582 ], [ 14.0, 0.00027051806915423727 ], [ 15.0, 0.0004709018240833019 ], [ 16.0, 0.0007814966442233521 ], [ 17.0, 0.0012223409050672943 ], [ 18.0, 0.0020439143002764595 ], [ 19.0, 0.0032462168298508474 ], [ 20.0, 0.0048492868692833644 ], [ 21.0, 0.007714774564768988 ], [ 22.0, 0.012233428238419398 ], [ 23.0, 0.018340123169882643 ], [ 24.0, 0.026235243114087793 ], [ 25.0, 0.03661512161941334 ], [ 26.0, 0.051673960802332546 ], [ 27.0, 0.0719728351766468 ], [ 28.0, 0.09692061266531535 ], [ 29.0, 0.1313365225743822 ], [ 30.0, 0.1783164939175014 ], [ 31.0, 0.23814607354544687 ], [ 32.0, 0.3154140494460942 ], [ 33.0, 0.4219580919418779 ], [ 34.0, 0.5576429419982207 ], [ 35.0, 0.7240115545280766 ], [ 36.0, 0.9168107843330763 ], [ 37.0, 1.1345828395961104 ], [ 38.0, 1.3785600804099931 ], [ 39.0, 1.6306027673597705 ], [ 40.0, 1.8672209147738834 ], [ 41.0, 2.1088135889041104 ], [ 42.0, 2.340747766046756 ], [ 43.0, 2.5363523684207627 ], [ 44.0, 2.693864018982754 ], [ 45.0, 2.8179616784103234 ], [ 46.0, 2.911059970950367 ], [ 47.0, 2.9665161751269857 ], [ 48.0, 3.0084013895010333 ], [ 49.0, 3.0733908508184022 ], [ 50.0, 3.1521967720381303 ], [ 51.0, 3.2147816282963504 ], [ 52.0, 3.2805876534150555 ], [ 53.0, 3.3565330965331706 ], [ 54.0, 3.4163927337243556 ], [ 55.0, 3.4720142544987906 ], [ 56.0, 3.481772943363836 ], [ 57.0, 3.4394518943228176 ], [ 58.0, 3.393258429217795 ], [ 59.0, 3.3817413729032473 ], [ 60.0, 3.3686412849247596 ], [ 61.0, 3.2639057058172103 ], [ 62.0, 3.0638726224592716 ], [ 63.0, 2.8349592304221813 ], [ 64.0, 2.6229582273011043 ], [ 65.0, 2.3643479627835267 ], [ 66.0, 2.0761660656322922 ], [ 67.0, 1.837524042293396 ], [ 68.0, 1.6128587858608021 ], [ 69.0, 1.3660110477575604 ], [ 70.0, 1.1368571952145554 ], [ 71.0, 0.9325108515317685 ], [ 72.0, 0.7687021414711314 ], [ 73.0, 0.6473397202983433 ], [ 74.0, 0.5538707178116812 ], [ 75.0, 0.4634575675876872 ], [ 76.0, 0.37760314778832943 ], [ 77.0, 0.3245415294831131 ], [ 78.0, 0.2896196505928504 ], [ 79.0, 0.2517471209112571 ], [ 80.0, 0.21595357268705295 ], [ 81.0, 0.1976234687049168 ], [ 82.0, 0.19189750290781876 ], [ 83.0, 0.16774124125112003 ], [ 84.0, 0.14078962621316082 ], [ 85.0, 0.14474720537300984 ], [ 86.0, 0.13435730767993787 ], [ 87.0, 0.09978109076692775 ], [ 88.0, 0.07996814699831647 ], [ 89.0, 0.0768271316398034 ], [ 90.0, 0.08342977636471607 ], [ 91.0, 0.08234770408809912 ], [ 92.0, 0.05146856745353026 ], [ 93.0, 0.018365171139248775 ], [ 94.0, 0.009262739071596013 ], [ 95.0, 0.007399170150755713 ], [ 96.0, 0.007178748020333742 ], [ 97.0, 0.009042316941174043 ], [ 98.0, 0.01344074036186701 ], [ 99.0, 0.025659139818666733 ], [ 100.0, 0.2094811774028442 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.4927946534066693e-05 ], [ 3.0, 2.9855893068133386e-05 ], [ 4.0, 4.478383960220008e-05 ], [ 5.0, 3.483187524615562e-05 ], [ 6.0, 1.9903928712088924e-05 ], [ 7.0, 3.483187524615562e-05 ], [ 8.0, 4.478383960220008e-05 ], [ 9.0, 2.9855893068133386e-05 ], [ 10.0, 9.951964356044462e-06 ], [ 11.0, 4.478383960220008e-05 ], [ 12.0, 5.4735803958244545e-05 ], [ 13.0, 6.468776831428901e-05 ], [ 14.0, 0.00012439955445055578 ], [ 15.0, 0.00021894321583297818 ], [ 16.0, 0.0004428624138439786 ], [ 17.0, 0.0009504125960022461 ], [ 18.0, 0.001965512960318781 ], [ 19.0, 0.0037120827048045843 ], [ 20.0, 0.005951274684914588 ], [ 21.0, 0.00912097533231475 ], [ 22.0, 0.014430348316264472 ], [ 23.0, 0.02121261202490877 ], [ 24.0, 0.029850917085955362 ], [ 25.0, 0.04122103636273616 ], [ 26.0, 0.05757708978189524 ], [ 27.0, 0.08247192861854045 ], [ 28.0, 0.11574632144297511 ], [ 29.0, 0.15495208502361227 ], [ 30.0, 0.20845882138388533 ], [ 31.0, 0.2817152310087286 ], [ 32.0, 0.37465165014764984 ], [ 33.0, 0.49118417677475246 ], [ 34.0, 0.6494054820893254 ], [ 35.0, 0.8222163671498594 ], [ 36.0, 1.0065267470238028 ], [ 37.0, 1.2577740391565013 ], [ 38.0, 1.5297910809002646 ], [ 39.0, 1.7789285565894815 ], [ 40.0, 2.020701578655226 ], [ 41.0, 2.251467728143185 ], [ 42.0, 2.4647532522397517 ], [ 43.0, 2.6669174561684392 ], [ 44.0, 2.829686809193724 ], [ 45.0, 2.9572361603629678 ], [ 46.0, 3.0572981859808173 ], [ 47.0, 3.1092474399193692 ], [ 48.0, 3.1234339651089105 ], [ 49.0, 3.1570666286501625 ], [ 50.0, 3.2122452950222513 ], [ 51.0, 3.2915524989755696 ], [ 52.0, 3.3772687679741806 ], [ 53.0, 3.4065922309492658 ], [ 54.0, 3.4803910226315136 ], [ 55.0, 3.5573595149611617 ], [ 56.0, 3.5214030677427726 ], [ 57.0, 3.430422209599814 ], [ 58.0, 3.3583202278402715 ], [ 59.0, 3.3028230986087896 ], [ 60.0, 3.2816005346195256 ], [ 61.0, 3.170103701956581 ], [ 62.0, 2.925205763083039 ], [ 63.0, 2.7039586675016363 ], [ 64.0, 2.483960543446918 ], [ 65.0, 2.263320517691234 ], [ 66.0, 2.004176341842014 ], [ 67.0, 1.706463328130944 ], [ 68.0, 1.4793395975972972 ], [ 69.0, 1.2463740639866523 ], [ 70.0, 0.9931712108579911 ], [ 71.0, 0.7982520369805044 ], [ 72.0, 0.6451858492023625 ], [ 73.0, 0.5190994367934572 ], [ 74.0, 0.4270089346247998 ], [ 75.0, 0.36986475529239243 ], [ 76.0, 0.3640627600728185 ], [ 77.0, 0.31491000811831493 ], [ 78.0, 0.24848064604171813 ], [ 79.0, 0.2085185331700216 ], [ 80.0, 0.1560567530671332 ], [ 81.0, 0.1494984085564999 ], [ 82.0, 0.16725271296768324 ], [ 83.0, 0.14198467546768637 ], [ 84.0, 0.11229298981142768 ], [ 85.0, 0.10875506648285388 ], [ 86.0, 0.10991944631251109 ], [ 87.0, 0.0905379957291145 ], [ 88.0, 0.05895046086302937 ], [ 89.0, 0.055208522265156657 ], [ 90.0, 0.047998324089202446 ], [ 91.0, 0.041539499222129586 ], [ 92.0, 0.032189628709625814 ], [ 93.0, 0.019371498619040545 ], [ 94.0, 0.011225815793618152 ], [ 95.0, 0.008289986308585037 ], [ 96.0, 0.007070870674969591 ], [ 97.0, 0.0051202856611848755 ], [ 98.0, 0.0038414582414331624 ], [ 99.0, 0.0020998644791253816 ], [ 100.0, 0.0005224781286923343 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 4.982589586337939e-06 ], [ 7.0, 4.982589586337939e-06 ], [ 8.0, 0.0 ], [ 9.0, 4.982589586337939e-06 ], [ 10.0, 1.9930358345351755e-05 ], [ 11.0, 1.9930358345351755e-05 ], [ 12.0, 1.9930358345351755e-05 ], [ 13.0, 4.982589586337938e-05 ], [ 14.0, 0.00013951250841746227 ], [ 15.0, 0.00028899019600760043 ], [ 16.0, 0.0005480848544971732 ], [ 17.0, 0.0010114656860266016 ], [ 18.0, 0.0017837670719089821 ], [ 19.0, 0.0029596582142847353 ], [ 20.0, 0.004598930188189918 ], [ 21.0, 0.0073841977669528245 ], [ 22.0, 0.01186852839465697 ], [ 23.0, 0.01800209617543897 ], [ 24.0, 0.02593936138647531 ], [ 25.0, 0.036333043263576247 ], [ 26.0, 0.05140537676224851 ], [ 27.0, 0.07192866326837448 ], [ 28.0, 0.0973049920315936 ], [ 29.0, 0.13201869367961003 ], [ 30.0, 0.17967218048334607 ], [ 31.0, 0.24069893773681317 ], [ 32.0, 0.3189853853173548 ], [ 33.0, 0.42647977305300955 ], [ 34.0, 0.5630126928978417 ], [ 35.0, 0.7315338378869635 ], [ 36.0, 0.9272649046070768 ], [ 37.0, 1.147749476392117 ], [ 38.0, 1.3918216272788808 ], [ 39.0, 1.6444688148437323 ], [ 40.0, 1.882935552445866 ], [ 41.0, 2.123101353096941 ], [ 42.0, 2.354283544723849 ], [ 43.0, 2.549117745318421 ], [ 44.0, 2.702840599236119 ], [ 45.0, 2.8205443130341803 ], [ 46.0, 2.9077894566909577 ], [ 47.0, 2.961287521079468 ], [ 48.0, 3.003026674044221 ], [ 49.0, 3.068657344075464 ], [ 50.0, 3.141966184659254 ], [ 51.0, 3.1982843947536326 ], [ 52.0, 3.260840807010105 ], [ 53.0, 3.330771451854358 ], [ 54.0, 3.389909807654603 ], [ 55.0, 3.4428548045990297 ], [ 56.0, 3.4487791036171855 ], [ 57.0, 3.404284578611188 ], [ 58.0, 3.352884184438526 ], [ 59.0, 3.341847748504787 ], [ 60.0, 3.333432154693462 ], [ 61.0, 3.234936323750734 ], [ 62.0, 3.0425037313367764 ], [ 63.0, 2.8196972728045027 ], [ 64.0, 2.617174936478211 ], [ 65.0, 2.367283120954604 ], [ 66.0, 2.084077711456742 ], [ 67.0, 1.8513359692893108 ], [ 68.0, 1.6289231353343578 ], [ 69.0, 1.3803915667678215 ], [ 70.0, 1.1494236264931263 ], [ 71.0, 0.9454264436492785 ], [ 72.0, 0.7806821015666009 ], [ 73.0, 0.6541093783048582 ], [ 74.0, 0.5599284699438986 ], [ 75.0, 0.47370973974190683 ], [ 76.0, 0.3891153337450613 ], [ 77.0, 0.33431681347451664 ], [ 78.0, 0.2972812250792668 ], [ 79.0, 0.25855155622466197 ], [ 80.0, 0.2235040210743609 ], [ 81.0, 0.20552185525726732 ], [ 82.0, 0.19793337131727462 ], [ 83.0, 0.17311509258772534 ], [ 84.0, 0.1491289063190945 ], [ 85.0, 0.1567572509757779 ], [ 86.0, 0.1475245124722937 ], [ 87.0, 0.11406642340003442 ], [ 88.0, 0.09802248493202625 ], [ 89.0, 0.0975142607942198 ], [ 90.0, 0.10362291562707011 ], [ 91.0, 0.1011266382443148 ], [ 92.0, 0.06627342408788092 ], [ 93.0, 0.028191491879500055 ], [ 94.0, 0.01621832910352999 ], [ 95.0, 0.012725533803507097 ], [ 96.0, 0.011469921227749934 ], [ 97.0, 0.010558107333450093 ], [ 98.0, 0.010717550200212906 ], [ 99.0, 0.013811738333328766 ], [ 100.0, 0.13856083380647172 ] ], "color": "#5cb85c", "marker": {} } ] }, { "label": "Counts", "uid": "fastqc_per_sequence_gc_content_plot_Counts", "dconfig": { "name": "Counts", "ylab": "Count", "tt_suffix": "", "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "% GC", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 10.5 ], [ 2.0, 35.0 ], [ 3.0, 83.0 ], [ 4.0, 88.0 ], [ 5.0, 46.5 ], [ 6.0, 26.5 ], [ 7.0, 19.0 ], [ 8.0, 13.5 ], [ 9.0, 12.0 ], [ 10.0, 15.5 ], [ 11.0, 16.0 ], [ 12.0, 17.0 ], [ 13.0, 25.0 ], [ 14.0, 39.5 ], [ 15.0, 47.0 ], [ 16.0, 63.0 ], [ 17.0, 144.0 ], [ 18.0, 266.0 ], [ 19.0, 437.5 ], [ 20.0, 716.5 ], [ 21.0, 1113.5 ], [ 22.0, 1664.0 ], [ 23.0, 2410.5 ], [ 24.0, 3382.0 ], [ 25.0, 4700.5 ], [ 26.0, 6449.5 ], [ 27.0, 8665.0 ], [ 28.0, 11839.0 ], [ 29.0, 16079.0 ], [ 30.0, 21548.5 ], [ 31.0, 28338.5 ], [ 32.0, 37298.5 ], [ 33.0, 48862.5 ], [ 34.0, 63659.5 ], [ 35.0, 79878.5 ], [ 36.0, 97764.0 ], [ 37.0, 121718.5 ], [ 38.0, 148043.5 ], [ 39.0, 171449.5 ], [ 40.0, 194168.5 ], [ 41.0, 218286.5 ], [ 42.0, 240069.0 ], [ 43.0, 258206.0 ], [ 44.0, 271926.0 ], [ 45.0, 284897.5 ], [ 46.0, 296769.0 ], [ 47.0, 301029.0 ], [ 48.0, 302420.0 ], [ 49.0, 306351.0 ], [ 50.0, 311815.5 ], [ 51.0, 319019.5 ], [ 52.0, 327307.0 ], [ 53.0, 333719.0 ], [ 54.0, 346416.5 ], [ 55.0, 358432.0 ], [ 56.0, 356878.5 ], [ 57.0, 351915.0 ], [ 58.0, 347645.0 ], [ 59.0, 345049.0 ], [ 60.0, 345188.0 ], [ 61.0, 333382.0 ], [ 62.0, 310625.5 ], [ 63.0, 289694.0 ], [ 64.0, 267886.5 ], [ 65.0, 245818.5 ], [ 66.0, 219808.0 ], [ 67.0, 188672.0 ], [ 68.0, 162705.5 ], [ 69.0, 136879.5 ], [ 70.0, 109184.0 ], [ 71.0, 87567.5 ], [ 72.0, 70704.0 ], [ 73.0, 56784.5 ], [ 74.0, 46485.0 ], [ 75.0, 38187.5 ], [ 76.0, 30592.5 ], [ 77.0, 24781.0 ], [ 78.0, 20177.5 ], [ 79.0, 15941.0 ], [ 80.0, 12773.0 ], [ 81.0, 10176.5 ], [ 82.0, 7701.0 ], [ 83.0, 5628.0 ], [ 84.0, 3884.0 ], [ 85.0, 2853.0 ], [ 86.0, 2176.5 ], [ 87.0, 1544.0 ], [ 88.0, 1051.0 ], [ 89.0, 673.0 ], [ 90.0, 428.0 ], [ 91.0, 272.0 ], [ 92.0, 189.5 ], [ 93.0, 126.0 ], [ 94.0, 56.0 ], [ 95.0, 26.0 ], [ 96.0, 11.5 ], [ 97.0, 8.0 ], [ 98.0, 23.0 ], [ 99.0, 23.0 ], [ 100.0, 6.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.5 ], [ 2.0, 2.5 ], [ 3.0, 2.5 ], [ 4.0, 4.0 ], [ 5.0, 4.0 ], [ 6.0, 4.0 ], [ 7.0, 3.0 ], [ 8.0, 5.0 ], [ 9.0, 10.0 ], [ 10.0, 8.5 ], [ 11.0, 6.5 ], [ 12.0, 13.5 ], [ 13.0, 24.0 ], [ 14.0, 31.0 ], [ 15.0, 38.0 ], [ 16.0, 59.0 ], [ 17.0, 90.5 ], [ 18.0, 160.5 ], [ 19.0, 274.0 ], [ 20.0, 419.5 ], [ 21.0, 676.0 ], [ 22.0, 1065.5 ], [ 23.0, 1599.0 ], [ 24.0, 2269.0 ], [ 25.0, 3299.0 ], [ 26.0, 4657.0 ], [ 27.0, 6275.0 ], [ 28.0, 8543.0 ], [ 29.0, 11781.5 ], [ 30.0, 15913.5 ], [ 31.0, 21547.5 ], [ 32.0, 28883.5 ], [ 33.0, 38503.0 ], [ 34.0, 51329.5 ], [ 35.0, 66906.5 ], [ 36.0, 85079.0 ], [ 37.0, 105898.5 ], [ 38.0, 129403.0 ], [ 39.0, 153817.0 ], [ 40.0, 176940.5 ], [ 41.0, 201037.5 ], [ 42.0, 223763.0 ], [ 43.0, 243146.5 ], [ 44.0, 258803.0 ], [ 45.0, 271023.5 ], [ 46.0, 280707.0 ], [ 47.0, 285673.5 ], [ 48.0, 290300.5 ], [ 49.0, 298117.5 ], [ 50.0, 306330.0 ], [ 51.0, 312580.5 ], [ 52.0, 319337.5 ], [ 53.0, 328453.0 ], [ 54.0, 336429.0 ], [ 55.0, 344976.5 ], [ 56.0, 347465.5 ], [ 57.0, 345009.0 ], [ 58.0, 344500.5 ], [ 59.0, 347009.5 ], [ 60.0, 347820.5 ], [ 61.0, 339072.0 ], [ 62.0, 321389.0 ], [ 63.0, 301955.5 ], [ 64.0, 283640.0 ], [ 65.0, 258493.5 ], [ 66.0, 230944.0 ], [ 67.0, 206631.5 ], [ 68.0, 181064.5 ], [ 69.0, 153681.5 ], [ 70.0, 128494.0 ], [ 71.0, 105641.5 ], [ 72.0, 87213.5 ], [ 73.0, 72992.5 ], [ 74.0, 61003.5 ], [ 75.0, 50914.0 ], [ 76.0, 41482.5 ], [ 77.0, 34246.5 ], [ 78.0, 29743.0 ], [ 79.0, 25220.0 ], [ 80.0, 21393.5 ], [ 81.0, 17605.0 ], [ 82.0, 13936.0 ], [ 83.0, 11247.5 ], [ 84.0, 8318.5 ], [ 85.0, 5865.5 ], [ 86.0, 4415.5 ], [ 87.0, 3279.0 ], [ 88.0, 2331.0 ], [ 89.0, 1713.5 ], [ 90.0, 1235.0 ], [ 91.0, 861.0 ], [ 92.0, 657.0 ], [ 93.0, 536.0 ], [ 94.0, 454.0 ], [ 95.0, 422.5 ], [ 96.0, 442.5 ], [ 97.0, 590.0 ], [ 98.0, 1033.5 ], [ 99.0, 2442.5 ], [ 100.0, 20562.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 10.0 ], [ 2.0, 34.5 ], [ 3.0, 83.0 ], [ 4.0, 87.5 ], [ 5.0, 46.0 ], [ 6.0, 26.5 ], [ 7.0, 18.0 ], [ 8.0, 13.0 ], [ 9.0, 12.5 ], [ 10.0, 15.0 ], [ 11.0, 15.5 ], [ 12.0, 16.5 ], [ 13.0, 24.5 ], [ 14.0, 40.0 ], [ 15.0, 47.0 ], [ 16.0, 60.5 ], [ 17.0, 139.5 ], [ 18.0, 261.5 ], [ 19.0, 433.0 ], [ 20.0, 711.0 ], [ 21.0, 1104.0 ], [ 22.0, 1650.0 ], [ 23.0, 2395.0 ], [ 24.0, 3366.0 ], [ 25.0, 4673.5 ], [ 26.0, 6423.0 ], [ 27.0, 8656.5 ], [ 28.0, 11835.5 ], [ 29.0, 16101.0 ], [ 30.0, 21639.5 ], [ 31.0, 28485.5 ], [ 32.0, 37496.5 ], [ 33.0, 49105.5 ], [ 34.0, 63960.0 ], [ 35.0, 80312.5 ], [ 36.0, 98285.0 ], [ 37.0, 122419.0 ], [ 38.0, 148851.5 ], [ 39.0, 172216.5 ], [ 40.0, 194867.0 ], [ 41.0, 218921.5 ], [ 42.0, 240653.0 ], [ 43.0, 258601.5 ], [ 44.0, 272118.5 ], [ 45.0, 285009.0 ], [ 46.0, 296478.5 ], [ 47.0, 300425.0 ], [ 48.0, 301871.5 ], [ 49.0, 305865.0 ], [ 50.0, 311105.0 ], [ 51.0, 317831.5 ], [ 52.0, 325800.0 ], [ 53.0, 331911.0 ], [ 54.0, 344367.0 ], [ 55.0, 356194.5 ], [ 56.0, 354465.0 ], [ 57.0, 349465.5 ], [ 58.0, 344838.5 ], [ 59.0, 341949.5 ], [ 60.0, 342494.0 ], [ 61.0, 331545.5 ], [ 62.0, 309538.0 ], [ 63.0, 289067.0 ], [ 64.0, 267857.5 ], [ 65.0, 246368.5 ], [ 66.0, 220879.0 ], [ 67.0, 190360.0 ], [ 68.0, 164739.5 ], [ 69.0, 138849.5 ], [ 70.0, 111090.5 ], [ 71.0, 89439.5 ], [ 72.0, 72411.0 ], [ 73.0, 58318.5 ], [ 74.0, 48152.5 ], [ 75.0, 39938.0 ], [ 76.0, 32075.5 ], [ 77.0, 26070.5 ], [ 78.0, 21338.5 ], [ 79.0, 16941.5 ], [ 80.0, 13705.5 ], [ 81.0, 11021.5 ], [ 82.0, 8451.5 ], [ 83.0, 6276.5 ], [ 84.0, 4449.5 ], [ 85.0, 3326.0 ], [ 86.0, 2593.5 ], [ 87.0, 1908.0 ], [ 88.0, 1343.5 ], [ 89.0, 962.5 ], [ 90.0, 730.5 ], [ 91.0, 525.0 ], [ 92.0, 377.0 ], [ 93.0, 273.5 ], [ 94.0, 173.5 ], [ 95.0, 120.5 ], [ 96.0, 82.0 ], [ 97.0, 65.5 ], [ 98.0, 64.5 ], [ 99.0, 41.0 ], [ 100.0, 11.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.5 ], [ 2.0, 2.0 ], [ 3.0, 2.5 ], [ 4.0, 3.5 ], [ 5.0, 1.5 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 1.0 ], [ 9.0, 1.0 ], [ 10.0, 1.0 ], [ 11.0, 2.0 ], [ 12.0, 5.5 ], [ 13.0, 11.0 ], [ 14.0, 17.5 ], [ 15.0, 23.5 ], [ 16.0, 40.5 ], [ 17.0, 74.0 ], [ 18.0, 142.0 ], [ 19.0, 248.0 ], [ 20.0, 388.0 ], [ 21.0, 644.0 ], [ 22.0, 1036.0 ], [ 23.0, 1567.0 ], [ 24.0, 2237.0 ], [ 25.0, 3273.5 ], [ 26.0, 4644.5 ], [ 27.0, 6283.5 ], [ 28.0, 8575.0 ], [ 29.0, 11844.5 ], [ 30.0, 16065.5 ], [ 31.0, 21780.5 ], [ 32.0, 29200.5 ], [ 33.0, 38925.0 ], [ 34.0, 51860.5 ], [ 35.0, 67638.0 ], [ 36.0, 85958.0 ], [ 37.0, 107001.5 ], [ 38.0, 130712.5 ], [ 39.0, 155254.0 ], [ 40.0, 178431.0 ], [ 41.0, 202477.5 ], [ 42.0, 225231.0 ], [ 43.0, 244454.0 ], [ 44.0, 259984.5 ], [ 45.0, 272127.5 ], [ 46.0, 281434.5 ], [ 47.0, 286136.0 ], [ 48.0, 290621.5 ], [ 49.0, 298541.5 ], [ 50.0, 306630.0 ], [ 51.0, 312360.5 ], [ 52.0, 318801.0 ], [ 53.0, 327614.5 ], [ 54.0, 335490.5 ], [ 55.0, 343940.5 ], [ 56.0, 346162.5 ], [ 57.0, 343401.0 ], [ 58.0, 342552.5 ], [ 59.0, 344977.0 ], [ 60.0, 346087.5 ], [ 61.0, 337769.5 ], [ 62.0, 320586.0 ], [ 63.0, 301592.5 ], [ 64.0, 283736.5 ], [ 65.0, 259025.0 ], [ 66.0, 231888.0 ], [ 67.0, 208137.5 ], [ 68.0, 182953.0 ], [ 69.0, 155455.5 ], [ 70.0, 129927.0 ], [ 71.0, 107046.0 ], [ 72.0, 88565.5 ], [ 73.0, 74173.5 ], [ 74.0, 62303.5 ], [ 75.0, 52238.0 ], [ 76.0, 42547.5 ], [ 77.0, 35143.0 ], [ 78.0, 30507.0 ], [ 79.0, 25889.0 ], [ 80.0, 22013.5 ], [ 81.0, 18146.5 ], [ 82.0, 14367.0 ], [ 83.0, 11543.0 ], [ 84.0, 8524.5 ], [ 85.0, 6017.0 ], [ 86.0, 4533.5 ], [ 87.0, 3346.0 ], [ 88.0, 2352.5 ], [ 89.0, 1731.0 ], [ 90.0, 1262.0 ], [ 91.0, 860.5 ], [ 92.0, 591.5 ], [ 93.0, 429.0 ], [ 94.0, 320.0 ], [ 95.0, 272.0 ], [ 96.0, 254.5 ], [ 97.0, 291.0 ], [ 98.0, 454.0 ], [ 99.0, 1065.5 ], [ 100.0, 13788.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.5 ], [ 3.0, 3.0 ], [ 4.0, 4.5 ], [ 5.0, 3.5 ], [ 6.0, 2.0 ], [ 7.0, 3.5 ], [ 8.0, 4.5 ], [ 9.0, 3.0 ], [ 10.0, 1.0 ], [ 11.0, 4.5 ], [ 12.0, 5.5 ], [ 13.0, 6.0 ], [ 14.0, 11.5 ], [ 15.0, 22.0 ], [ 16.0, 46.0 ], [ 17.0, 96.5 ], [ 18.0, 197.0 ], [ 19.0, 374.5 ], [ 20.0, 600.5 ], [ 21.0, 922.5 ], [ 22.0, 1458.0 ], [ 23.0, 2137.5 ], [ 24.0, 3002.0 ], [ 25.0, 4142.0 ], [ 26.0, 5777.0 ], [ 27.0, 8261.0 ], [ 28.0, 11563.0 ], [ 29.0, 15470.5 ], [ 30.0, 20794.5 ], [ 31.0, 28019.0 ], [ 32.0, 37238.0 ], [ 33.0, 48849.0 ], [ 34.0, 64640.5 ], [ 35.0, 81736.0 ], [ 36.0, 99921.5 ], [ 37.0, 124899.0 ], [ 38.0, 152249.5 ], [ 39.0, 177209.5 ], [ 40.0, 201307.5 ], [ 41.0, 224667.0 ], [ 42.0, 246082.5 ], [ 43.0, 266397.5 ], [ 44.0, 283205.0 ], [ 45.0, 296554.0 ], [ 46.0, 307088.5 ], [ 47.0, 312482.0 ], [ 48.0, 313865.5 ], [ 49.0, 317196.5 ], [ 50.0, 323380.0 ], [ 51.0, 331992.5 ], [ 52.0, 340724.5 ], [ 53.0, 344144.5 ], [ 54.0, 351767.0 ], [ 55.0, 359673.0 ], [ 56.0, 356242.0 ], [ 57.0, 347249.5 ], [ 58.0, 340497.0 ], [ 59.0, 335140.5 ], [ 60.0, 332277.0 ], [ 61.0, 320163.5 ], [ 62.0, 294585.5 ], [ 63.0, 271603.0 ], [ 64.0, 248741.0 ], [ 65.0, 225650.0 ], [ 66.0, 199054.0 ], [ 67.0, 168586.0 ], [ 68.0, 145716.5 ], [ 69.0, 122516.0 ], [ 70.0, 97314.0 ], [ 71.0, 77961.0 ], [ 72.0, 62940.0 ], [ 73.0, 50856.5 ], [ 74.0, 41654.0 ], [ 75.0, 35601.0 ], [ 76.0, 35148.5 ], [ 77.0, 30358.5 ], [ 78.0, 23734.0 ], [ 79.0, 19887.0 ], [ 80.0, 14626.0 ], [ 81.0, 13862.0 ], [ 82.0, 15771.0 ], [ 83.0, 13300.0 ], [ 84.0, 9872.5 ], [ 85.0, 9047.0 ], [ 86.0, 9148.0 ], [ 87.0, 7205.5 ], [ 88.0, 3682.5 ], [ 89.0, 3035.0 ], [ 90.0, 2360.5 ], [ 91.0, 1893.5 ], [ 92.0, 1439.5 ], [ 93.0, 718.0 ], [ 94.0, 207.0 ], [ 95.0, 65.5 ], [ 96.0, 28.5 ], [ 97.0, 12.5 ], [ 98.0, 17.0 ], [ 99.0, 17.0 ], [ 100.0, 5.5 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 1.5 ], [ 7.0, 5.0 ], [ 8.0, 6.5 ], [ 9.0, 6.0 ], [ 10.0, 11.5 ], [ 11.0, 11.5 ], [ 12.0, 11.0 ], [ 13.0, 18.0 ], [ 14.0, 27.0 ], [ 15.0, 47.0 ], [ 16.0, 78.0 ], [ 17.0, 122.0 ], [ 18.0, 204.0 ], [ 19.0, 324.0 ], [ 20.0, 484.0 ], [ 21.0, 770.0 ], [ 22.0, 1221.0 ], [ 23.0, 1830.5 ], [ 24.0, 2618.5 ], [ 25.0, 3654.5 ], [ 26.0, 5157.5 ], [ 27.0, 7183.5 ], [ 28.0, 9673.5 ], [ 29.0, 13108.5 ], [ 30.0, 17797.5 ], [ 31.0, 23769.0 ], [ 32.0, 31481.0 ], [ 33.0, 42115.0 ], [ 34.0, 55657.5 ], [ 35.0, 72262.5 ], [ 36.0, 91505.5 ], [ 37.0, 113241.0 ], [ 38.0, 137592.0 ], [ 39.0, 162748.0 ], [ 40.0, 186364.5 ], [ 41.0, 210477.5 ], [ 42.0, 233626.5 ], [ 43.0, 253149.5 ], [ 44.0, 268870.5 ], [ 45.0, 281256.5 ], [ 46.0, 290548.5 ], [ 47.0, 296083.5 ], [ 48.0, 300264.0 ], [ 49.0, 306750.5 ], [ 50.0, 314616.0 ], [ 51.0, 320862.5 ], [ 52.0, 327430.5 ], [ 53.0, 335010.5 ], [ 54.0, 340985.0 ], [ 55.0, 346536.5 ], [ 56.0, 347510.5 ], [ 57.0, 343286.5 ], [ 58.0, 338676.0 ], [ 59.0, 337526.5 ], [ 60.0, 336219.0 ], [ 61.0, 325765.5 ], [ 62.0, 305800.5 ], [ 63.0, 282953.0 ], [ 64.0, 261793.5 ], [ 65.0, 235982.0 ], [ 66.0, 207219.0 ], [ 67.0, 183400.5 ], [ 68.0, 160977.0 ], [ 69.0, 136339.5 ], [ 70.0, 113468.0 ], [ 71.0, 93072.5 ], [ 72.0, 76723.0 ], [ 73.0, 64610.0 ], [ 74.0, 55281.0 ], [ 75.0, 46257.0 ], [ 76.0, 37688.0 ], [ 77.0, 32392.0 ], [ 78.0, 28906.5 ], [ 79.0, 25126.5 ], [ 80.0, 21554.0 ], [ 81.0, 19724.5 ], [ 82.0, 19153.0 ], [ 83.0, 16742.0 ], [ 84.0, 14052.0 ], [ 85.0, 14447.0 ], [ 86.0, 13410.0 ], [ 87.0, 9959.0 ], [ 88.0, 7981.5 ], [ 89.0, 7668.0 ], [ 90.0, 8327.0 ], [ 91.0, 8219.0 ], [ 92.0, 5137.0 ], [ 93.0, 1833.0 ], [ 94.0, 924.5 ], [ 95.0, 738.5 ], [ 96.0, 716.5 ], [ 97.0, 902.5 ], [ 98.0, 1341.5 ], [ 99.0, 2561.0 ], [ 100.0, 20908.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.5 ], [ 3.0, 3.0 ], [ 4.0, 4.5 ], [ 5.0, 3.5 ], [ 6.0, 2.0 ], [ 7.0, 3.5 ], [ 8.0, 4.5 ], [ 9.0, 3.0 ], [ 10.0, 1.0 ], [ 11.0, 4.5 ], [ 12.0, 5.5 ], [ 13.0, 6.5 ], [ 14.0, 12.5 ], [ 15.0, 22.0 ], [ 16.0, 44.5 ], [ 17.0, 95.5 ], [ 18.0, 197.5 ], [ 19.0, 373.0 ], [ 20.0, 598.0 ], [ 21.0, 916.5 ], [ 22.0, 1450.0 ], [ 23.0, 2131.5 ], [ 24.0, 2999.5 ], [ 25.0, 4142.0 ], [ 26.0, 5785.5 ], [ 27.0, 8287.0 ], [ 28.0, 11630.5 ], [ 29.0, 15570.0 ], [ 30.0, 20946.5 ], [ 31.0, 28307.5 ], [ 32.0, 37646.0 ], [ 33.0, 49355.5 ], [ 34.0, 65254.0 ], [ 35.0, 82618.5 ], [ 36.0, 101138.5 ], [ 37.0, 126384.5 ], [ 38.0, 153717.5 ], [ 39.0, 178751.5 ], [ 40.0, 203045.5 ], [ 41.0, 226233.5 ], [ 42.0, 247665.0 ], [ 43.0, 267979.0 ], [ 44.0, 284334.5 ], [ 45.0, 297151.0 ], [ 46.0, 307205.5 ], [ 47.0, 312425.5 ], [ 48.0, 313851.0 ], [ 49.0, 317230.5 ], [ 50.0, 322775.0 ], [ 51.0, 330744.0 ], [ 52.0, 339357.0 ], [ 53.0, 342303.5 ], [ 54.0, 349719.0 ], [ 55.0, 357453.0 ], [ 56.0, 353840.0 ], [ 57.0, 344698.0 ], [ 58.0, 337453.0 ], [ 59.0, 331876.5 ], [ 60.0, 329744.0 ], [ 61.0, 318540.5 ], [ 62.0, 293932.5 ], [ 63.0, 271701.0 ], [ 64.0, 249595.0 ], [ 65.0, 227424.5 ], [ 66.0, 201385.0 ], [ 67.0, 171470.0 ], [ 68.0, 148648.0 ], [ 69.0, 125239.0 ], [ 70.0, 99796.5 ], [ 71.0, 80210.5 ], [ 72.0, 64830.0 ], [ 73.0, 52160.5 ], [ 74.0, 42907.0 ], [ 75.0, 37165.0 ], [ 76.0, 36582.0 ], [ 77.0, 31643.0 ], [ 78.0, 24968.0 ], [ 79.0, 20952.5 ], [ 80.0, 15681.0 ], [ 81.0, 15022.0 ], [ 82.0, 16806.0 ], [ 83.0, 14267.0 ], [ 84.0, 11283.5 ], [ 85.0, 10928.0 ], [ 86.0, 11045.0 ], [ 87.0, 9097.5 ], [ 88.0, 5923.5 ], [ 89.0, 5547.5 ], [ 90.0, 4823.0 ], [ 91.0, 4174.0 ], [ 92.0, 3234.5 ], [ 93.0, 1946.5 ], [ 94.0, 1128.0 ], [ 95.0, 833.0 ], [ 96.0, 710.5 ], [ 97.0, 514.5 ], [ 98.0, 386.0 ], [ 99.0, 211.0 ], [ 100.0, 52.5 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.5 ], [ 7.0, 0.5 ], [ 8.0, 0.0 ], [ 9.0, 0.5 ], [ 10.0, 2.0 ], [ 11.0, 2.0 ], [ 12.0, 2.0 ], [ 13.0, 5.0 ], [ 14.0, 14.0 ], [ 15.0, 29.0 ], [ 16.0, 55.0 ], [ 17.0, 101.5 ], [ 18.0, 179.0 ], [ 19.0, 297.0 ], [ 20.0, 461.5 ], [ 21.0, 741.0 ], [ 22.0, 1191.0 ], [ 23.0, 1806.5 ], [ 24.0, 2603.0 ], [ 25.0, 3646.0 ], [ 26.0, 5158.5 ], [ 27.0, 7218.0 ], [ 28.0, 9764.5 ], [ 29.0, 13248.0 ], [ 30.0, 18030.0 ], [ 31.0, 24154.0 ], [ 32.0, 32010.0 ], [ 33.0, 42797.0 ], [ 34.0, 56498.0 ], [ 35.0, 73409.0 ], [ 36.0, 93050.5 ], [ 37.0, 115176.0 ], [ 38.0, 139668.5 ], [ 39.0, 165021.5 ], [ 40.0, 188951.5 ], [ 41.0, 213052.0 ], [ 42.0, 236251.0 ], [ 43.0, 255802.5 ], [ 44.0, 271228.5 ], [ 45.0, 283040.0 ], [ 46.0, 291795.0 ], [ 47.0, 297163.5 ], [ 48.0, 301352.0 ], [ 49.0, 307938.0 ], [ 50.0, 315294.5 ], [ 51.0, 320946.0 ], [ 52.0, 327223.5 ], [ 53.0, 334241.0 ], [ 54.0, 340175.5 ], [ 55.0, 345488.5 ], [ 56.0, 346083.0 ], [ 57.0, 341618.0 ], [ 58.0, 336460.0 ], [ 59.0, 335352.5 ], [ 60.0, 334508.0 ], [ 61.0, 324624.0 ], [ 62.0, 305313.5 ], [ 63.0, 282955.0 ], [ 64.0, 262632.0 ], [ 65.0, 237555.5 ], [ 66.0, 209136.0 ], [ 67.0, 185780.5 ], [ 68.0, 163461.5 ], [ 69.0, 138521.5 ], [ 70.0, 115344.0 ], [ 71.0, 94873.0 ], [ 72.0, 78341.0 ], [ 73.0, 65639.5 ], [ 74.0, 56188.5 ], [ 75.0, 47536.5 ], [ 76.0, 39047.5 ], [ 77.0, 33548.5 ], [ 78.0, 29832.0 ], [ 79.0, 25945.5 ], [ 80.0, 22428.5 ], [ 81.0, 20624.0 ], [ 82.0, 19862.5 ], [ 83.0, 17372.0 ], [ 84.0, 14965.0 ], [ 85.0, 15730.5 ], [ 86.0, 14804.0 ], [ 87.0, 11446.5 ], [ 88.0, 9836.5 ], [ 89.0, 9785.5 ], [ 90.0, 10398.5 ], [ 91.0, 10148.0 ], [ 92.0, 6650.5 ], [ 93.0, 2829.0 ], [ 94.0, 1627.5 ], [ 95.0, 1277.0 ], [ 96.0, 1151.0 ], [ 97.0, 1059.5 ], [ 98.0, 1075.5 ], [ 99.0, 1386.0 ], [ 100.0, 13904.5 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_sequence_gc_content_plot", "title": "FastQC: Per Sequence GC Content", "xlab": "% GC", "ylab": "Percentage", "ymin": 0, "xmax": 100, "xmin": 0, "yDecimals": false, "tt_label": "{point.x}% GC: {point.y}", "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_1": "#f0ad4e", "rna_s1200_S21_1": "#f0ad4e", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1221_S42_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#f0ad4e", "rna_s1200_S21_2": "#f0ad4e" }, "data_labels": [ { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "categories": [] }, { "name": "Counts", "ylab": "Count", "tt_suffix": "", "categories": [] } ] } }, "fastqc_per_base_n_content_plot": { "id": "fastqc_per_base_n_content_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Base N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_base_n_content_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Per Base N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position in Read (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage N-Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_base_n_content_plot", "title": "FastQC: Per Base N Content", "ylab": "Percentage N-Count", "xlab": "Position in Read (bp)", "yCeiling": 100, "yMinRange": 5, "ymin": 0, "xmin": 0, "xDecimals": false, "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_1": "#5cb85c", "rna_s1200_S21_1": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1221_S42_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c", "rna_s1200_S21_2": "#5cb85c" }, "tt_label": "Base {point.x}: {point.y:.2f}%", "yPlotBands": [ { "from": 20, "to": 100, "color": "#e6c3c3" }, { "from": 5, "to": 20, "color": "#e6dcc3" }, { "from": 0, "to": 5, "color": "#c3e6c3" } ] } }, "fastqc_sequence_length_distribution_plot": { "id": "fastqc_sequence_length_distribution_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Length Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_length_distribution_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Sequence Length Distribution" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Sequence Length (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ [ 150, 10000000.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ [ 150, 10000000.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 17, 2.0 ], [ 22, 16.0 ], [ 27, 36.0 ], [ 32, 161.0 ], [ 37, 279.0 ], [ 42, 612.0 ], [ 47, 881.0 ], [ 52, 1367.0 ], [ 57, 2175.0 ], [ 62, 4583.0 ], [ 67, 9800.0 ], [ 72, 19754.0 ], [ 77, 36140.0 ], [ 82, 55336.0 ], [ 87, 84877.0 ], [ 92, 112059.0 ], [ 97, 150451.0 ], [ 102, 179521.0 ], [ 107, 219299.0 ], [ 112, 242182.0 ], [ 117, 272020.0 ], [ 122, 288438.0 ], [ 127, 304154.0 ], [ 132, 315151.0 ], [ 137, 318119.0 ], [ 142, 324693.0 ], [ 147, 322343.0 ], [ 150, 6673257.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 17, 3.0 ], [ 22, 16.0 ], [ 27, 34.0 ], [ 32, 161.0 ], [ 37, 277.0 ], [ 42, 609.0 ], [ 47, 879.0 ], [ 52, 1361.0 ], [ 57, 2166.0 ], [ 62, 4567.0 ], [ 67, 9763.0 ], [ 72, 19709.0 ], [ 77, 36077.0 ], [ 82, 55243.0 ], [ 87, 84726.0 ], [ 92, 111904.0 ], [ 97, 150231.0 ], [ 102, 179269.0 ], [ 107, 218999.0 ], [ 112, 241818.0 ], [ 117, 271651.0 ], [ 122, 288010.0 ], [ 127, 303755.0 ], [ 132, 314756.0 ], [ 137, 317800.0 ], [ 142, 326211.0 ], [ 147, 324722.0 ], [ 150, 6672989.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ [ 150, 10000000.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ [ 150, 10000000.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 17, 8.0 ], [ 22, 58.0 ], [ 27, 165.0 ], [ 32, 406.0 ], [ 37, 1057.0 ], [ 42, 1921.0 ], [ 47, 2659.0 ], [ 52, 4167.0 ], [ 57, 5933.0 ], [ 62, 9786.0 ], [ 67, 18230.0 ], [ 72, 32898.0 ], [ 77, 56395.0 ], [ 82, 82845.0 ], [ 87, 120046.0 ], [ 92, 151940.0 ], [ 97, 193027.0 ], [ 102, 223777.0 ], [ 107, 258734.0 ], [ 112, 275999.0 ], [ 117, 301243.0 ], [ 122, 310947.0 ], [ 127, 320811.0 ], [ 132, 325339.0 ], [ 137, 326292.0 ], [ 142, 325341.0 ], [ 147, 322725.0 ], [ 150, 6259257.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 17, 8.0 ], [ 22, 59.0 ], [ 27, 167.0 ], [ 32, 405.0 ], [ 37, 1056.0 ], [ 42, 1918.0 ], [ 47, 2656.0 ], [ 52, 4152.0 ], [ 57, 5912.0 ], [ 62, 9752.0 ], [ 67, 18175.0 ], [ 72, 32803.0 ], [ 77, 56266.0 ], [ 82, 82665.0 ], [ 87, 119812.0 ], [ 92, 151658.0 ], [ 97, 192634.0 ], [ 102, 223186.0 ], [ 107, 257921.0 ], [ 112, 275391.0 ], [ 117, 300661.0 ], [ 122, 310411.0 ], [ 127, 320305.0 ], [ 132, 324818.0 ], [ 137, 325834.0 ], [ 142, 326507.0 ], [ 147, 325093.0 ], [ 150, 6261781.0 ] ], "color": "#f0ad4e", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_length_distribution_plot", "title": "FastQC: Sequence Length Distribution", "ylab": "Read Count", "xlab": "Sequence Length (bp)", "ymin": 0, "colors": { "rna_s1221_S42_trimmed_1": "#f0ad4e", "rna_s1200_S21_trimmed_2": "#f0ad4e", "rna_s1221_S42_1": "#5cb85c", "rna_s1200_S21_1": "#5cb85c", "rna_s1221_S42_trimmed_2": "#f0ad4e", "rna_s1221_S42_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#f0ad4e", "rna_s1200_S21_2": "#5cb85c" }, "tt_label": "{point.x} bp: {point.y}" } }, "fastqc_sequence_duplication_levels_plot": { "id": "fastqc_sequence_duplication_levels_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Duplication Levels", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_duplication_levels_plot", "dconfig": { "categories": [ 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, ">10", ">50", ">100", ">500", ">1k", ">5k", ">10k+" ] }, "layout": { "title": { "text": "FastQC: Sequence Duplication Levels" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Sequence Duplication Level" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null }, "type": "category" }, "yaxis": { "hoverformat": ",.2f", "ticksuffix": "%", "title": { "text": "% of Library" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1", "data": [ 29.53961490286335, 14.827436415289677, 8.806605194578369, 5.854939507377317, 4.376902409363902, 3.385462945820296, 2.694160488830702, 2.1675999356398834, 1.8454606115227228, 17.559262739858127, 3.666671037074501, 4.515105445095276, 0.5422345811453556, 0.2185437855404656, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1200_S21_2", "data": [ 32.24453423163892, 16.992684501865625, 10.083733694214086, 6.355106647178424, 4.485765114791342, 3.41589364629103, 2.4925005126045074, 1.9890620524342508, 1.6239383296597427, 14.075283038765162, 2.9742665707143496, 2.6576976551081306, 0.15299606550656558, 0.025052630676817015, 0.0, 0.4314853085511351 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1", "data": [ 29.442998378904573, 14.878228460135364, 8.797103899845233, 5.8569982917098775, 4.392899490789697, 3.387569838800386, 2.7032685241475836, 2.1653246503849357, 1.8462069065154851, 17.5708769212612, 3.675431021799146, 4.530015078350886, 0.5337307808304302, 0.21934775652525995, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ 32.026900930232785, 17.083591915435775, 10.142656722924185, 6.4000466704057555, 4.508193521626878, 3.4400157877307698, 2.51554813788994, 2.003677756973867, 1.6292181271777302, 14.13467003178887, 2.9857013900007527, 2.676010034889662, 0.1486403032660056, 0.025194294955532263, 0.0, 0.27993437470160487 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_1", "data": [ 27.1010781355778, 14.071887627647248, 8.309374089363208, 5.771747828472301, 4.198298442176643, 3.397835656799205, 2.7476250438358365, 2.2816325744070878, 1.884207785686904, 19.353132899388047, 4.051318544739075, 5.483738871473167, 0.8259320744615473, 0.5221904259717822, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_2", "data": [ 30.918830800612408, 16.790887590451465, 9.899697474759696, 6.400848450764253, 4.4281964807923355, 3.197166987013869, 2.474527383627302, 1.9974995226086485, 1.6756428756214605, 14.965669632288941, 3.212491512247702, 3.118865844442636, 0.2987650173751997, 0.18026302728629504, 0.0, 0.4406474001078057 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ 26.952485740547232, 14.117822233066438, 8.3402600156957, 5.793553890594906, 4.212373540767959, 3.4085341397514215, 2.745351388750462, 2.269980973187953, 1.9070721546434906, 19.37879379239825, 4.046636281211134, 5.498155432538126, 0.8073369745500782, 0.5216434422968501, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ 30.70062583588802, 16.887772077397067, 9.950113733908902, 6.445060911331558, 4.462322545634369, 3.2220651527192756, 2.494679749960873, 2.0102476637366364, 1.6821057255182341, 15.029614848923561, 3.2233794561015396, 3.135576861528962, 0.2949048174178143, 0.18077052202076518, 0.0, 0.2807600979124025 ], "color": "#d9534f", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_duplication_levels_plot", "title": "FastQC: Sequence Duplication Levels", "ylab": "% of Library", "xlab": "Sequence Duplication Level", "ymax": 100, "ymin": 0, "colors": { "rna_s1221_S42_trimmed_1": "#d9534f", "rna_s1200_S21_trimmed_2": "#d9534f", "rna_s1221_S42_1": "#d9534f", "rna_s1200_S21_1": "#d9534f", "rna_s1221_S42_trimmed_2": "#d9534f", "rna_s1221_S42_2": "#d9534f", "rna_s1200_S21_trimmed_1": "#d9534f", "rna_s1200_S21_2": "#d9534f" }, "tt_decimals": 2, "tt_suffix": "%", "data_labels": [ { "categories": [ 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, ">10", ">50", ">100", ">500", ">1k", ">5k", ">10k+" ] } ] } }, "fastqc_top_overrepresented_sequences_table": { "id": "fastqc_top_overrepresented_sequences_table", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Top overrepresented sequences", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "label": 1, "uid": "fastqc_top_overrepresented_sequences_table", "dconfig": { "ylab": null }, "layout": { "title": { "text": null }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "grey", "line": { "width": 2, "color": "grey" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "metrics": [ "samples", "total_count", "total_percent" ], "header_by_metric": { "samples": { "title": "Samples", "description": "Number of samples where this sequence is overrepresented", "dmax": 4.0, "dmin": 0.0, "suffix": "", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -0.02, 4.0201 ] }, "show_points": true, "show_only_outliers": false }, "total_count": { "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "dmax": 142918.0, "dmin": 0.0, "suffix": "", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -714.59, 143636.16295 ] }, "show_points": true, "show_only_outliers": false }, "total_percent": { "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" } }, "violin_values_by_sample_by_metric": { "samples": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 4 }, "total_count": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 142918 }, "total_percent": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 0.17923129216483932 } }, "scatter_values_by_sample_by_metric": { "samples": {}, "total_count": {}, "total_percent": {} }, "all_samples": [ "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "plot_type": "violin", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": null, "config": { "namespace": "FastQC (raw)", "table_title": "FastQC: Top overrepresented sequences", "col1_header": "Overrepresented sequence", "sortRows": false }, "static": true, "violin_height": 70, "extra_height": 63 }, "fastqc_adapter_content_plot": { "id": "fastqc_adapter_content_plot", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Adapter Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_adapter_content_plot", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Adapter Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% of Sequences" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_1 - illumina_universal_adapter", "data": [ [ 1, 1e-05 ], [ 2, 1e-05 ], [ 3, 1e-05 ], [ 4, 2e-05 ], [ 5, 2e-05 ], [ 6, 2e-05 ], [ 7, 2e-05 ], [ 8, 2e-05 ], [ 9, 2e-05 ], [ 10, 4.5e-05 ], [ 12, 6e-05 ], [ 14, 6e-05 ], [ 16, 6e-05 ], [ 18, 6.5e-05 ], [ 20, 8e-05 ], [ 22, 0.00014000000000000001 ], [ 24, 0.00024 ], [ 26, 0.00034 ], [ 28, 0.00047500000000000005 ], [ 30, 0.00065 ], [ 32, 0.0008049999999999999 ], [ 34, 0.0011 ], [ 36, 0.0014650000000000002 ], [ 38, 0.0019099999999999998 ], [ 40, 0.00278 ], [ 42, 0.003895 ], [ 44, 0.00551 ], [ 46, 0.00747 ], [ 48, 0.009569999999999999 ], [ 50, 0.01227 ], [ 52, 0.01579 ], [ 54, 0.02039 ], [ 56, 0.02614 ], [ 58, 0.033135 ], [ 60, 0.042505 ], [ 62, 0.05581 ], [ 64, 0.07597999999999999 ], [ 66, 0.103745 ], [ 68, 0.140865 ], [ 70, 0.190055 ], [ 72, 0.255155 ], [ 74, 0.34273 ], [ 76, 0.45726500000000003 ], [ 78, 0.5998399999999999 ], [ 80, 0.768005 ], [ 82, 0.965355 ], [ 84, 1.2025549999999998 ], [ 86, 1.49219 ], [ 88, 1.82914 ], [ 90, 2.20438 ], [ 92, 2.62312 ], [ 94, 3.08983 ], [ 96, 3.625235 ], [ 98, 4.226925 ], [ 100, 4.873225 ], [ 102, 5.55598 ], [ 104, 6.29097 ], [ 106, 7.09568 ], [ 108, 7.96658 ], [ 110, 8.886415 ], [ 112, 9.83174 ], [ 114, 10.80903 ], [ 116, 11.82866 ], [ 118, 12.909355 ], [ 120, 14.03391 ], [ 122, 15.175654999999999 ], [ 124, 16.317320000000002 ], [ 126, 17.486690000000003 ], [ 128, 18.69974 ], [ 130, 19.937199999999997 ], [ 132, 21.188634999999998 ], [ 134, 22.43478 ], [ 136, 23.671145 ], [ 138, 24.929415 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1200_S21_1 - polya", "data": [ [ 1, 0.00015 ], [ 2, 0.00148 ], [ 3, 0.00264 ], [ 4, 0.00452 ], [ 5, 0.00559 ], [ 6, 0.00656 ], [ 7, 0.00782 ], [ 8, 0.00928 ], [ 9, 0.01278 ], [ 10, 0.016855000000000002 ], [ 12, 0.019235 ], [ 14, 0.024215 ], [ 16, 0.026595 ], [ 18, 0.028749999999999998 ], [ 20, 0.03077 ], [ 22, 0.033365 ], [ 24, 0.036364999999999995 ], [ 26, 0.04091 ], [ 28, 0.044765 ], [ 30, 0.047435000000000005 ], [ 32, 0.04908 ], [ 34, 0.05258 ], [ 36, 0.054404999999999995 ], [ 38, 0.056315000000000004 ], [ 40, 0.05792 ], [ 42, 0.059545 ], [ 44, 0.06112 ], [ 46, 0.062915 ], [ 48, 0.06475500000000001 ], [ 50, 0.06588 ], [ 52, 0.06718 ], [ 54, 0.068715 ], [ 56, 0.070535 ], [ 58, 0.07192499999999999 ], [ 60, 0.07330500000000001 ], [ 62, 0.07443 ], [ 64, 0.07542499999999999 ], [ 66, 0.07656 ], [ 68, 0.079985 ], [ 70, 0.08306 ], [ 72, 0.084535 ], [ 74, 0.085625 ], [ 76, 0.08668999999999999 ], [ 78, 0.087915 ], [ 80, 0.08884 ], [ 82, 0.08989 ], [ 84, 0.091275 ], [ 86, 0.09307499999999999 ], [ 88, 0.09453500000000001 ], [ 90, 0.096475 ], [ 92, 0.09788 ], [ 94, 0.098965 ], [ 96, 0.100155 ], [ 98, 0.10133 ], [ 100, 0.102275 ], [ 102, 0.10327 ], [ 104, 0.104575 ], [ 106, 0.106005 ], [ 108, 0.1071 ], [ 110, 0.108025 ], [ 112, 0.10921 ], [ 114, 0.110055 ], [ 116, 0.111045 ], [ 118, 0.11194 ], [ 120, 0.11279 ], [ 122, 0.113705 ], [ 124, 0.11463000000000001 ], [ 126, 0.115475 ], [ 128, 0.11630499999999999 ], [ 130, 0.117175 ], [ 132, 0.117975 ], [ 134, 0.11893500000000001 ], [ 136, 0.119695 ], [ 138, 0.120405 ] ], "color": "#434348", "marker": {} }, { "name": "rna_s1200_S21_1 - polyg", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.00036 ], [ 4, 0.00058 ], [ 5, 0.00059 ], [ 6, 0.00062 ], [ 7, 0.00066 ], [ 8, 0.00068 ], [ 9, 0.00069 ], [ 10, 0.0007199999999999999 ], [ 12, 0.000835 ], [ 14, 0.00092 ], [ 16, 0.000985 ], [ 18, 0.00102 ], [ 20, 0.001085 ], [ 22, 0.0011 ], [ 24, 0.00115 ], [ 26, 0.001215 ], [ 28, 0.00128 ], [ 30, 0.00134 ], [ 32, 0.001415 ], [ 34, 0.001495 ], [ 36, 0.00155 ], [ 38, 0.00158 ], [ 40, 0.0016649999999999998 ], [ 42, 0.00181 ], [ 44, 0.0021 ], [ 46, 0.002215 ], [ 48, 0.0023550000000000003 ], [ 50, 0.00245 ], [ 52, 0.00268 ], [ 54, 0.003075 ], [ 56, 0.0033049999999999998 ], [ 58, 0.003485 ], [ 60, 0.00363 ], [ 62, 0.00376 ], [ 64, 0.00384 ], [ 66, 0.00392 ], [ 68, 0.004025 ], [ 70, 0.0040999999999999995 ], [ 72, 0.004240000000000001 ], [ 74, 0.004370000000000001 ], [ 76, 0.00449 ], [ 78, 0.004595 ], [ 80, 0.00468 ], [ 82, 0.004765 ], [ 84, 0.00487 ], [ 86, 0.004954999999999999 ], [ 88, 0.005075 ], [ 90, 0.0052049999999999996 ], [ 92, 0.005405 ], [ 94, 0.00563 ], [ 96, 0.00592 ], [ 98, 0.00622 ], [ 100, 0.006665 ], [ 102, 0.007175 ], [ 104, 0.007625 ], [ 106, 0.00818 ], [ 108, 0.00895 ], [ 110, 0.009989999999999999 ], [ 112, 0.011415 ], [ 114, 0.012885 ], [ 116, 0.014815 ], [ 118, 0.016975 ], [ 120, 0.01959 ], [ 122, 0.02275 ], [ 124, 0.0269 ], [ 126, 0.03187 ], [ 128, 0.03815 ], [ 130, 0.04567 ], [ 132, 0.056315000000000004 ], [ 134, 0.071685 ], [ 136, 0.093625 ], [ 138, 0.12295 ] ], "color": "#90ed7d", "marker": {} }, { "name": "rna_s1200_S21_2 - illumina_universal_adapter", "data": [ [ 1, 1e-05 ], [ 2, 2e-05 ], [ 3, 2e-05 ], [ 4, 2e-05 ], [ 5, 2e-05 ], [ 6, 2e-05 ], [ 7, 2e-05 ], [ 8, 2e-05 ], [ 9, 2e-05 ], [ 10, 3.5000000000000004e-05 ], [ 12, 4e-05 ], [ 14, 5.5e-05 ], [ 16, 6.5e-05 ], [ 18, 7.500000000000001e-05 ], [ 20, 9e-05 ], [ 22, 0.00014000000000000001 ], [ 24, 0.00023500000000000002 ], [ 26, 0.00036 ], [ 28, 0.000505 ], [ 30, 0.000705 ], [ 32, 0.0008849999999999999 ], [ 34, 0.001185 ], [ 36, 0.001565 ], [ 38, 0.002055 ], [ 40, 0.00294 ], [ 42, 0.004095 ], [ 44, 0.005770000000000001 ], [ 46, 0.0077599999999999995 ], [ 48, 0.009885 ], [ 50, 0.012625 ], [ 52, 0.01623 ], [ 54, 0.020955 ], [ 56, 0.026775 ], [ 58, 0.033894999999999995 ], [ 60, 0.043275 ], [ 62, 0.05658 ], [ 64, 0.07678 ], [ 66, 0.104585 ], [ 68, 0.14189000000000002 ], [ 70, 0.19095 ], [ 72, 0.25600999999999996 ], [ 74, 0.34345499999999995 ], [ 76, 0.45802 ], [ 78, 0.6006100000000001 ], [ 80, 0.768915 ], [ 82, 0.9663250000000001 ], [ 84, 1.203325 ], [ 86, 1.49317 ], [ 88, 1.830195 ], [ 90, 2.20553 ], [ 92, 2.624245 ], [ 94, 3.09043 ], [ 96, 3.625565 ], [ 98, 4.226955 ], [ 100, 4.872985 ], [ 102, 5.555405 ], [ 104, 6.289865 ], [ 106, 7.094060000000001 ], [ 108, 7.964145 ], [ 110, 8.883735000000001 ], [ 112, 9.82847 ], [ 114, 10.80522 ], [ 116, 11.824864999999999 ], [ 118, 12.905505000000002 ], [ 120, 14.03005 ], [ 122, 15.171520000000001 ], [ 124, 16.313125 ], [ 126, 17.48248 ], [ 128, 18.69537 ], [ 130, 19.934135 ], [ 132, 21.187415 ], [ 134, 22.434445 ], [ 136, 23.67197 ], [ 138, 24.931935000000003 ] ], "color": "#f7a35c", "marker": {} }, { "name": "rna_s1200_S21_2 - polyg", "data": [ [ 1, 0.53241 ], [ 2, 0.55801 ], [ 3, 0.55892 ], [ 4, 0.56035 ], [ 5, 0.56153 ], [ 6, 0.56328 ], [ 7, 0.56512 ], [ 8, 0.56701 ], [ 9, 0.56891 ], [ 10, 0.57158 ], [ 12, 0.5747599999999999 ], [ 14, 0.576435 ], [ 16, 0.5773550000000001 ], [ 18, 0.57785 ], [ 20, 0.57819 ], [ 22, 0.578585 ], [ 24, 0.5789249999999999 ], [ 26, 0.579155 ], [ 28, 0.5793649999999999 ], [ 30, 0.57959 ], [ 32, 0.57981 ], [ 34, 0.57997 ], [ 36, 0.580085 ], [ 38, 0.58021 ], [ 40, 0.58037 ], [ 42, 0.580525 ], [ 44, 0.58069 ], [ 46, 0.58082 ], [ 48, 0.58095 ], [ 50, 0.5810599999999999 ], [ 52, 0.58118 ], [ 54, 0.58133 ], [ 56, 0.581485 ], [ 58, 0.58165 ], [ 60, 0.581815 ], [ 62, 0.5819099999999999 ], [ 64, 0.58202 ], [ 66, 0.58216 ], [ 68, 0.5822849999999999 ], [ 70, 0.58247 ], [ 72, 0.5826 ], [ 74, 0.582675 ], [ 76, 0.5828 ], [ 78, 0.5828949999999999 ], [ 80, 0.5829850000000001 ], [ 82, 0.5830850000000001 ], [ 84, 0.58322 ], [ 86, 0.583435 ], [ 88, 0.5836399999999999 ], [ 90, 0.58375 ], [ 92, 0.583825 ], [ 94, 0.58399 ], [ 96, 0.5841099999999999 ], [ 98, 0.584245 ], [ 100, 0.584395 ], [ 102, 0.58467 ], [ 104, 0.5849500000000001 ], [ 106, 0.585265 ], [ 108, 0.58559 ], [ 110, 0.586015 ], [ 112, 0.586505 ], [ 114, 0.5871500000000001 ], [ 116, 0.5882700000000001 ], [ 118, 0.589585 ], [ 120, 0.59148 ], [ 122, 0.5937 ], [ 124, 0.5960749999999999 ], [ 126, 0.598975 ], [ 128, 0.6028500000000001 ], [ 130, 0.60781 ], [ 132, 0.6139950000000001 ], [ 134, 0.621495 ], [ 136, 0.63143 ], [ 138, 0.64557 ] ], "color": "#8085e9", "marker": {} }, { "name": "rna_s1200_S21_trimmed_1 - polya", "data": [ [ 1, 0.00015094026730112564 ], [ 2, 0.0014289011971173227 ], [ 3, 0.002565984544119136 ], [ 4, 0.004387330436219385 ], [ 5, 0.005353348146946589 ], [ 6, 0.006289177804213568 ], [ 7, 0.007506762627109315 ], [ 8, 0.008855162348332704 ], [ 9, 0.012155722859983984 ], [ 10, 0.01600469967616269 ], [ 12, 0.018273835027922944 ], [ 14, 0.023028453447908402 ], [ 16, 0.02530262014191203 ], [ 18, 0.027365470461694075 ], [ 20, 0.029362913332312307 ], [ 22, 0.03194399190316155 ], [ 24, 0.034882295773290134 ], [ 26, 0.039284720236239634 ], [ 28, 0.04306828960325451 ], [ 30, 0.04570471293878084 ], [ 32, 0.047319773798902884 ], [ 34, 0.05082661934253237 ], [ 36, 0.05264293389238925 ], [ 38, 0.05452465589140995 ], [ 40, 0.056124622724801884 ], [ 42, 0.057734652242680554 ], [ 44, 0.05928430565363878 ], [ 46, 0.061060369465548686 ], [ 48, 0.0629068720688658 ], [ 50, 0.06402886138913749 ], [ 52, 0.06529172829222357 ], [ 54, 0.06681622499196495 ], [ 56, 0.06863253954182183 ], [ 58, 0.07000609597426208 ], [ 60, 0.07136958972221558 ], [ 62, 0.07249157904248726 ], [ 64, 0.07349281614891807 ], [ 66, 0.07461480546918978 ], [ 68, 0.07800089879897835 ], [ 70, 0.08107001756743458 ], [ 72, 0.08249388742230854 ], [ 74, 0.08356053197790314 ], [ 76, 0.0845869257955508 ], [ 78, 0.08576425988049959 ], [ 80, 0.08664977611533285 ], [ 82, 0.08768623261746725 ], [ 84, 0.0890597890499075 ], [ 86, 0.09086100957303427 ], [ 88, 0.09229494211239495 ], [ 90, 0.09421691484936262 ], [ 92, 0.09556028322834263 ], [ 94, 0.09660177107272042 ], [ 96, 0.09775394844645233 ], [ 98, 0.09891115716242763 ], [ 100, 0.09982183010847775 ], [ 102, 0.10078281647696158 ], [ 104, 0.10206580874902116 ], [ 106, 0.10344942786594813 ], [ 108, 0.10451104107929939 ], [ 110, 0.10541668268310614 ], [ 112, 0.10657892274132481 ], [ 114, 0.10735878078904729 ], [ 116, 0.10831976715753112 ], [ 118, 0.10918012668114754 ], [ 120, 0.11000526680906036 ], [ 122, 0.11087568901716352 ], [ 124, 0.11177126793648354 ], [ 126, 0.11259640806439636 ], [ 128, 0.11340142282333568 ], [ 130, 0.1142265629512485 ], [ 132, 0.11496113891878065 ], [ 134, 0.11589193723380425 ], [ 136, 0.11661645051684966 ], [ 138, 0.11731077574643484 ] ], "color": "#f15c80", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2 - polyg", "data": [ [ 1, 0.3327226625541146 ], [ 2, 0.34101431457118975 ], [ 3, 0.34148726074206665 ], [ 4, 0.3419602069129435 ], [ 5, 0.3424432157683071 ], [ 6, 0.3432683558962199 ], [ 7, 0.34381174085850397 ], [ 8, 0.3443752511897615 ], [ 9, 0.345019262996913 ], [ 10, 0.3458896852050162 ], [ 12, 0.34691607902266375 ], [ 14, 0.3475198400918683 ], [ 16, 0.34778650123076693 ], [ 18, 0.34797266089377166 ], [ 20, 0.34812863250331616 ], [ 22, 0.34828963545510405 ], [ 24, 0.3483952936422148 ], [ 26, 0.3484607010913786 ], [ 28, 0.34854623390951595 ], [ 30, 0.34864686075438334 ], [ 32, 0.34871226820354717 ], [ 34, 0.348777675652711 ], [ 36, 0.34880786370617123 ], [ 38, 0.3488632084708483 ], [ 40, 0.34894370994674223 ], [ 42, 0.34899905471141934 ], [ 44, 0.349049368133853 ], [ 46, 0.3491248382675036 ], [ 48, 0.3491701203476939 ], [ 50, 0.349225465112371 ], [ 52, 0.34929087256153485 ], [ 54, 0.3493663426951854 ], [ 56, 0.3494569068555661 ], [ 58, 0.3495223143047299 ], [ 60, 0.3495726277271636 ], [ 62, 0.3496229411495973 ], [ 64, 0.3496883485987611 ], [ 66, 0.3497487247056816 ], [ 68, 0.349809100812602 ], [ 70, 0.34988960228849597 ], [ 72, 0.34997513510663325 ], [ 74, 0.350025448529067 ], [ 76, 0.35010091866271753 ], [ 78, 0.350161294769638 ], [ 80, 0.3502116081920717 ], [ 82, 0.3502468275877753 ], [ 84, 0.350297141010209 ], [ 86, 0.35037261114385954 ], [ 88, 0.3504933633577004 ], [ 90, 0.35055877080686426 ], [ 92, 0.35059902154481126 ], [ 94, 0.3506744916784618 ], [ 96, 0.35071977375865215 ], [ 98, 0.3507902125500594 ], [ 100, 0.35083549463024966 ], [ 102, 0.35088077671044 ], [ 104, 0.3509260587906303 ], [ 106, 0.3510065602665243 ], [ 108, 0.3510518423467146 ], [ 110, 0.3511021557691483 ], [ 112, 0.35115246919158205 ], [ 114, 0.35125812737869283 ], [ 116, 0.35134366019683017 ], [ 118, 0.35143422435721083 ], [ 120, 0.35154994522880834 ], [ 122, 0.3516656661004059 ], [ 124, 0.3516958541538661 ], [ 126, 0.35172604220732634 ], [ 128, 0.35177635562976 ], [ 130, 0.3518467944211672 ], [ 132, 0.35187698247462745 ], [ 134, 0.3519222645548178 ], [ 136, 0.3519675466350081 ], [ 138, 0.35200276603071173 ] ], "color": "#e4d354", "marker": {} }, { "name": "rna_s1221_S42_1 - illumina_universal_adapter", "data": [ [ 1, 0.0 ], [ 2, 1e-05 ], [ 3, 2e-05 ], [ 4, 4e-05 ], [ 5, 5e-05 ], [ 6, 5e-05 ], [ 7, 6e-05 ], [ 8, 6e-05 ], [ 9, 6e-05 ], [ 10, 6.5e-05 ], [ 12, 7e-05 ], [ 14, 7e-05 ], [ 16, 9.5e-05 ], [ 18, 0.000145 ], [ 20, 0.00017500000000000003 ], [ 22, 0.000385 ], [ 24, 0.00068 ], [ 26, 0.001065 ], [ 28, 0.00172 ], [ 30, 0.00258 ], [ 32, 0.0036 ], [ 34, 0.004795 ], [ 36, 0.006775 ], [ 38, 0.009935 ], [ 40, 0.015185 ], [ 42, 0.02126 ], [ 44, 0.028145 ], [ 46, 0.03585 ], [ 48, 0.04488 ], [ 50, 0.055125 ], [ 52, 0.06867999999999999 ], [ 54, 0.08518 ], [ 56, 0.104345 ], [ 58, 0.1259 ], [ 60, 0.15196500000000002 ], [ 62, 0.18358 ], [ 64, 0.22555999999999998 ], [ 66, 0.28081 ], [ 68, 0.351135 ], [ 70, 0.43945999999999996 ], [ 72, 0.551995 ], [ 74, 0.696175 ], [ 76, 0.878505 ], [ 78, 1.1003150000000002 ], [ 80, 1.361035 ], [ 82, 1.66166 ], [ 84, 2.014235 ], [ 86, 2.435775 ], [ 88, 2.9093999999999998 ], [ 90, 3.4315550000000004 ], [ 92, 4.00288 ], [ 94, 4.632235 ], [ 96, 5.33784 ], [ 98, 6.109715 ], [ 100, 6.92365 ], [ 102, 7.782045 ], [ 104, 8.693100000000001 ], [ 106, 9.66677 ], [ 108, 10.693835 ], [ 110, 11.757629999999999 ], [ 112, 12.841764999999999 ], [ 114, 13.946935 ], [ 116, 15.100995000000001 ], [ 118, 16.295830000000002 ], [ 120, 17.514499999999998 ], [ 122, 18.746915 ], [ 124, 19.976375 ], [ 126, 21.224625 ], [ 128, 22.507485000000003 ], [ 130, 23.789545 ], [ 132, 25.07849 ], [ 134, 26.368164999999998 ], [ 136, 27.64539 ], [ 138, 28.93455 ] ], "color": "#2b908f", "marker": {} }, { "name": "rna_s1221_S42_1 - polya", "data": [ [ 1, 0.00015 ], [ 2, 0.00129 ], [ 3, 0.00227 ], [ 4, 0.00382 ], [ 5, 0.00491 ], [ 6, 0.00566 ], [ 7, 0.0067 ], [ 8, 0.0075 ], [ 9, 0.01068 ], [ 10, 0.014985 ], [ 12, 0.017544999999999998 ], [ 14, 0.022019999999999998 ], [ 16, 0.02422 ], [ 18, 0.02655 ], [ 20, 0.028245 ], [ 22, 0.03057 ], [ 24, 0.033335000000000004 ], [ 26, 0.03745 ], [ 28, 0.04088 ], [ 30, 0.04313 ], [ 32, 0.044655 ], [ 34, 0.04753 ], [ 36, 0.04914 ], [ 38, 0.05055 ], [ 40, 0.05178000000000001 ], [ 42, 0.053395 ], [ 44, 0.05502 ], [ 46, 0.056334999999999996 ], [ 48, 0.05777 ], [ 50, 0.058679999999999996 ], [ 52, 0.059664999999999996 ], [ 54, 0.060915 ], [ 56, 0.06261 ], [ 58, 0.06418499999999999 ], [ 60, 0.065345 ], [ 62, 0.066585 ], [ 64, 0.067545 ], [ 66, 0.06877 ], [ 68, 0.071985 ], [ 70, 0.07524 ], [ 72, 0.07665 ], [ 74, 0.077625 ], [ 76, 0.07869000000000001 ], [ 78, 0.07997 ], [ 80, 0.08085500000000001 ], [ 82, 0.08187 ], [ 84, 0.08311 ], [ 86, 0.08505 ], [ 88, 0.086485 ], [ 90, 0.08835 ], [ 92, 0.08951 ], [ 94, 0.09071000000000001 ], [ 96, 0.09195500000000001 ], [ 98, 0.09307499999999999 ], [ 100, 0.09422 ], [ 102, 0.095385 ], [ 104, 0.09659000000000001 ], [ 106, 0.09779499999999999 ], [ 108, 0.09926499999999999 ], [ 110, 0.1005 ], [ 112, 0.10165 ], [ 114, 0.10264999999999999 ], [ 116, 0.10363 ], [ 118, 0.104585 ], [ 120, 0.105605 ], [ 122, 0.1065 ], [ 124, 0.107285 ], [ 126, 0.10841 ], [ 128, 0.10936499999999999 ], [ 130, 0.11022499999999999 ], [ 132, 0.11085500000000001 ], [ 134, 0.11172 ], [ 136, 0.11266999999999999 ], [ 138, 0.113585 ] ], "color": "#f45b5b", "marker": {} }, { "name": "rna_s1221_S42_1 - polyg", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.00026 ], [ 4, 0.00036 ], [ 5, 0.00038 ], [ 6, 0.00042 ], [ 7, 0.00044 ], [ 8, 0.00044 ], [ 9, 0.00052 ], [ 10, 0.000585 ], [ 12, 0.00067 ], [ 14, 0.0007 ], [ 16, 0.00075 ], [ 18, 0.00084 ], [ 20, 0.000985 ], [ 22, 0.00108 ], [ 24, 0.0012000000000000001 ], [ 26, 0.0012799999999999999 ], [ 28, 0.00136 ], [ 30, 0.0015899999999999998 ], [ 32, 0.001805 ], [ 34, 0.00199 ], [ 36, 0.00216 ], [ 38, 0.002355 ], [ 40, 0.0026550000000000002 ], [ 42, 0.002895 ], [ 44, 0.003355 ], [ 46, 0.00364 ], [ 48, 0.0038250000000000003 ], [ 50, 0.0040750000000000005 ], [ 52, 0.00451 ], [ 54, 0.0053100000000000005 ], [ 56, 0.005635 ], [ 58, 0.00588 ], [ 60, 0.00616 ], [ 62, 0.006314999999999999 ], [ 64, 0.0065 ], [ 66, 0.00671 ], [ 68, 0.006895 ], [ 70, 0.007165 ], [ 72, 0.007735 ], [ 74, 0.00809 ], [ 76, 0.00842 ], [ 78, 0.00914 ], [ 80, 0.010825000000000001 ], [ 82, 0.013694999999999999 ], [ 84, 0.0155 ], [ 86, 0.01645 ], [ 88, 0.017165 ], [ 90, 0.017815 ], [ 92, 0.018770000000000002 ], [ 94, 0.020035 ], [ 96, 0.021535 ], [ 98, 0.02331 ], [ 100, 0.02555 ], [ 102, 0.02816 ], [ 104, 0.031085 ], [ 106, 0.03449 ], [ 108, 0.038974999999999996 ], [ 110, 0.045094999999999996 ], [ 112, 0.05282 ], [ 114, 0.061134999999999995 ], [ 116, 0.06934 ], [ 118, 0.07785 ], [ 120, 0.08751 ], [ 122, 0.099265 ], [ 124, 0.11417 ], [ 126, 0.13081500000000001 ], [ 128, 0.15018 ], [ 130, 0.172985 ], [ 132, 0.20077 ], [ 134, 0.23532 ], [ 136, 0.28022 ], [ 138, 0.338465 ] ], "color": "#91e8e1", "marker": {} }, { "name": "rna_s1221_S42_2 - illumina_universal_adapter", "data": [ [ 1, 0.0 ], [ 2, 1e-05 ], [ 3, 1e-05 ], [ 4, 1e-05 ], [ 5, 1e-05 ], [ 6, 1e-05 ], [ 7, 1e-05 ], [ 8, 2e-05 ], [ 9, 2e-05 ], [ 10, 3e-05 ], [ 12, 3e-05 ], [ 14, 4e-05 ], [ 16, 6.5e-05 ], [ 18, 0.0001 ], [ 20, 0.00013 ], [ 22, 0.000355 ], [ 24, 0.000675 ], [ 26, 0.001065 ], [ 28, 0.001755 ], [ 30, 0.00263 ], [ 32, 0.003645 ], [ 34, 0.004880000000000001 ], [ 36, 0.006914999999999999 ], [ 38, 0.010159999999999999 ], [ 40, 0.015405 ], [ 42, 0.02141 ], [ 44, 0.02825 ], [ 46, 0.035965 ], [ 48, 0.04513 ], [ 50, 0.05541 ], [ 52, 0.06915 ], [ 54, 0.08584 ], [ 56, 0.10521 ], [ 58, 0.126645 ], [ 60, 0.15262 ], [ 62, 0.18409999999999999 ], [ 64, 0.22610999999999998 ], [ 66, 0.2812 ], [ 68, 0.351515 ], [ 70, 0.439835 ], [ 72, 0.55225 ], [ 74, 0.696335 ], [ 76, 0.878455 ], [ 78, 1.099695 ], [ 80, 1.359705 ], [ 82, 1.66001 ], [ 84, 2.01242 ], [ 86, 2.43289 ], [ 88, 2.905695 ], [ 90, 3.427245 ], [ 92, 3.997865 ], [ 94, 4.626715 ], [ 96, 5.33146 ], [ 98, 6.10214 ], [ 100, 6.914745 ], [ 102, 7.7710349999999995 ], [ 104, 8.680125 ], [ 106, 9.65183 ], [ 108, 10.676425 ], [ 110, 11.73816 ], [ 112, 12.820695 ], [ 114, 13.92442 ], [ 116, 15.07752 ], [ 118, 16.27216 ], [ 120, 17.49012 ], [ 122, 18.721899999999998 ], [ 124, 19.95115 ], [ 126, 21.19921 ], [ 128, 22.482035 ], [ 130, 23.764695 ], [ 132, 25.05379 ], [ 134, 26.3438 ], [ 136, 27.62211 ], [ 138, 28.911830000000002 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1221_S42_2 - polyg", "data": [ [ 1, 0.54805 ], [ 2, 0.57391 ], [ 3, 0.57482 ], [ 4, 0.57634 ], [ 5, 0.57724 ], [ 6, 0.57898 ], [ 7, 0.58078 ], [ 8, 0.58256 ], [ 9, 0.58435 ], [ 10, 0.587125 ], [ 12, 0.59066 ], [ 14, 0.59236 ], [ 16, 0.59318 ], [ 18, 0.5938049999999999 ], [ 20, 0.59433 ], [ 22, 0.594775 ], [ 24, 0.595105 ], [ 26, 0.595325 ], [ 28, 0.59554 ], [ 30, 0.5958600000000001 ], [ 32, 0.596105 ], [ 34, 0.59631 ], [ 36, 0.596545 ], [ 38, 0.596795 ], [ 40, 0.5970150000000001 ], [ 42, 0.59721 ], [ 44, 0.597405 ], [ 46, 0.59762 ], [ 48, 0.597845 ], [ 50, 0.59811 ], [ 52, 0.5983499999999999 ], [ 54, 0.598575 ], [ 56, 0.5987750000000001 ], [ 58, 0.5989800000000001 ], [ 60, 0.59918 ], [ 62, 0.59935 ], [ 64, 0.59951 ], [ 66, 0.599745 ], [ 68, 0.59992 ], [ 70, 0.6002050000000001 ], [ 72, 0.60051 ], [ 74, 0.600705 ], [ 76, 0.60082 ], [ 78, 0.60101 ], [ 80, 0.601255 ], [ 82, 0.601515 ], [ 84, 0.601775 ], [ 86, 0.602105 ], [ 88, 0.602395 ], [ 90, 0.6026499999999999 ], [ 92, 0.6029599999999999 ], [ 94, 0.603175 ], [ 96, 0.60333 ], [ 98, 0.6037349999999999 ], [ 100, 0.604205 ], [ 102, 0.604905 ], [ 104, 0.605695 ], [ 106, 0.606785 ], [ 108, 0.608085 ], [ 110, 0.609545 ], [ 112, 0.61202 ], [ 114, 0.6156550000000001 ], [ 116, 0.621335 ], [ 118, 0.62811 ], [ 120, 0.635515 ], [ 122, 0.64383 ], [ 124, 0.6534850000000001 ], [ 126, 0.66474 ], [ 128, 0.679235 ], [ 130, 0.6969000000000001 ], [ 132, 0.7168 ], [ 134, 0.73942 ], [ 136, 0.7665150000000001 ], [ 138, 0.8001 ] ], "color": "#434348", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1 - polya", "data": [ [ 1, 0.0001409584327677611 ], [ 2, 0.0012182835974927926 ], [ 3, 0.002194924167383709 ], [ 4, 0.003664919251961789 ], [ 5, 0.004722107497719998 ], [ 6, 0.005436968121042215 ], [ 7, 0.0064136086909331305 ], [ 8, 0.007158674692705582 ], [ 9, 0.0101490071592788 ], [ 10, 0.014191493641868521 ], [ 12, 0.016592821228662166 ], [ 14, 0.02086688227937035 ], [ 16, 0.02299132723037018 ], [ 18, 0.02525169638439606 ], [ 20, 0.026902923739675552 ], [ 22, 0.029163292893701433 ], [ 24, 0.03188177695422254 ], [ 26, 0.035929297666553964 ], [ 28, 0.03926195775556318 ], [ 30, 0.04148708730139712 ], [ 32, 0.042972185075200314 ], [ 34, 0.04581149064952236 ], [ 36, 0.047412375707384796 ], [ 38, 0.048801823116095586 ], [ 40, 0.04998486710539643 ], [ 42, 0.05159078639300056 ], [ 44, 0.05320677414008812 ], [ 46, 0.05450057118370649 ], [ 48, 0.05591518974112582 ], [ 50, 0.056816316864891137 ], [ 52, 0.05780302589426547 ], [ 54, 0.05902130949175827 ], [ 56, 0.06071281068497139 ], [ 58, 0.06223314806696653 ], [ 60, 0.06338598667781714 ], [ 62, 0.06460930450505165 ], [ 64, 0.0655305685477838 ], [ 66, 0.0666683044694093 ], [ 68, 0.0698197322877171 ], [ 70, 0.0730517077818922 ], [ 72, 0.07442101827163616 ], [ 74, 0.07536745346307686 ], [ 76, 0.0763793336411597 ], [ 78, 0.07762278838736103 ], [ 80, 0.07847357321370929 ], [ 82, 0.0794451795538585 ], [ 84, 0.08064332623238447 ], [ 86, 0.08256136776397437 ], [ 88, 0.08396591786191027 ], [ 90, 0.08577824056892434 ], [ 92, 0.08690087380132472 ], [ 94, 0.08801847280398341 ], [ 96, 0.08920655102302597 ], [ 98, 0.09028891041749271 ], [ 100, 0.09140650942015138 ], [ 102, 0.09252410842281006 ], [ 104, 0.09369708395262749 ], [ 106, 0.09485495679321981 ], [ 108, 0.09630481495883109 ], [ 110, 0.09753820124554899 ], [ 112, 0.09867090293743278 ], [ 114, 0.09961230389913175 ], [ 116, 0.10054867063108902 ], [ 118, 0.10148503736304629 ], [ 120, 0.10249691754112916 ], [ 122, 0.10334770236747742 ], [ 124, 0.10407766568002476 ], [ 126, 0.10519526468268343 ], [ 128, 0.10608128911722364 ], [ 130, 0.10689683433537998 ], [ 132, 0.10748583921515956 ], [ 134, 0.10829635020357418 ], [ 136, 0.10921761424630633 ], [ 138, 0.11009860445110484 ] ], "color": "#90ed7d", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2 - polyg", "data": [ [ 1, 0.33756524110033764 ], [ 2, 0.346113363201754 ], [ 3, 0.34650603312160705 ], [ 4, 0.34728130450182976 ], [ 5, 0.34760349520529893 ], [ 6, 0.34826801353120407 ], [ 7, 0.3490432849114268 ], [ 8, 0.34965746093991484 ], [ 9, 0.3502817054278864 ], [ 10, 0.3513791675115782 ], [ 12, 0.3526024853388127 ], [ 14, 0.3531814217591089 ], [ 16, 0.35342809901645245 ], [ 18, 0.3536395366656041 ], [ 20, 0.3537855293281136 ], [ 22, 0.3538962823824311 ], [ 24, 0.353966761598815 ], [ 26, 0.35401206966649035 ], [ 28, 0.3540976515720994 ], [ 30, 0.35419330193719173 ], [ 32, 0.35430908922125093 ], [ 34, 0.3544047395863434 ], [ 36, 0.3545003899514358 ], [ 38, 0.35458597185704477 ], [ 40, 0.3546866564518789 ], [ 42, 0.3547521014385211 ], [ 44, 0.35482761488464665 ], [ 46, 0.35489305987128883 ], [ 48, 0.354993744466123 ], [ 50, 0.35508436060147364 ], [ 52, 0.3552102163450163 ], [ 54, 0.3553058667101087 ], [ 56, 0.3553914486157177 ], [ 58, 0.3554820647510684 ], [ 60, 0.3555978520351276 ], [ 62, 0.3556935024002201 ], [ 64, 0.3557992212247959 ], [ 66, 0.3559200427385968 ], [ 68, 0.3559905219549807 ], [ 70, 0.35614154884723187 ], [ 72, 0.3563479522666418 ], [ 74, 0.3564687737804427 ], [ 76, 0.35652415030760154 ], [ 78, 0.3566449718214024 ], [ 80, 0.35681110140287875 ], [ 82, 0.3569570940653882 ], [ 84, 0.3571232236468645 ], [ 86, 0.3573044559175659 ], [ 88, 0.3575058251072341 ], [ 90, 0.3576467835400019 ], [ 92, 0.3578229815809616 ], [ 94, 0.3579488373245042 ], [ 96, 0.35801931654088814 ], [ 98, 0.3581653092033976 ], [ 100, 0.3582810964874568 ], [ 102, 0.35845226029867483 ], [ 104, 0.3585076368258336 ], [ 106, 0.3586385267991179 ], [ 108, 0.3587945879211108 ], [ 110, 0.3589003067456866 ], [ 112, 0.3590765047866463 ], [ 114, 0.3592124289896724 ], [ 116, 0.35931311358450646 ], [ 118, 0.35940372971985723 ], [ 120, 0.3594842773957245 ], [ 122, 0.35959503045004204 ], [ 124, 0.3596655096664259 ], [ 126, 0.3597561258017766 ], [ 128, 0.3598568103966107 ], [ 130, 0.35994742653196143 ], [ 132, 0.3600128715186036 ], [ 134, 0.36006321381602063 ], [ 136, 0.3601638984108547 ], [ 138, 0.3602595487759472 ] ], "color": "#f7a35c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_adapter_content_plot", "title": "FastQC: Adapter Content", "ylab": "% of Sequences", "xlab": "Position (bp)", "yCeiling": 100, "yMinRange": 5, "ymin": 0, "xDecimals": false, "tt_label": "Base {point.x}: {point.y:.2f}%", "hide_empty": true, "yPlotBands": [ { "from": 20, "to": 100, "color": "#e6c3c3" }, { "from": 5, "to": 20, "color": "#e6dcc3" }, { "from": 0, "to": 5, "color": "#c3e6c3" } ] } }, "fastqc-status-check-heatmap": { "id": "fastqc-status-check-heatmap", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 680, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Status Checks", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ], "ticktext": [ "Basic
Statistics", "Per Base
Sequence
Quality", "Per Tile
Sequence
Quality", "Per
Sequence
Quality
Scores", "Per Base
Sequence
Content", "Per
Sequence
GC Content", "Per Base N
Content", "Sequence
Length
Distribution", "Sequence
Duplication
Levels", "Overrepresented
Sequences", "Adapter
Content" ], "tickangle": 0, "showgrid": false }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7 ], "ticktext": [ "rna_s1200_S21_1", "rna_s1200_S21_2", "rna_s1200_S21_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1221_S42_1", "rna_s1221_S42_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_trimmed_2" ], "showgrid": false, "autorange": "reversed", "ticklabelposition": "outside right" } }, "datasets": [ { "label": 1, "uid": "fastqc-status-check-heatmap", "dconfig": { "ylab": null }, "layout": { "title": { "text": "FastQC: Status Checks" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": ",.1f", "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "colorscale": [ [ 0.0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1.0, "#5cb85c" ] ], "reversescale": false, "showscale": false, "zmin": 0, "zmax": 1, "hovertemplate": "x: %{x}
y: %{y}
z: %{z}" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "rows": [ [ 1, 1, 1, 1, 0.25, 0.5, 1, 1, 0.25, 1, 0.25 ], [ 1, 1, 1, 1, 0.5, 0.5, 1, 1, 0.25, 0.5, 0.25 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 1, 1 ], [ 1, 1, 1, 1, 0.5, 1, 1, 0.5, 0.25, 0.5, 1 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 1, 0.25, 1, 0.25 ], [ 1, 1, 1, 1, 0.5, 1, 1, 1, 0.25, 0.5, 0.25 ], [ 1, 1, 1, 1, 0.25, 1, 1, 0.5, 0.25, 1, 1 ], [ 1, 1, 1, 1, 0.5, 1, 1, 0.5, 0.25, 0.5, 1 ] ], "xcats": [ "Basic Statistics", "Per Base Sequence Quality", "Per Tile Sequence Quality", "Per Sequence Quality Scores", "Per Base Sequence Content", "Per Sequence GC Content", "Per Base N Content", "Sequence Length Distribution", "Sequence Duplication Levels", "Overrepresented Sequences", "Adapter Content" ], "ycats": [ "rna_s1200_S21_1", "rna_s1200_S21_2", "rna_s1200_S21_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1221_S42_1", "rna_s1221_S42_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_trimmed_2" ] } ], "plot_type": "heatmap", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": false, "config": { "id": "fastqc-status-check-heatmap", "title": "FastQC: Status Checks", "xTitle": "Section Name", "yTitle": "Sample", "min": 0, "max": 1, "square": false, "colstops": [ [ 0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1, "#5cb85c" ] ], "decimalPlaces": 1, "legend": false, "datalabels": false, "xcats_samples": false, "angled_xticks": false }, "xcats_samples": false, "ycats_samples": true }, "fastqc_sequence_counts_plot-1": { "id": "fastqc_sequence_counts_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 300, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_counts_plot-1", "dconfig": {}, "layout": { "title": { "text": "FastQC: Sequence Counts" }, "xaxis": { "title": { "text": "Number of reads" }, "hoverformat": ",.0f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 9937706 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "cats": [ { "name": "Unique Reads", "data": [ 4690735, 4145006, 4838842, 4440350 ], "color": "0.49,0.71,0.93", "data_pct": [ 47.22847529492028, 41.733824969497604, 48.691740327194225, 44.68184106070355 ] }, { "name": "Duplicate Reads", "data": [ 5241271, 5787000, 5098864, 5497356 ], "color": "0.26,0.26,0.28", "data_pct": [ 52.77152470507972, 58.266175030502396, 51.308259672805775, 55.31815893929646 ] } ], "samples": [ "rna_s1221_S42_trimmed_2", "rna_s1221_S42_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1200_S21_trimmed_1" ] } ], "plot_type": "bar_graph", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_counts_plot", "title": "FastQC: Sequence Counts", "ylab": "Number of reads", "cpswitch_counts_label": "Number of reads", "hide_zero_cats": false } }, "fastqc_per_base_sequence_quality_plot-1": { "id": "fastqc_per_base_sequence_quality_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Mean Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_base_sequence_quality_plot-1", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Mean Quality Scores" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Phred Score" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 41.79215623858176 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 1, 38.94306794747198 ], [ 2, 39.39670523559462 ], [ 3, 39.47628456708218 ], [ 4, 39.59774559641833 ], [ 5, 39.58142271465869 ], [ 6, 39.58508553181187 ], [ 7, 39.59326850683649 ], [ 8, 39.63249486350271 ], [ 9, 39.635484889571096 ], [ 12, 39.66327625309101 ], [ 17, 39.75626978283675 ], [ 22, 39.80205356055406 ], [ 27, 39.73025252253767 ], [ 32, 39.72439460358404 ], [ 37, 39.74347277170697 ], [ 42, 39.75583839896649 ], [ 47, 39.760332920822194 ], [ 52, 39.76545823408362 ], [ 57, 39.76967942530913 ], [ 62, 39.76880745533617 ], [ 67, 39.77333886588867 ], [ 72, 39.772878776986374 ], [ 77, 39.76791594013832 ], [ 82, 39.7678818949237 ], [ 87, 39.76467587602449 ], [ 92, 39.766284196368005 ], [ 97, 39.76434309170602 ], [ 102, 39.763928020467894 ], [ 107, 39.75972969733292 ], [ 112, 39.75681886979599 ], [ 117, 39.75461865760445 ], [ 122, 39.754396492737335 ], [ 127, 39.742481928113584 ], [ 132, 39.73437040281548 ], [ 137, 39.72571135784959 ], [ 142, 39.715775764667185 ], [ 147, 39.70821165695177 ], [ 150, 39.69699054000168 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 1, 38.55978894928065 ], [ 2, 39.30448737364539 ], [ 3, 39.39223076231074 ], [ 4, 39.510513190871215 ], [ 5, 39.54694453629439 ], [ 6, 39.5582058877572 ], [ 7, 39.6133659015471 ], [ 8, 39.61380081077061 ], [ 9, 39.6457580854173 ], [ 12, 39.68760432236574 ], [ 17, 39.7116128590245 ], [ 22, 39.742937683400484 ], [ 27, 39.64081064854827 ], [ 32, 39.63123260046743 ], [ 37, 39.64516179599552 ], [ 42, 39.65977627596425 ], [ 47, 39.66191889995811 ], [ 52, 39.6813844955296 ], [ 57, 39.68699661778756 ], [ 62, 39.69054729283711 ], [ 67, 39.69864900759071 ], [ 72, 39.69599614292183 ], [ 77, 39.70361384460513 ], [ 82, 39.69537312407714 ], [ 87, 39.7014991479501 ], [ 92, 39.7048192412924 ], [ 97, 39.704836485389094 ], [ 102, 39.70420606111101 ], [ 107, 39.70431610819084 ], [ 112, 39.6998588225954 ], [ 117, 39.70126648221349 ], [ 122, 39.69617588583934 ], [ 127, 39.680323494553065 ], [ 132, 39.65815704757692 ], [ 137, 39.62799233367437 ], [ 142, 39.57751194795751 ], [ 147, 39.525079330368655 ], [ 150, 39.47454521504531 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 1, 38.88678681829229 ], [ 2, 39.37229840578026 ], [ 3, 39.45641897517984 ], [ 4, 39.59082767368445 ], [ 5, 39.57253469238742 ], [ 6, 39.57983573509722 ], [ 7, 39.57732526540963 ], [ 8, 39.6219468655174 ], [ 9, 39.62334456906289 ], [ 12, 39.655177614673214 ], [ 17, 39.75015081572302 ], [ 22, 39.79460996441105 ], [ 27, 39.7177865939076 ], [ 32, 39.710983830263956 ], [ 37, 39.730423389299574 ], [ 42, 39.74263859167057 ], [ 47, 39.747419416169805 ], [ 52, 39.752281501490955 ], [ 57, 39.75580567691223 ], [ 62, 39.75653614171501 ], [ 67, 39.76014430568049 ], [ 72, 39.759037296441974 ], [ 77, 39.75351892005919 ], [ 82, 39.75326868702665 ], [ 87, 39.75039149158128 ], [ 92, 39.751845369698216 ], [ 97, 39.74875447924235 ], [ 102, 39.74717572341797 ], [ 107, 39.74454724028804 ], [ 112, 39.73954651373164 ], [ 117, 39.73811176871098 ], [ 122, 39.73480046158572 ], [ 127, 39.72239541150465 ], [ 132, 39.71202989556686 ], [ 137, 39.702701200907725 ], [ 142, 39.69047640456341 ], [ 147, 39.68299301781765 ], [ 150, 39.66862967920953 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 1, 38.498900624909005 ], [ 2, 39.30910734447804 ], [ 3, 39.371919831703686 ], [ 4, 39.51578442461674 ], [ 5, 39.551455566982135 ], [ 6, 39.563159345654846 ], [ 7, 39.61885685530194 ], [ 8, 39.619765433085725 ], [ 9, 39.646874558875616 ], [ 12, 39.684223428781664 ], [ 17, 39.710981426526715 ], [ 22, 39.737268059527175 ], [ 27, 39.63511155094139 ], [ 32, 39.624342432755064 ], [ 37, 39.63614565804456 ], [ 42, 39.6490580015017 ], [ 47, 39.649272663052535 ], [ 52, 39.66730035987424 ], [ 57, 39.67134964505194 ], [ 62, 39.67465411832068 ], [ 67, 39.681925646409766 ], [ 72, 39.67876141755537 ], [ 77, 39.6859209505747 ], [ 82, 39.67702972813373 ], [ 87, 39.68203692625376 ], [ 92, 39.68451130343087 ], [ 97, 39.682972729662325 ], [ 102, 39.681027551278326 ], [ 107, 39.679851836497924 ], [ 112, 39.67386090284102 ], [ 117, 39.67507006577069 ], [ 122, 39.6679497505624 ], [ 127, 39.652008572714024 ], [ 132, 39.630803686418304 ], [ 137, 39.59959828029385 ], [ 142, 39.55011519618961 ], [ 147, 39.498174762377396 ], [ 150, 39.44704549711975 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_base_sequence_quality_plot", "title": "FastQC: Mean Quality Scores", "ylab": "Phred Score", "xlab": "Position (bp)", "ymin": 0, "xmin": 0, "xDecimals": false, "tt_label": "Base {point.x}: {point.y:.2f}", "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c" }, "yPlotBands": [ { "from": 28, "to": 100, "color": "#c3e6c3" }, { "from": 20, "to": 28, "color": "#e6dcc3" }, { "from": 0, "to": 20, "color": "#e6c3c3" } ] } }, "fastqc_per_sequence_quality_scores_plot-1": { "id": "fastqc_per_sequence_quality_scores_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_sequence_quality_scores_plot-1", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence Quality Scores" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Mean Sequence Quality (Phred Score)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 40.0 ] }, "yaxis": { "hoverformat": null, "ticksuffix": " reads", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
Phred %{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 20.0, 217.0 ], [ 21.0, 1320.0 ], [ 22.0, 2098.0 ], [ 23.0, 2624.0 ], [ 24.0, 3342.0 ], [ 25.0, 4015.0 ], [ 26.0, 4811.0 ], [ 27.0, 5566.0 ], [ 28.0, 6677.0 ], [ 29.0, 7780.0 ], [ 30.0, 9474.0 ], [ 31.0, 11060.0 ], [ 32.0, 14252.0 ], [ 33.0, 18391.0 ], [ 34.0, 25774.0 ], [ 35.0, 37612.0 ], [ 36.0, 57989.0 ], [ 37.0, 86507.0 ], [ 38.0, 205023.0 ], [ 39.0, 2850206.0 ], [ 40.0, 6582968.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 19.0, 3.0 ], [ 20.0, 580.0 ], [ 21.0, 3415.0 ], [ 22.0, 5656.0 ], [ 23.0, 6518.0 ], [ 24.0, 7522.0 ], [ 25.0, 7766.0 ], [ 26.0, 8605.0 ], [ 27.0, 8996.0 ], [ 28.0, 10147.0 ], [ 29.0, 10800.0 ], [ 30.0, 12369.0 ], [ 31.0, 13965.0 ], [ 32.0, 16788.0 ], [ 33.0, 20340.0 ], [ 34.0, 27088.0 ], [ 35.0, 37573.0 ], [ 36.0, 56343.0 ], [ 37.0, 86283.0 ], [ 38.0, 213244.0 ], [ 39.0, 3370681.0 ], [ 40.0, 6013024.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 20.0, 190.0 ], [ 21.0, 1375.0 ], [ 22.0, 2243.0 ], [ 23.0, 2840.0 ], [ 24.0, 3643.0 ], [ 25.0, 4145.0 ], [ 26.0, 5166.0 ], [ 27.0, 5809.0 ], [ 28.0, 7002.0 ], [ 29.0, 8249.0 ], [ 30.0, 9928.0 ], [ 31.0, 11879.0 ], [ 32.0, 15163.0 ], [ 33.0, 19501.0 ], [ 34.0, 27333.0 ], [ 35.0, 39480.0 ], [ 36.0, 61042.0 ], [ 37.0, 92744.0 ], [ 38.0, 222708.0 ], [ 39.0, 2922299.0 ], [ 40.0, 6469267.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 19.0, 2.0 ], [ 20.0, 578.0 ], [ 21.0, 3634.0 ], [ 22.0, 5858.0 ], [ 23.0, 6769.0 ], [ 24.0, 7799.0 ], [ 25.0, 8361.0 ], [ 26.0, 9386.0 ], [ 27.0, 10097.0 ], [ 28.0, 10893.0 ], [ 29.0, 12005.0 ], [ 30.0, 13618.0 ], [ 31.0, 15026.0 ], [ 32.0, 17875.0 ], [ 33.0, 21638.0 ], [ 34.0, 28818.0 ], [ 35.0, 39637.0 ], [ 36.0, 59322.0 ], [ 37.0, 90306.0 ], [ 38.0, 221392.0 ], [ 39.0, 3274143.0 ], [ 40.0, 6074849.0 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_sequence_quality_scores_plot", "title": "FastQC: Per Sequence Quality Scores", "ylab": "Count", "xlab": "Mean Sequence Quality (Phred Score)", "ymin": 0, "xmin": 0, "xDecimals": false, "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c" }, "tt_label": "Phred {point.x}: {point.y} reads", "xPlotBands": [ { "from": 28, "to": 100, "color": "#c3e6c3" }, { "from": 20, "to": 28, "color": "#e6dcc3" }, { "from": 0, "to": 20, "color": "#e6c3c3" } ] } }, "fastqc_per_sequence_gc_content_plot-1": { "id": "fastqc_per_sequence_gc_content_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": "Percentages", "uid": "fastqc_per_sequence_gc_content_plot-1_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "% GC", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 9.992220556685592e-05 ], [ 2.0, 0.0003447316092056529 ], [ 3.0, 0.0008293543062049041 ], [ 4.0, 0.0008743192987099894 ], [ 5.0, 0.00045964214560753727 ], [ 6.0, 0.0002647938447521682 ], [ 7.0, 0.00017985997002034068 ], [ 8.0, 0.0001298988672369127 ], [ 9.0, 0.0001249027569585699 ], [ 10.0, 0.00014988330835028388 ], [ 11.0, 0.00015487941862862668 ], [ 12.0, 0.00016487163918531226 ], [ 13.0, 0.000244809403638797 ], [ 14.0, 0.0003996888222674237 ], [ 15.0, 0.0004696343661642228 ], [ 16.0, 0.0006045293436794783 ], [ 17.0, 0.0013939147676576401 ], [ 18.0, 0.0026129656755732827 ], [ 19.0, 0.004326631501044862 ], [ 20.0, 0.007104468815803456 ], [ 21.0, 0.011031411494580893 ], [ 22.0, 0.016487163918531226 ], [ 23.0, 0.023931368233261995 ], [ 24.0, 0.0336338143938037 ], [ 25.0, 0.046698642771670115 ], [ 26.0, 0.06418003263559156 ], [ 27.0, 0.08649765724894883 ], [ 28.0, 0.11826292639865234 ], [ 29.0, 0.16088474318319473 ], [ 30.0, 0.21622665673639788 ], [ 31.0, 0.28463339866746745 ], [ 32.0, 0.3746732981037613 ], [ 33.0, 0.4906729865463244 ], [ 34.0, 0.6391024268056105 ], [ 35.0, 0.8025002134588116 ], [ 36.0, 0.9820853974138434 ], [ 37.0, 1.2232376483288934 ], [ 38.0, 1.4873570181934854 ], [ 39.0, 1.7208252515004443 ], [ 40.0, 1.9471540432196515 ], [ 41.0, 2.1875119126004448 ], [ 42.0, 2.404657853628058 ], [ 43.0, 2.584003224289729 ], [ 44.0, 2.7190680695544485 ], [ 45.0, 2.847872788640404 ], [ 46.0, 2.9624785623153094 ], [ 47.0, 3.001912860742269 ], [ 48.0, 3.016366607777515 ], [ 49.0, 3.056270540570639 ], [ 50.0, 3.108629776287671 ], [ 51.0, 3.175842447862217 ], [ 52.0, 3.255465457368166 ], [ 53.0, 3.3165279171900717 ], [ 54.0, 3.4409910164441477 ], [ 55.0, 3.5591740050783462 ], [ 56.0, 3.5418924596255583 ], [ 57.0, 3.4919363529524086 ], [ 58.0, 3.4457023484366243 ], [ 59.0, 3.4168348232483603 ], [ 60.0, 3.422275587341475 ], [ 61.0, 3.312875760576603 ], [ 62.0, 3.092971966675345 ], [ 63.0, 2.888421219659434 ], [ 64.0, 2.676491217762411 ], [ 65.0, 2.4617683902197944 ], [ 66.0, 2.207071684340157 ], [ 67.0, 1.9021191051706694 ], [ 68.0, 1.646113418398106 ], [ 69.0, 1.387414828185516 ], [ 70.0, 1.1100407777524808 ], [ 71.0, 0.8936992104796809 ], [ 72.0, 0.7235466827301604 ], [ 73.0, 0.5827313145350687 ], [ 74.0, 0.48115040035580303 ], [ 75.0, 0.39906930459290924 ], [ 76.0, 0.3205054704659687 ], [ 77.0, 0.26050218602307174 ], [ 78.0, 0.2132189983488355 ], [ 79.0, 0.16928320456108897 ], [ 80.0, 0.13694837883965438 ], [ 81.0, 0.11012925886551025 ], [ 82.0, 0.08444925203482828 ], [ 83.0, 0.06271617232403712 ], [ 84.0, 0.04446038536697254 ], [ 85.0, 0.03323412557153628 ], [ 86.0, 0.025914824013764083 ], [ 87.0, 0.01906515682215611 ], [ 88.0, 0.013424548317907093 ], [ 89.0, 0.009617512285809883 ], [ 90.0, 0.0072993171166588254 ], [ 91.0, 0.005245915792259936 ], [ 92.0, 0.003767067149870468 ], [ 93.0, 0.0027328723222535094 ], [ 94.0, 0.0017336502665849505 ], [ 95.0, 0.0012040625770806139 ], [ 96.0, 0.0008193620856482187 ], [ 97.0, 0.0006544904464629063 ], [ 98.0, 0.0006444982259062207 ], [ 99.0, 0.00040968104282410934 ], [ 100.0, 0.00010991442612354151 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.5008150175953053e-05 ], [ 2.0, 2.0010866901270736e-05 ], [ 3.0, 2.501358362658842e-05 ], [ 4.0, 3.501901707722378e-05 ], [ 5.0, 1.5008150175953053e-05 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 1.0005433450635368e-05 ], [ 9.0, 1.0005433450635368e-05 ], [ 10.0, 1.0005433450635368e-05 ], [ 11.0, 2.0010866901270736e-05 ], [ 12.0, 5.502988397849452e-05 ], [ 13.0, 0.00011005976795698904 ], [ 14.0, 0.00017509508538611894 ], [ 15.0, 0.00023512768608993117 ], [ 16.0, 0.0004052200547507324 ], [ 17.0, 0.0007404020753470172 ], [ 18.0, 0.0014207715499902221 ], [ 19.0, 0.0024813474957575713 ], [ 20.0, 0.0038821081788465227 ], [ 21.0, 0.006443499142209176 ], [ 22.0, 0.01036562905485824 ], [ 23.0, 0.015678514217145622 ], [ 24.0, 0.022382154629071317 ], [ 25.0, 0.032752786400654876 ], [ 26.0, 0.04647023566147596 ], [ 27.0, 0.06286914108706733 ], [ 28.0, 0.08579659183919827 ], [ 29.0, 0.11850935650605061 ], [ 30.0, 0.16074229110118252 ], [ 31.0, 0.21792334327156362 ], [ 32.0, 0.29216365947527806 ], [ 33.0, 0.38946149706598165 ], [ 34.0, 0.5188867814666754 ], [ 35.0, 0.676747507734075 ], [ 36.0, 0.8600470485497148 ], [ 37.0, 1.0705963873681603 ], [ 38.0, 1.3078352199161754 ], [ 39.0, 1.5533835649449432 ], [ 40.0, 1.7852794960303193 ], [ 41.0, 2.025875151501023 ], [ 42.0, 2.2535337815200545 ], [ 43.0, 2.445868228741618 ], [ 44.0, 2.6012576129467107 ], [ 45.0, 2.722753591337776 ], [ 46.0, 2.8158741604628394 ], [ 47.0, 2.862914705831001 ], [ 48.0, 2.9077940775738265 ], [ 49.0, 2.987037110502859 ], [ 50.0, 3.067966058968323 ], [ 51.0, 3.1253021953571887 ], [ 52.0, 3.189742189496006 ], [ 53.0, 3.2779250772131805 ], [ 54.0, 3.356727871070385 ], [ 55.0, 3.441273783728253 ], [ 56.0, 3.4635058568555657 ], [ 57.0, 3.435875852381636 ], [ 58.0, 3.427386242098772 ], [ 59.0, 3.4516444154998367 ], [ 60.0, 3.4627554493467674 ], [ 61.0, 3.3795302539043828 ], [ 62.0, 3.20760188820539 ], [ 63.0, 3.017563687960747 ], [ 64.0, 2.8389066682662016 ], [ 65.0, 2.5916573995508263 ], [ 66.0, 2.3201399520009343 ], [ 67.0, 2.082505904831619 ], [ 68.0, 1.8305240660940925 ], [ 69.0, 1.5553996597852464 ], [ 70.0, 1.2999759519407013 ], [ 71.0, 1.0710416291567135 ], [ 72.0, 0.8861362162722467 ], [ 73.0, 0.7421380180507025 ], [ 74.0, 0.6233735229916606 ], [ 75.0, 0.5226638325942903 ], [ 76.0, 0.4257061797409083 ], [ 77.0, 0.3516209477556787 ], [ 78.0, 0.30523575827853316 ], [ 79.0, 0.25903066660349905 ], [ 80.0, 0.22025460926556167 ], [ 81.0, 0.18156359811195472 ], [ 82.0, 0.14374806238527832 ], [ 83.0, 0.11549271832068406 ], [ 84.0, 0.0852913174499412 ], [ 85.0, 0.06020269307247301 ], [ 86.0, 0.045359632548455445 ], [ 87.0, 0.03347818032582594 ], [ 88.0, 0.0235377821926197 ], [ 89.0, 0.01731940530304982 ], [ 90.0, 0.012626857014701835 ], [ 91.0, 0.008609675484271734 ], [ 92.0, 0.00591821388605082 ], [ 93.0, 0.004292330950322573 ], [ 94.0, 0.0032017387042033176 ], [ 95.0, 0.0027214778985728202 ], [ 96.0, 0.002546382813186701 ], [ 97.0, 0.0029115811341348923 ], [ 98.0, 0.004542466786588457 ], [ 99.0, 0.010660789341651985 ], [ 100.0, 0.13795491641736046 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.4927946534066693e-05 ], [ 3.0, 2.9855893068133386e-05 ], [ 4.0, 4.478383960220008e-05 ], [ 5.0, 3.483187524615562e-05 ], [ 6.0, 1.9903928712088924e-05 ], [ 7.0, 3.483187524615562e-05 ], [ 8.0, 4.478383960220008e-05 ], [ 9.0, 2.9855893068133386e-05 ], [ 10.0, 9.951964356044462e-06 ], [ 11.0, 4.478383960220008e-05 ], [ 12.0, 5.4735803958244545e-05 ], [ 13.0, 6.468776831428901e-05 ], [ 14.0, 0.00012439955445055578 ], [ 15.0, 0.00021894321583297818 ], [ 16.0, 0.0004428624138439786 ], [ 17.0, 0.0009504125960022461 ], [ 18.0, 0.001965512960318781 ], [ 19.0, 0.0037120827048045843 ], [ 20.0, 0.005951274684914588 ], [ 21.0, 0.00912097533231475 ], [ 22.0, 0.014430348316264472 ], [ 23.0, 0.02121261202490877 ], [ 24.0, 0.029850917085955362 ], [ 25.0, 0.04122103636273616 ], [ 26.0, 0.05757708978189524 ], [ 27.0, 0.08247192861854045 ], [ 28.0, 0.11574632144297511 ], [ 29.0, 0.15495208502361227 ], [ 30.0, 0.20845882138388533 ], [ 31.0, 0.2817152310087286 ], [ 32.0, 0.37465165014764984 ], [ 33.0, 0.49118417677475246 ], [ 34.0, 0.6494054820893254 ], [ 35.0, 0.8222163671498594 ], [ 36.0, 1.0065267470238028 ], [ 37.0, 1.2577740391565013 ], [ 38.0, 1.5297910809002646 ], [ 39.0, 1.7789285565894815 ], [ 40.0, 2.020701578655226 ], [ 41.0, 2.251467728143185 ], [ 42.0, 2.4647532522397517 ], [ 43.0, 2.6669174561684392 ], [ 44.0, 2.829686809193724 ], [ 45.0, 2.9572361603629678 ], [ 46.0, 3.0572981859808173 ], [ 47.0, 3.1092474399193692 ], [ 48.0, 3.1234339651089105 ], [ 49.0, 3.1570666286501625 ], [ 50.0, 3.2122452950222513 ], [ 51.0, 3.2915524989755696 ], [ 52.0, 3.3772687679741806 ], [ 53.0, 3.4065922309492658 ], [ 54.0, 3.4803910226315136 ], [ 55.0, 3.5573595149611617 ], [ 56.0, 3.5214030677427726 ], [ 57.0, 3.430422209599814 ], [ 58.0, 3.3583202278402715 ], [ 59.0, 3.3028230986087896 ], [ 60.0, 3.2816005346195256 ], [ 61.0, 3.170103701956581 ], [ 62.0, 2.925205763083039 ], [ 63.0, 2.7039586675016363 ], [ 64.0, 2.483960543446918 ], [ 65.0, 2.263320517691234 ], [ 66.0, 2.004176341842014 ], [ 67.0, 1.706463328130944 ], [ 68.0, 1.4793395975972972 ], [ 69.0, 1.2463740639866523 ], [ 70.0, 0.9931712108579911 ], [ 71.0, 0.7982520369805044 ], [ 72.0, 0.6451858492023625 ], [ 73.0, 0.5190994367934572 ], [ 74.0, 0.4270089346247998 ], [ 75.0, 0.36986475529239243 ], [ 76.0, 0.3640627600728185 ], [ 77.0, 0.31491000811831493 ], [ 78.0, 0.24848064604171813 ], [ 79.0, 0.2085185331700216 ], [ 80.0, 0.1560567530671332 ], [ 81.0, 0.1494984085564999 ], [ 82.0, 0.16725271296768324 ], [ 83.0, 0.14198467546768637 ], [ 84.0, 0.11229298981142768 ], [ 85.0, 0.10875506648285388 ], [ 86.0, 0.10991944631251109 ], [ 87.0, 0.0905379957291145 ], [ 88.0, 0.05895046086302937 ], [ 89.0, 0.055208522265156657 ], [ 90.0, 0.047998324089202446 ], [ 91.0, 0.041539499222129586 ], [ 92.0, 0.032189628709625814 ], [ 93.0, 0.019371498619040545 ], [ 94.0, 0.011225815793618152 ], [ 95.0, 0.008289986308585037 ], [ 96.0, 0.007070870674969591 ], [ 97.0, 0.0051202856611848755 ], [ 98.0, 0.0038414582414331624 ], [ 99.0, 0.0020998644791253816 ], [ 100.0, 0.0005224781286923343 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 4.982589586337939e-06 ], [ 7.0, 4.982589586337939e-06 ], [ 8.0, 0.0 ], [ 9.0, 4.982589586337939e-06 ], [ 10.0, 1.9930358345351755e-05 ], [ 11.0, 1.9930358345351755e-05 ], [ 12.0, 1.9930358345351755e-05 ], [ 13.0, 4.982589586337938e-05 ], [ 14.0, 0.00013951250841746227 ], [ 15.0, 0.00028899019600760043 ], [ 16.0, 0.0005480848544971732 ], [ 17.0, 0.0010114656860266016 ], [ 18.0, 0.0017837670719089821 ], [ 19.0, 0.0029596582142847353 ], [ 20.0, 0.004598930188189918 ], [ 21.0, 0.0073841977669528245 ], [ 22.0, 0.01186852839465697 ], [ 23.0, 0.01800209617543897 ], [ 24.0, 0.02593936138647531 ], [ 25.0, 0.036333043263576247 ], [ 26.0, 0.05140537676224851 ], [ 27.0, 0.07192866326837448 ], [ 28.0, 0.0973049920315936 ], [ 29.0, 0.13201869367961003 ], [ 30.0, 0.17967218048334607 ], [ 31.0, 0.24069893773681317 ], [ 32.0, 0.3189853853173548 ], [ 33.0, 0.42647977305300955 ], [ 34.0, 0.5630126928978417 ], [ 35.0, 0.7315338378869635 ], [ 36.0, 0.9272649046070768 ], [ 37.0, 1.147749476392117 ], [ 38.0, 1.3918216272788808 ], [ 39.0, 1.6444688148437323 ], [ 40.0, 1.882935552445866 ], [ 41.0, 2.123101353096941 ], [ 42.0, 2.354283544723849 ], [ 43.0, 2.549117745318421 ], [ 44.0, 2.702840599236119 ], [ 45.0, 2.8205443130341803 ], [ 46.0, 2.9077894566909577 ], [ 47.0, 2.961287521079468 ], [ 48.0, 3.003026674044221 ], [ 49.0, 3.068657344075464 ], [ 50.0, 3.141966184659254 ], [ 51.0, 3.1982843947536326 ], [ 52.0, 3.260840807010105 ], [ 53.0, 3.330771451854358 ], [ 54.0, 3.389909807654603 ], [ 55.0, 3.4428548045990297 ], [ 56.0, 3.4487791036171855 ], [ 57.0, 3.404284578611188 ], [ 58.0, 3.352884184438526 ], [ 59.0, 3.341847748504787 ], [ 60.0, 3.333432154693462 ], [ 61.0, 3.234936323750734 ], [ 62.0, 3.0425037313367764 ], [ 63.0, 2.8196972728045027 ], [ 64.0, 2.617174936478211 ], [ 65.0, 2.367283120954604 ], [ 66.0, 2.084077711456742 ], [ 67.0, 1.8513359692893108 ], [ 68.0, 1.6289231353343578 ], [ 69.0, 1.3803915667678215 ], [ 70.0, 1.1494236264931263 ], [ 71.0, 0.9454264436492785 ], [ 72.0, 0.7806821015666009 ], [ 73.0, 0.6541093783048582 ], [ 74.0, 0.5599284699438986 ], [ 75.0, 0.47370973974190683 ], [ 76.0, 0.3891153337450613 ], [ 77.0, 0.33431681347451664 ], [ 78.0, 0.2972812250792668 ], [ 79.0, 0.25855155622466197 ], [ 80.0, 0.2235040210743609 ], [ 81.0, 0.20552185525726732 ], [ 82.0, 0.19793337131727462 ], [ 83.0, 0.17311509258772534 ], [ 84.0, 0.1491289063190945 ], [ 85.0, 0.1567572509757779 ], [ 86.0, 0.1475245124722937 ], [ 87.0, 0.11406642340003442 ], [ 88.0, 0.09802248493202625 ], [ 89.0, 0.0975142607942198 ], [ 90.0, 0.10362291562707011 ], [ 91.0, 0.1011266382443148 ], [ 92.0, 0.06627342408788092 ], [ 93.0, 0.028191491879500055 ], [ 94.0, 0.01621832910352999 ], [ 95.0, 0.012725533803507097 ], [ 96.0, 0.011469921227749934 ], [ 97.0, 0.010558107333450093 ], [ 98.0, 0.010717550200212906 ], [ 99.0, 0.013811738333328766 ], [ 100.0, 0.13856083380647172 ] ], "color": "#5cb85c", "marker": {} } ] }, { "label": "Counts", "uid": "fastqc_per_sequence_gc_content_plot-1_Counts", "dconfig": { "name": "Counts", "ylab": "Count", "tt_suffix": "", "categories": [] }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "% GC", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 10.0 ], [ 2.0, 34.5 ], [ 3.0, 83.0 ], [ 4.0, 87.5 ], [ 5.0, 46.0 ], [ 6.0, 26.5 ], [ 7.0, 18.0 ], [ 8.0, 13.0 ], [ 9.0, 12.5 ], [ 10.0, 15.0 ], [ 11.0, 15.5 ], [ 12.0, 16.5 ], [ 13.0, 24.5 ], [ 14.0, 40.0 ], [ 15.0, 47.0 ], [ 16.0, 60.5 ], [ 17.0, 139.5 ], [ 18.0, 261.5 ], [ 19.0, 433.0 ], [ 20.0, 711.0 ], [ 21.0, 1104.0 ], [ 22.0, 1650.0 ], [ 23.0, 2395.0 ], [ 24.0, 3366.0 ], [ 25.0, 4673.5 ], [ 26.0, 6423.0 ], [ 27.0, 8656.5 ], [ 28.0, 11835.5 ], [ 29.0, 16101.0 ], [ 30.0, 21639.5 ], [ 31.0, 28485.5 ], [ 32.0, 37496.5 ], [ 33.0, 49105.5 ], [ 34.0, 63960.0 ], [ 35.0, 80312.5 ], [ 36.0, 98285.0 ], [ 37.0, 122419.0 ], [ 38.0, 148851.5 ], [ 39.0, 172216.5 ], [ 40.0, 194867.0 ], [ 41.0, 218921.5 ], [ 42.0, 240653.0 ], [ 43.0, 258601.5 ], [ 44.0, 272118.5 ], [ 45.0, 285009.0 ], [ 46.0, 296478.5 ], [ 47.0, 300425.0 ], [ 48.0, 301871.5 ], [ 49.0, 305865.0 ], [ 50.0, 311105.0 ], [ 51.0, 317831.5 ], [ 52.0, 325800.0 ], [ 53.0, 331911.0 ], [ 54.0, 344367.0 ], [ 55.0, 356194.5 ], [ 56.0, 354465.0 ], [ 57.0, 349465.5 ], [ 58.0, 344838.5 ], [ 59.0, 341949.5 ], [ 60.0, 342494.0 ], [ 61.0, 331545.5 ], [ 62.0, 309538.0 ], [ 63.0, 289067.0 ], [ 64.0, 267857.5 ], [ 65.0, 246368.5 ], [ 66.0, 220879.0 ], [ 67.0, 190360.0 ], [ 68.0, 164739.5 ], [ 69.0, 138849.5 ], [ 70.0, 111090.5 ], [ 71.0, 89439.5 ], [ 72.0, 72411.0 ], [ 73.0, 58318.5 ], [ 74.0, 48152.5 ], [ 75.0, 39938.0 ], [ 76.0, 32075.5 ], [ 77.0, 26070.5 ], [ 78.0, 21338.5 ], [ 79.0, 16941.5 ], [ 80.0, 13705.5 ], [ 81.0, 11021.5 ], [ 82.0, 8451.5 ], [ 83.0, 6276.5 ], [ 84.0, 4449.5 ], [ 85.0, 3326.0 ], [ 86.0, 2593.5 ], [ 87.0, 1908.0 ], [ 88.0, 1343.5 ], [ 89.0, 962.5 ], [ 90.0, 730.5 ], [ 91.0, 525.0 ], [ 92.0, 377.0 ], [ 93.0, 273.5 ], [ 94.0, 173.5 ], [ 95.0, 120.5 ], [ 96.0, 82.0 ], [ 97.0, 65.5 ], [ 98.0, 64.5 ], [ 99.0, 41.0 ], [ 100.0, 11.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 1.5 ], [ 2.0, 2.0 ], [ 3.0, 2.5 ], [ 4.0, 3.5 ], [ 5.0, 1.5 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 1.0 ], [ 9.0, 1.0 ], [ 10.0, 1.0 ], [ 11.0, 2.0 ], [ 12.0, 5.5 ], [ 13.0, 11.0 ], [ 14.0, 17.5 ], [ 15.0, 23.5 ], [ 16.0, 40.5 ], [ 17.0, 74.0 ], [ 18.0, 142.0 ], [ 19.0, 248.0 ], [ 20.0, 388.0 ], [ 21.0, 644.0 ], [ 22.0, 1036.0 ], [ 23.0, 1567.0 ], [ 24.0, 2237.0 ], [ 25.0, 3273.5 ], [ 26.0, 4644.5 ], [ 27.0, 6283.5 ], [ 28.0, 8575.0 ], [ 29.0, 11844.5 ], [ 30.0, 16065.5 ], [ 31.0, 21780.5 ], [ 32.0, 29200.5 ], [ 33.0, 38925.0 ], [ 34.0, 51860.5 ], [ 35.0, 67638.0 ], [ 36.0, 85958.0 ], [ 37.0, 107001.5 ], [ 38.0, 130712.5 ], [ 39.0, 155254.0 ], [ 40.0, 178431.0 ], [ 41.0, 202477.5 ], [ 42.0, 225231.0 ], [ 43.0, 244454.0 ], [ 44.0, 259984.5 ], [ 45.0, 272127.5 ], [ 46.0, 281434.5 ], [ 47.0, 286136.0 ], [ 48.0, 290621.5 ], [ 49.0, 298541.5 ], [ 50.0, 306630.0 ], [ 51.0, 312360.5 ], [ 52.0, 318801.0 ], [ 53.0, 327614.5 ], [ 54.0, 335490.5 ], [ 55.0, 343940.5 ], [ 56.0, 346162.5 ], [ 57.0, 343401.0 ], [ 58.0, 342552.5 ], [ 59.0, 344977.0 ], [ 60.0, 346087.5 ], [ 61.0, 337769.5 ], [ 62.0, 320586.0 ], [ 63.0, 301592.5 ], [ 64.0, 283736.5 ], [ 65.0, 259025.0 ], [ 66.0, 231888.0 ], [ 67.0, 208137.5 ], [ 68.0, 182953.0 ], [ 69.0, 155455.5 ], [ 70.0, 129927.0 ], [ 71.0, 107046.0 ], [ 72.0, 88565.5 ], [ 73.0, 74173.5 ], [ 74.0, 62303.5 ], [ 75.0, 52238.0 ], [ 76.0, 42547.5 ], [ 77.0, 35143.0 ], [ 78.0, 30507.0 ], [ 79.0, 25889.0 ], [ 80.0, 22013.5 ], [ 81.0, 18146.5 ], [ 82.0, 14367.0 ], [ 83.0, 11543.0 ], [ 84.0, 8524.5 ], [ 85.0, 6017.0 ], [ 86.0, 4533.5 ], [ 87.0, 3346.0 ], [ 88.0, 2352.5 ], [ 89.0, 1731.0 ], [ 90.0, 1262.0 ], [ 91.0, 860.5 ], [ 92.0, 591.5 ], [ 93.0, 429.0 ], [ 94.0, 320.0 ], [ 95.0, 272.0 ], [ 96.0, 254.5 ], [ 97.0, 291.0 ], [ 98.0, 454.0 ], [ 99.0, 1065.5 ], [ 100.0, 13788.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 1.5 ], [ 3.0, 3.0 ], [ 4.0, 4.5 ], [ 5.0, 3.5 ], [ 6.0, 2.0 ], [ 7.0, 3.5 ], [ 8.0, 4.5 ], [ 9.0, 3.0 ], [ 10.0, 1.0 ], [ 11.0, 4.5 ], [ 12.0, 5.5 ], [ 13.0, 6.5 ], [ 14.0, 12.5 ], [ 15.0, 22.0 ], [ 16.0, 44.5 ], [ 17.0, 95.5 ], [ 18.0, 197.5 ], [ 19.0, 373.0 ], [ 20.0, 598.0 ], [ 21.0, 916.5 ], [ 22.0, 1450.0 ], [ 23.0, 2131.5 ], [ 24.0, 2999.5 ], [ 25.0, 4142.0 ], [ 26.0, 5785.5 ], [ 27.0, 8287.0 ], [ 28.0, 11630.5 ], [ 29.0, 15570.0 ], [ 30.0, 20946.5 ], [ 31.0, 28307.5 ], [ 32.0, 37646.0 ], [ 33.0, 49355.5 ], [ 34.0, 65254.0 ], [ 35.0, 82618.5 ], [ 36.0, 101138.5 ], [ 37.0, 126384.5 ], [ 38.0, 153717.5 ], [ 39.0, 178751.5 ], [ 40.0, 203045.5 ], [ 41.0, 226233.5 ], [ 42.0, 247665.0 ], [ 43.0, 267979.0 ], [ 44.0, 284334.5 ], [ 45.0, 297151.0 ], [ 46.0, 307205.5 ], [ 47.0, 312425.5 ], [ 48.0, 313851.0 ], [ 49.0, 317230.5 ], [ 50.0, 322775.0 ], [ 51.0, 330744.0 ], [ 52.0, 339357.0 ], [ 53.0, 342303.5 ], [ 54.0, 349719.0 ], [ 55.0, 357453.0 ], [ 56.0, 353840.0 ], [ 57.0, 344698.0 ], [ 58.0, 337453.0 ], [ 59.0, 331876.5 ], [ 60.0, 329744.0 ], [ 61.0, 318540.5 ], [ 62.0, 293932.5 ], [ 63.0, 271701.0 ], [ 64.0, 249595.0 ], [ 65.0, 227424.5 ], [ 66.0, 201385.0 ], [ 67.0, 171470.0 ], [ 68.0, 148648.0 ], [ 69.0, 125239.0 ], [ 70.0, 99796.5 ], [ 71.0, 80210.5 ], [ 72.0, 64830.0 ], [ 73.0, 52160.5 ], [ 74.0, 42907.0 ], [ 75.0, 37165.0 ], [ 76.0, 36582.0 ], [ 77.0, 31643.0 ], [ 78.0, 24968.0 ], [ 79.0, 20952.5 ], [ 80.0, 15681.0 ], [ 81.0, 15022.0 ], [ 82.0, 16806.0 ], [ 83.0, 14267.0 ], [ 84.0, 11283.5 ], [ 85.0, 10928.0 ], [ 86.0, 11045.0 ], [ 87.0, 9097.5 ], [ 88.0, 5923.5 ], [ 89.0, 5547.5 ], [ 90.0, 4823.0 ], [ 91.0, 4174.0 ], [ 92.0, 3234.5 ], [ 93.0, 1946.5 ], [ 94.0, 1128.0 ], [ 95.0, 833.0 ], [ 96.0, 710.5 ], [ 97.0, 514.5 ], [ 98.0, 386.0 ], [ 99.0, 211.0 ], [ 100.0, 52.5 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.5 ], [ 7.0, 0.5 ], [ 8.0, 0.0 ], [ 9.0, 0.5 ], [ 10.0, 2.0 ], [ 11.0, 2.0 ], [ 12.0, 2.0 ], [ 13.0, 5.0 ], [ 14.0, 14.0 ], [ 15.0, 29.0 ], [ 16.0, 55.0 ], [ 17.0, 101.5 ], [ 18.0, 179.0 ], [ 19.0, 297.0 ], [ 20.0, 461.5 ], [ 21.0, 741.0 ], [ 22.0, 1191.0 ], [ 23.0, 1806.5 ], [ 24.0, 2603.0 ], [ 25.0, 3646.0 ], [ 26.0, 5158.5 ], [ 27.0, 7218.0 ], [ 28.0, 9764.5 ], [ 29.0, 13248.0 ], [ 30.0, 18030.0 ], [ 31.0, 24154.0 ], [ 32.0, 32010.0 ], [ 33.0, 42797.0 ], [ 34.0, 56498.0 ], [ 35.0, 73409.0 ], [ 36.0, 93050.5 ], [ 37.0, 115176.0 ], [ 38.0, 139668.5 ], [ 39.0, 165021.5 ], [ 40.0, 188951.5 ], [ 41.0, 213052.0 ], [ 42.0, 236251.0 ], [ 43.0, 255802.5 ], [ 44.0, 271228.5 ], [ 45.0, 283040.0 ], [ 46.0, 291795.0 ], [ 47.0, 297163.5 ], [ 48.0, 301352.0 ], [ 49.0, 307938.0 ], [ 50.0, 315294.5 ], [ 51.0, 320946.0 ], [ 52.0, 327223.5 ], [ 53.0, 334241.0 ], [ 54.0, 340175.5 ], [ 55.0, 345488.5 ], [ 56.0, 346083.0 ], [ 57.0, 341618.0 ], [ 58.0, 336460.0 ], [ 59.0, 335352.5 ], [ 60.0, 334508.0 ], [ 61.0, 324624.0 ], [ 62.0, 305313.5 ], [ 63.0, 282955.0 ], [ 64.0, 262632.0 ], [ 65.0, 237555.5 ], [ 66.0, 209136.0 ], [ 67.0, 185780.5 ], [ 68.0, 163461.5 ], [ 69.0, 138521.5 ], [ 70.0, 115344.0 ], [ 71.0, 94873.0 ], [ 72.0, 78341.0 ], [ 73.0, 65639.5 ], [ 74.0, 56188.5 ], [ 75.0, 47536.5 ], [ 76.0, 39047.5 ], [ 77.0, 33548.5 ], [ 78.0, 29832.0 ], [ 79.0, 25945.5 ], [ 80.0, 22428.5 ], [ 81.0, 20624.0 ], [ 82.0, 19862.5 ], [ 83.0, 17372.0 ], [ 84.0, 14965.0 ], [ 85.0, 15730.5 ], [ 86.0, 14804.0 ], [ 87.0, 11446.5 ], [ 88.0, 9836.5 ], [ 89.0, 9785.5 ], [ 90.0, 10398.5 ], [ 91.0, 10148.0 ], [ 92.0, 6650.5 ], [ 93.0, 2829.0 ], [ 94.0, 1627.5 ], [ 95.0, 1277.0 ], [ 96.0, 1151.0 ], [ 97.0, 1059.5 ], [ 98.0, 1075.5 ], [ 99.0, 1386.0 ], [ 100.0, 13904.5 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_sequence_gc_content_plot", "title": "FastQC: Per Sequence GC Content", "xlab": "% GC", "ylab": "Percentage", "ymin": 0, "xmax": 100, "xmin": 0, "yDecimals": false, "tt_label": "{point.x}% GC: {point.y}", "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#f0ad4e" }, "data_labels": [ { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "categories": [] }, { "name": "Counts", "ylab": "Count", "tt_suffix": "", "categories": [] } ] } }, "fastqc_per_base_n_content_plot-1": { "id": "fastqc_per_base_n_content_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Base N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_per_base_n_content_plot-1", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Per Base N Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position in Read (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage N-Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 12, 0.0 ], [ 17, 0.0 ], [ 22, 0.0 ], [ 27, 0.0 ], [ 32, 0.0 ], [ 37, 0.0 ], [ 42, 0.0 ], [ 47, 0.0 ], [ 52, 0.0 ], [ 57, 0.0 ], [ 62, 0.0 ], [ 67, 0.0 ], [ 72, 0.0 ], [ 77, 0.0 ], [ 82, 0.0 ], [ 87, 0.0 ], [ 92, 0.0 ], [ 97, 0.0 ], [ 102, 0.0 ], [ 107, 0.0 ], [ 112, 0.0 ], [ 117, 0.0 ], [ 122, 0.0 ], [ 127, 0.0 ], [ 132, 0.0 ], [ 137, 0.0 ], [ 142, 0.0 ], [ 147, 0.0 ], [ 150, 0.0 ] ], "color": "#5cb85c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_per_base_n_content_plot", "title": "FastQC: Per Base N Content", "ylab": "Percentage N-Count", "xlab": "Position in Read (bp)", "yCeiling": 100, "yMinRange": 5, "ymin": 0, "xmin": 0, "xDecimals": false, "colors": { "rna_s1221_S42_trimmed_1": "#5cb85c", "rna_s1200_S21_trimmed_2": "#5cb85c", "rna_s1221_S42_trimmed_2": "#5cb85c", "rna_s1200_S21_trimmed_1": "#5cb85c" }, "tt_label": "Base {point.x}: {point.y:.2f}%", "yPlotBands": [ { "from": 20, "to": 100, "color": "#e6c3c3" }, { "from": 5, "to": 20, "color": "#e6dcc3" }, { "from": 0, "to": 5, "color": "#c3e6c3" } ] } }, "fastqc_sequence_length_distribution_plot-1": { "id": "fastqc_sequence_length_distribution_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Length Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_length_distribution_plot-1", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Sequence Length Distribution" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Sequence Length (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ [ 17, 2.0 ], [ 22, 16.0 ], [ 27, 36.0 ], [ 32, 161.0 ], [ 37, 279.0 ], [ 42, 612.0 ], [ 47, 881.0 ], [ 52, 1367.0 ], [ 57, 2175.0 ], [ 62, 4583.0 ], [ 67, 9800.0 ], [ 72, 19754.0 ], [ 77, 36140.0 ], [ 82, 55336.0 ], [ 87, 84877.0 ], [ 92, 112059.0 ], [ 97, 150451.0 ], [ 102, 179521.0 ], [ 107, 219299.0 ], [ 112, 242182.0 ], [ 117, 272020.0 ], [ 122, 288438.0 ], [ 127, 304154.0 ], [ 132, 315151.0 ], [ 137, 318119.0 ], [ 142, 324693.0 ], [ 147, 322343.0 ], [ 150, 6673257.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ [ 17, 3.0 ], [ 22, 16.0 ], [ 27, 34.0 ], [ 32, 161.0 ], [ 37, 277.0 ], [ 42, 609.0 ], [ 47, 879.0 ], [ 52, 1361.0 ], [ 57, 2166.0 ], [ 62, 4567.0 ], [ 67, 9763.0 ], [ 72, 19709.0 ], [ 77, 36077.0 ], [ 82, 55243.0 ], [ 87, 84726.0 ], [ 92, 111904.0 ], [ 97, 150231.0 ], [ 102, 179269.0 ], [ 107, 218999.0 ], [ 112, 241818.0 ], [ 117, 271651.0 ], [ 122, 288010.0 ], [ 127, 303755.0 ], [ 132, 314756.0 ], [ 137, 317800.0 ], [ 142, 326211.0 ], [ 147, 324722.0 ], [ 150, 6672989.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ [ 17, 8.0 ], [ 22, 58.0 ], [ 27, 165.0 ], [ 32, 406.0 ], [ 37, 1057.0 ], [ 42, 1921.0 ], [ 47, 2659.0 ], [ 52, 4167.0 ], [ 57, 5933.0 ], [ 62, 9786.0 ], [ 67, 18230.0 ], [ 72, 32898.0 ], [ 77, 56395.0 ], [ 82, 82845.0 ], [ 87, 120046.0 ], [ 92, 151940.0 ], [ 97, 193027.0 ], [ 102, 223777.0 ], [ 107, 258734.0 ], [ 112, 275999.0 ], [ 117, 301243.0 ], [ 122, 310947.0 ], [ 127, 320811.0 ], [ 132, 325339.0 ], [ 137, 326292.0 ], [ 142, 325341.0 ], [ 147, 322725.0 ], [ 150, 6259257.0 ] ], "color": "#f0ad4e", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ [ 17, 8.0 ], [ 22, 59.0 ], [ 27, 167.0 ], [ 32, 405.0 ], [ 37, 1056.0 ], [ 42, 1918.0 ], [ 47, 2656.0 ], [ 52, 4152.0 ], [ 57, 5912.0 ], [ 62, 9752.0 ], [ 67, 18175.0 ], [ 72, 32803.0 ], [ 77, 56266.0 ], [ 82, 82665.0 ], [ 87, 119812.0 ], [ 92, 151658.0 ], [ 97, 192634.0 ], [ 102, 223186.0 ], [ 107, 257921.0 ], [ 112, 275391.0 ], [ 117, 300661.0 ], [ 122, 310411.0 ], [ 127, 320305.0 ], [ 132, 324818.0 ], [ 137, 325834.0 ], [ 142, 326507.0 ], [ 147, 325093.0 ], [ 150, 6261781.0 ] ], "color": "#f0ad4e", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_length_distribution_plot", "title": "FastQC: Sequence Length Distribution", "ylab": "Read Count", "xlab": "Sequence Length (bp)", "ymin": 0, "colors": { "rna_s1221_S42_trimmed_1": "#f0ad4e", "rna_s1200_S21_trimmed_2": "#f0ad4e", "rna_s1221_S42_trimmed_2": "#f0ad4e", "rna_s1200_S21_trimmed_1": "#f0ad4e" }, "tt_label": "{point.x} bp: {point.y}" } }, "fastqc_sequence_duplication_levels_plot-1": { "id": "fastqc_sequence_duplication_levels_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Duplication Levels", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "label": 1, "uid": "fastqc_sequence_duplication_levels_plot-1", "dconfig": { "categories": [ 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, ">10", ">50", ">100", ">500", ">1k", ">5k", ">10k+" ] }, "layout": { "title": { "text": "FastQC: Sequence Duplication Levels" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Sequence Duplication Level" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null }, "type": "category" }, "yaxis": { "hoverformat": ",.2f", "ticksuffix": "%", "title": { "text": "% of Library" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1", "data": [ 29.442998378904573, 14.878228460135364, 8.797103899845233, 5.8569982917098775, 4.392899490789697, 3.387569838800386, 2.7032685241475836, 2.1653246503849357, 1.8462069065154851, 17.5708769212612, 3.675431021799146, 4.530015078350886, 0.5337307808304302, 0.21934775652525995, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2", "data": [ 32.026900930232785, 17.083591915435775, 10.142656722924185, 6.4000466704057555, 4.508193521626878, 3.4400157877307698, 2.51554813788994, 2.003677756973867, 1.6292181271777302, 14.13467003178887, 2.9857013900007527, 2.676010034889662, 0.1486403032660056, 0.025194294955532263, 0.0, 0.27993437470160487 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1", "data": [ 26.952485740547232, 14.117822233066438, 8.3402600156957, 5.793553890594906, 4.212373540767959, 3.4085341397514215, 2.745351388750462, 2.269980973187953, 1.9070721546434906, 19.37879379239825, 4.046636281211134, 5.498155432538126, 0.8073369745500782, 0.5216434422968501, 0.0, 0.0 ], "color": "#d9534f", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2", "data": [ 30.70062583588802, 16.887772077397067, 9.950113733908902, 6.445060911331558, 4.462322545634369, 3.2220651527192756, 2.494679749960873, 2.0102476637366364, 1.6821057255182341, 15.029614848923561, 3.2233794561015396, 3.135576861528962, 0.2949048174178143, 0.18077052202076518, 0.0, 0.2807600979124025 ], "color": "#d9534f", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_sequence_duplication_levels_plot", "title": "FastQC: Sequence Duplication Levels", "ylab": "% of Library", "xlab": "Sequence Duplication Level", "ymax": 100, "ymin": 0, "colors": { "rna_s1221_S42_trimmed_1": "#d9534f", "rna_s1200_S21_trimmed_2": "#d9534f", "rna_s1221_S42_trimmed_2": "#d9534f", "rna_s1200_S21_trimmed_1": "#d9534f" }, "tt_decimals": 2, "tt_suffix": "%", "data_labels": [ { "categories": [ 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, ">10", ">50", ">100", ">500", ">1k", ">5k", ">10k+" ] } ] } }, "fastqc_top_overrepresented_sequences_table-1": { "id": "fastqc_top_overrepresented_sequences_table-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Top overrepresented sequences", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "label": 1, "uid": "fastqc_top_overrepresented_sequences_table-1", "dconfig": { "ylab": null }, "layout": { "title": { "text": null }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "grey", "line": { "width": 2, "color": "grey" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "metrics": [ "samples-1", "total_count-1", "total_percent-1" ], "header_by_metric": { "samples-1": { "title": "Samples", "description": "Number of samples where this sequence is overrepresented", "dmax": 2.0, "dmin": 0.0, "suffix": "", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -0.01, 2.01005 ] }, "show_points": true, "show_only_outliers": false }, "total_count-1": { "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "dmax": 55710.0, "dmin": 0.0, "suffix": "", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -278.55, 55989.94275 ] }, "show_points": true, "show_only_outliers": false }, "total_percent-1": { "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" } }, "violin_values_by_sample_by_metric": { "samples-1": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 2 }, "total_count-1": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 55710 }, "total_percent-1": { "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 0.14018824228554497 } }, "scatter_values_by_sample_by_metric": { "samples-1": {}, "total_count-1": {}, "total_percent-1": {} }, "all_samples": [ "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "plot_type": "violin", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": null, "config": { "namespace": "FastQC (trimmed)", "table_title": "FastQC: Top overrepresented sequences", "col1_header": "Overrepresented sequence", "sortRows": false }, "static": true, "violin_height": 70, "extra_height": 63 }, "fastqc_adapter_content_plot-1": { "id": "fastqc_adapter_content_plot-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Adapter Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ] }, "datasets": [ { "label": 1, "uid": "fastqc_adapter_content_plot-1", "dconfig": { "categories": [] }, "layout": { "title": { "text": "FastQC: Adapter Content" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Position (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% of Sequences" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 100 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 }, "marker": { "size": 4 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "lines": [ { "name": "rna_s1200_S21_trimmed_1 - polya", "data": [ [ 1, 0.00015094026730112564 ], [ 2, 0.0014289011971173227 ], [ 3, 0.002565984544119136 ], [ 4, 0.004387330436219385 ], [ 5, 0.005353348146946589 ], [ 6, 0.006289177804213568 ], [ 7, 0.007506762627109315 ], [ 8, 0.008855162348332704 ], [ 9, 0.012155722859983984 ], [ 10, 0.01600469967616269 ], [ 12, 0.018273835027922944 ], [ 14, 0.023028453447908402 ], [ 16, 0.02530262014191203 ], [ 18, 0.027365470461694075 ], [ 20, 0.029362913332312307 ], [ 22, 0.03194399190316155 ], [ 24, 0.034882295773290134 ], [ 26, 0.039284720236239634 ], [ 28, 0.04306828960325451 ], [ 30, 0.04570471293878084 ], [ 32, 0.047319773798902884 ], [ 34, 0.05082661934253237 ], [ 36, 0.05264293389238925 ], [ 38, 0.05452465589140995 ], [ 40, 0.056124622724801884 ], [ 42, 0.057734652242680554 ], [ 44, 0.05928430565363878 ], [ 46, 0.061060369465548686 ], [ 48, 0.0629068720688658 ], [ 50, 0.06402886138913749 ], [ 52, 0.06529172829222357 ], [ 54, 0.06681622499196495 ], [ 56, 0.06863253954182183 ], [ 58, 0.07000609597426208 ], [ 60, 0.07136958972221558 ], [ 62, 0.07249157904248726 ], [ 64, 0.07349281614891807 ], [ 66, 0.07461480546918978 ], [ 68, 0.07800089879897835 ], [ 70, 0.08107001756743458 ], [ 72, 0.08249388742230854 ], [ 74, 0.08356053197790314 ], [ 76, 0.0845869257955508 ], [ 78, 0.08576425988049959 ], [ 80, 0.08664977611533285 ], [ 82, 0.08768623261746725 ], [ 84, 0.0890597890499075 ], [ 86, 0.09086100957303427 ], [ 88, 0.09229494211239495 ], [ 90, 0.09421691484936262 ], [ 92, 0.09556028322834263 ], [ 94, 0.09660177107272042 ], [ 96, 0.09775394844645233 ], [ 98, 0.09891115716242763 ], [ 100, 0.09982183010847775 ], [ 102, 0.10078281647696158 ], [ 104, 0.10206580874902116 ], [ 106, 0.10344942786594813 ], [ 108, 0.10451104107929939 ], [ 110, 0.10541668268310614 ], [ 112, 0.10657892274132481 ], [ 114, 0.10735878078904729 ], [ 116, 0.10831976715753112 ], [ 118, 0.10918012668114754 ], [ 120, 0.11000526680906036 ], [ 122, 0.11087568901716352 ], [ 124, 0.11177126793648354 ], [ 126, 0.11259640806439636 ], [ 128, 0.11340142282333568 ], [ 130, 0.1142265629512485 ], [ 132, 0.11496113891878065 ], [ 134, 0.11589193723380425 ], [ 136, 0.11661645051684966 ], [ 138, 0.11731077574643484 ] ], "color": "#7cb5ec", "marker": {} }, { "name": "rna_s1200_S21_trimmed_2 - polyg", "data": [ [ 1, 0.3327226625541146 ], [ 2, 0.34101431457118975 ], [ 3, 0.34148726074206665 ], [ 4, 0.3419602069129435 ], [ 5, 0.3424432157683071 ], [ 6, 0.3432683558962199 ], [ 7, 0.34381174085850397 ], [ 8, 0.3443752511897615 ], [ 9, 0.345019262996913 ], [ 10, 0.3458896852050162 ], [ 12, 0.34691607902266375 ], [ 14, 0.3475198400918683 ], [ 16, 0.34778650123076693 ], [ 18, 0.34797266089377166 ], [ 20, 0.34812863250331616 ], [ 22, 0.34828963545510405 ], [ 24, 0.3483952936422148 ], [ 26, 0.3484607010913786 ], [ 28, 0.34854623390951595 ], [ 30, 0.34864686075438334 ], [ 32, 0.34871226820354717 ], [ 34, 0.348777675652711 ], [ 36, 0.34880786370617123 ], [ 38, 0.3488632084708483 ], [ 40, 0.34894370994674223 ], [ 42, 0.34899905471141934 ], [ 44, 0.349049368133853 ], [ 46, 0.3491248382675036 ], [ 48, 0.3491701203476939 ], [ 50, 0.349225465112371 ], [ 52, 0.34929087256153485 ], [ 54, 0.3493663426951854 ], [ 56, 0.3494569068555661 ], [ 58, 0.3495223143047299 ], [ 60, 0.3495726277271636 ], [ 62, 0.3496229411495973 ], [ 64, 0.3496883485987611 ], [ 66, 0.3497487247056816 ], [ 68, 0.349809100812602 ], [ 70, 0.34988960228849597 ], [ 72, 0.34997513510663325 ], [ 74, 0.350025448529067 ], [ 76, 0.35010091866271753 ], [ 78, 0.350161294769638 ], [ 80, 0.3502116081920717 ], [ 82, 0.3502468275877753 ], [ 84, 0.350297141010209 ], [ 86, 0.35037261114385954 ], [ 88, 0.3504933633577004 ], [ 90, 0.35055877080686426 ], [ 92, 0.35059902154481126 ], [ 94, 0.3506744916784618 ], [ 96, 0.35071977375865215 ], [ 98, 0.3507902125500594 ], [ 100, 0.35083549463024966 ], [ 102, 0.35088077671044 ], [ 104, 0.3509260587906303 ], [ 106, 0.3510065602665243 ], [ 108, 0.3510518423467146 ], [ 110, 0.3511021557691483 ], [ 112, 0.35115246919158205 ], [ 114, 0.35125812737869283 ], [ 116, 0.35134366019683017 ], [ 118, 0.35143422435721083 ], [ 120, 0.35154994522880834 ], [ 122, 0.3516656661004059 ], [ 124, 0.3516958541538661 ], [ 126, 0.35172604220732634 ], [ 128, 0.35177635562976 ], [ 130, 0.3518467944211672 ], [ 132, 0.35187698247462745 ], [ 134, 0.3519222645548178 ], [ 136, 0.3519675466350081 ], [ 138, 0.35200276603071173 ] ], "color": "#434348", "marker": {} }, { "name": "rna_s1221_S42_trimmed_1 - polya", "data": [ [ 1, 0.0001409584327677611 ], [ 2, 0.0012182835974927926 ], [ 3, 0.002194924167383709 ], [ 4, 0.003664919251961789 ], [ 5, 0.004722107497719998 ], [ 6, 0.005436968121042215 ], [ 7, 0.0064136086909331305 ], [ 8, 0.007158674692705582 ], [ 9, 0.0101490071592788 ], [ 10, 0.014191493641868521 ], [ 12, 0.016592821228662166 ], [ 14, 0.02086688227937035 ], [ 16, 0.02299132723037018 ], [ 18, 0.02525169638439606 ], [ 20, 0.026902923739675552 ], [ 22, 0.029163292893701433 ], [ 24, 0.03188177695422254 ], [ 26, 0.035929297666553964 ], [ 28, 0.03926195775556318 ], [ 30, 0.04148708730139712 ], [ 32, 0.042972185075200314 ], [ 34, 0.04581149064952236 ], [ 36, 0.047412375707384796 ], [ 38, 0.048801823116095586 ], [ 40, 0.04998486710539643 ], [ 42, 0.05159078639300056 ], [ 44, 0.05320677414008812 ], [ 46, 0.05450057118370649 ], [ 48, 0.05591518974112582 ], [ 50, 0.056816316864891137 ], [ 52, 0.05780302589426547 ], [ 54, 0.05902130949175827 ], [ 56, 0.06071281068497139 ], [ 58, 0.06223314806696653 ], [ 60, 0.06338598667781714 ], [ 62, 0.06460930450505165 ], [ 64, 0.0655305685477838 ], [ 66, 0.0666683044694093 ], [ 68, 0.0698197322877171 ], [ 70, 0.0730517077818922 ], [ 72, 0.07442101827163616 ], [ 74, 0.07536745346307686 ], [ 76, 0.0763793336411597 ], [ 78, 0.07762278838736103 ], [ 80, 0.07847357321370929 ], [ 82, 0.0794451795538585 ], [ 84, 0.08064332623238447 ], [ 86, 0.08256136776397437 ], [ 88, 0.08396591786191027 ], [ 90, 0.08577824056892434 ], [ 92, 0.08690087380132472 ], [ 94, 0.08801847280398341 ], [ 96, 0.08920655102302597 ], [ 98, 0.09028891041749271 ], [ 100, 0.09140650942015138 ], [ 102, 0.09252410842281006 ], [ 104, 0.09369708395262749 ], [ 106, 0.09485495679321981 ], [ 108, 0.09630481495883109 ], [ 110, 0.09753820124554899 ], [ 112, 0.09867090293743278 ], [ 114, 0.09961230389913175 ], [ 116, 0.10054867063108902 ], [ 118, 0.10148503736304629 ], [ 120, 0.10249691754112916 ], [ 122, 0.10334770236747742 ], [ 124, 0.10407766568002476 ], [ 126, 0.10519526468268343 ], [ 128, 0.10608128911722364 ], [ 130, 0.10689683433537998 ], [ 132, 0.10748583921515956 ], [ 134, 0.10829635020357418 ], [ 136, 0.10921761424630633 ], [ 138, 0.11009860445110484 ] ], "color": "#90ed7d", "marker": {} }, { "name": "rna_s1221_S42_trimmed_2 - polyg", "data": [ [ 1, 0.33756524110033764 ], [ 2, 0.346113363201754 ], [ 3, 0.34650603312160705 ], [ 4, 0.34728130450182976 ], [ 5, 0.34760349520529893 ], [ 6, 0.34826801353120407 ], [ 7, 0.3490432849114268 ], [ 8, 0.34965746093991484 ], [ 9, 0.3502817054278864 ], [ 10, 0.3513791675115782 ], [ 12, 0.3526024853388127 ], [ 14, 0.3531814217591089 ], [ 16, 0.35342809901645245 ], [ 18, 0.3536395366656041 ], [ 20, 0.3537855293281136 ], [ 22, 0.3538962823824311 ], [ 24, 0.353966761598815 ], [ 26, 0.35401206966649035 ], [ 28, 0.3540976515720994 ], [ 30, 0.35419330193719173 ], [ 32, 0.35430908922125093 ], [ 34, 0.3544047395863434 ], [ 36, 0.3545003899514358 ], [ 38, 0.35458597185704477 ], [ 40, 0.3546866564518789 ], [ 42, 0.3547521014385211 ], [ 44, 0.35482761488464665 ], [ 46, 0.35489305987128883 ], [ 48, 0.354993744466123 ], [ 50, 0.35508436060147364 ], [ 52, 0.3552102163450163 ], [ 54, 0.3553058667101087 ], [ 56, 0.3553914486157177 ], [ 58, 0.3554820647510684 ], [ 60, 0.3555978520351276 ], [ 62, 0.3556935024002201 ], [ 64, 0.3557992212247959 ], [ 66, 0.3559200427385968 ], [ 68, 0.3559905219549807 ], [ 70, 0.35614154884723187 ], [ 72, 0.3563479522666418 ], [ 74, 0.3564687737804427 ], [ 76, 0.35652415030760154 ], [ 78, 0.3566449718214024 ], [ 80, 0.35681110140287875 ], [ 82, 0.3569570940653882 ], [ 84, 0.3571232236468645 ], [ 86, 0.3573044559175659 ], [ 88, 0.3575058251072341 ], [ 90, 0.3576467835400019 ], [ 92, 0.3578229815809616 ], [ 94, 0.3579488373245042 ], [ 96, 0.35801931654088814 ], [ 98, 0.3581653092033976 ], [ 100, 0.3582810964874568 ], [ 102, 0.35845226029867483 ], [ 104, 0.3585076368258336 ], [ 106, 0.3586385267991179 ], [ 108, 0.3587945879211108 ], [ 110, 0.3589003067456866 ], [ 112, 0.3590765047866463 ], [ 114, 0.3592124289896724 ], [ 116, 0.35931311358450646 ], [ 118, 0.35940372971985723 ], [ 120, 0.3594842773957245 ], [ 122, 0.35959503045004204 ], [ 124, 0.3596655096664259 ], [ 126, 0.3597561258017766 ], [ 128, 0.3598568103966107 ], [ 130, 0.35994742653196143 ], [ 132, 0.3600128715186036 ], [ 134, 0.36006321381602063 ], [ 136, 0.3601638984108547 ], [ 138, 0.3602595487759472 ] ], "color": "#f7a35c", "marker": {} } ] } ], "plot_type": "xy_line", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "p_active": false, "l_active": false, "square": null, "config": { "id": "fastqc_adapter_content_plot", "title": "FastQC: Adapter Content", "ylab": "% of Sequences", "xlab": "Position (bp)", "yCeiling": 100, "yMinRange": 5, "ymin": 0, "xDecimals": false, "tt_label": "Base {point.x}: {point.y:.2f}%", "hide_empty": true, "yPlotBands": [ { "from": 20, "to": 100, "color": "#e6c3c3" }, { "from": 5, "to": 20, "color": "#e6dcc3" }, { "from": 0, "to": 5, "color": "#c3e6c3" } ] } }, "fastqc-status-check-heatmap-1": { "id": "fastqc-status-check-heatmap-1", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 520, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Status Checks", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ], "ticktext": [ "Basic
Statistics", "Per Base
Sequence
Quality", "Per Tile
Sequence
Quality", "Per
Sequence
Quality
Scores", "Per Base
Sequence
Content", "Per
Sequence
GC Content", "Per Base N
Content", "Sequence
Length
Distribution", "Sequence
Duplication
Levels", "Overrepresented
Sequences", "Adapter
Content" ], "tickangle": 0, "showgrid": false }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3 ], "ticktext": [ "rna_s1200_S21_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_trimmed_2" ], "showgrid": false, "autorange": "reversed", "ticklabelposition": "outside right" } }, "datasets": [ { "label": 1, "uid": "fastqc-status-check-heatmap-1", "dconfig": { "ylab": null }, "layout": { "title": { "text": "FastQC: Status Checks" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": ",.1f", "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "colorscale": [ [ 0.0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1.0, "#5cb85c" ] ], "reversescale": false, "showscale": false, "zmin": 0, "zmax": 1, "hovertemplate": "x: %{x}
y: %{y}
z: %{z}" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "rows": [ [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 1, 1 ], [ 1, 1, 1, 1, 0.5, 1, 1, 0.5, 0.25, 0.5, 1 ], [ 1, 1, 1, 1, 0.25, 1, 1, 0.5, 0.25, 1, 1 ], [ 1, 1, 1, 1, 0.5, 1, 1, 0.5, 0.25, 0.5, 1 ] ], "xcats": [ "Basic Statistics", "Per Base Sequence Quality", "Per Tile Sequence Quality", "Per Sequence Quality Scores", "Per Base Sequence Content", "Per Sequence GC Content", "Per Base N Content", "Sequence Length Distribution", "Sequence Duplication Levels", "Overrepresented Sequences", "Adapter Content" ], "ycats": [ "rna_s1200_S21_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_trimmed_2" ] } ], "plot_type": "heatmap", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": false, "config": { "id": "fastqc-status-check-heatmap", "title": "FastQC: Status Checks", "xTitle": "Section Name", "yTitle": "Sample", "min": 0, "max": 1, "square": false, "colstops": [ [ 0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1, "#5cb85c" ] ], "decimalPlaces": 1, "legend": false, "datalabels": false, "xcats_samples": false, "angled_xticks": false }, "xcats_samples": false, "ycats_samples": true }, "general_stats_table": { "id": "general_stats_table", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "rgba(0,0,0,0)", "plot_bgcolor": "rgba(0,0,0,0)", "showlegend": false, "title": { "font": { "size": 20 }, "text": "General Statistics", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "label": 1, "uid": "general_stats_table", "dconfig": { "ylab": null }, "layout": { "title": { "text": null }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "grey", "line": { "width": 2, "color": "grey" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "metrics": [ "mqc-generalstats-custom_content_kallisto-fragment_length_mean", "mqc-generalstats-custom_content_kallisto-fragment_length_median", "mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts", "mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts", "mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts", "mqc-generalstats-custom_content_expression_qc-pct_male_est_counts", "mqc-generalstats-custom_content_expression_qc-pct_mito_tpm", "mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm", "mqc-generalstats-custom_content_expression_qc-pct_hk_tpm", "mqc-generalstats-custom_content_expression_qc-pct_male_tpm", "mqc-generalstats-custom_content_preseq-total_reads", "mqc-generalstats-custom_content_preseq-expected_distinct", "mqc-generalstats-custom_content_seqtools_general_stats-reads", "mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped", "mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes", "mqc-generalstats-custom_content_seqtools_general_stats-unique_reads", "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target", "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target", "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target", "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target", "mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target", "mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target", "mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target", "mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target", "mqc-generalstats-custom_content_seqtools_general_stats-mean_depth", "mqc-generalstats-custom_content_seqtools_general_stats-q50_depth", "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x", "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x", "mqc-generalstats-custom_content_seqtools_general_stats-n_q30", "mqc-generalstats-custom_content_seqtools_general_stats-gc_bias", "mqc-generalstats-custom_content_rna_contamination-is_contaminated", "mqc-generalstats-custom_content_rna_contamination-contamination_pct", "mqc-generalstats-kallisto-fragment_length", "mqc-generalstats-kallisto-percent_aligned", "mqc-generalstats-kallisto-pseudoaligned_reads", "mqc-generalstats-picard_insertsizemetrics-summed_median", "mqc-generalstats-picard_insertsizemetrics-summed_mean", "mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION", "mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES", "mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES", "mqc-generalstats-rseqc-proper_pairs_percent", "mqc-generalstats-star-uniquely_mapped_percent", "mqc-generalstats-star-uniquely_mapped", "mqc-generalstats-fastp-pct_duplication", "mqc-generalstats-fastp-after_filtering_q30_rate", "mqc-generalstats-fastp-after_filtering_q30_bases", "mqc-generalstats-fastp-filtering_result_passed_filter_reads", "mqc-generalstats-fastp-after_filtering_gc_content", "mqc-generalstats-fastp-pct_surviving", "mqc-generalstats-fastp-pct_adapter", "mqc-generalstats-fastqc_raw-percent_duplicates", "mqc-generalstats-fastqc_raw-percent_gc", "mqc-generalstats-fastqc_raw-avg_sequence_length", "mqc-generalstats-fastqc_raw-median_sequence_length", "mqc-generalstats-fastqc_raw-percent_fails", "mqc-generalstats-fastqc_raw-total_sequences", "mqc-generalstats-fastqc_trimmed-percent_duplicates", "mqc-generalstats-fastqc_trimmed-percent_gc", "mqc-generalstats-fastqc_trimmed-avg_sequence_length", "mqc-generalstats-fastqc_trimmed-median_sequence_length", "mqc-generalstats-fastqc_trimmed-percent_fails", "mqc-generalstats-fastqc_trimmed-total_sequences" ], "header_by_metric": { "mqc-generalstats-custom_content_kallisto-fragment_length_mean": { "namespace": "Custom content: Kallisto", "title": "Fragment Length Mean", "description": "Mean fragment length from kallisto fragment length distribution", "dmax": 180.9, "dmin": 0.0, "suffix": " bp", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.9045000000000001, 181.8090225 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_kallisto-fragment_length_median": { "namespace": "Custom content: Kallisto", "title": "Fragment Length Median", "description": "Median fragment length from kallisto fragment length distribution", "dmax": 166.0, "dmin": 0.0, "suffix": " bp", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.8300000000000001, 166.83415 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Mito est. counts", "description": "Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.", "dmax": 0.01, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -5e-05, 0.01005025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Ribo est. counts", "description": "Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.", "dmax": 4.71, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.02355, 4.73366775 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Housekeeping est. counts", "description": "Percentage of estimated counts from housekeeping genes.", "dmax": 2.97, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.014850000000000002, 2.98492425 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_male_est_counts": { "namespace": "Custom content: Expression QC", "title": "pct Male est. counts", "description": "pct Male est. counts", "dmax": 0, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": [ 0 ], "range": [ -0.005, 1.005025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_mito_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Mito TPM", "description": "Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.", "dmax": 0.01, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -5e-05, 0.01005025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Ribo TPM", "description": "Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.", "dmax": 11.32, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.056600000000000004, 11.376883 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_hk_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Housekeeping TPM", "description": "Percentage of TPM from housekeeping genes.", "dmax": 3.45, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.01725, 3.4673362500000002 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_expression_qc-pct_male_tpm": { "namespace": "Custom content: Expression QC", "title": "pct Male TPM", "description": "pct Male TPM", "dmax": 0, "dmin": 0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": [ 0 ], "range": [ -0.005, 1.005025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_preseq-total_reads": { "namespace": "Custom content: Preseq", "title": "Total Reads", "description": "Total reads from preseq analysis", "dmax": 9999000000.0, "dmin": 0.0, "suffix": "", "color": "77,175,74", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -49995000.0, 10049244975.0 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_preseq-expected_distinct": { "namespace": "Custom content: Preseq", "title": "Expected Distinct", "description": "Expected distinct molecules at maximum sequencing depth", "dmax": 53979070.0, "dmin": 0.0, "suffix": "", "color": "77,175,74", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -269895.35, 54250314.82675 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-reads": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads", "description": "SeqTools (general stats) — reads", "dmax": 19875412.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -99377.06, 19975285.9453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Unmapped", "description": "SeqTools (general stats) — frac unmapped", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Dupes", "description": "SeqTools (general stats) — frac dupes", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-unique_reads": { "namespace": "Custom content: SeqTools (general stats)", "title": "Unique Reads", "description": "SeqTools (general stats) — unique reads", "dmax": 16225876.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -81129.38, 16307411.0269 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Reads On Target", "description": "SeqTools (general stats) — frac reads on target", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Pairs On Target", "description": "SeqTools (general stats) — frac pairs on target", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Reads Off Target", "description": "SeqTools (general stats) — frac reads off target", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Pairs Off Target", "description": "SeqTools (general stats) — frac pairs off target", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads On Target", "description": "SeqTools (general stats) — reads on target", "dmax": 15339088.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -76695.44, 15416166.9172 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Pairs On Target", "description": "SeqTools (general stats) — pairs on target", "dmax": 7832369.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -39161.845, 7871726.654225 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Reads Off Target", "description": "SeqTools (general stats) — reads off target", "dmax": 930229.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -4651.145, 934903.400725 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target": { "namespace": "Custom content: SeqTools (general stats)", "title": "Pairs Off Target", "description": "SeqTools (general stats) — pairs off target", "dmax": 299983.0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -1499.915, 301490.414575 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-mean_depth": { "namespace": "Custom content: SeqTools (general stats)", "title": "Mean Depth", "description": "SeqTools (general stats) — mean depth", "dmax": 34.559207, "dmin": 0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -0.17279603500000001, 34.732867015175 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-q50_depth": { "namespace": "Custom content: SeqTools (general stats)", "title": "Q50 Depth", "description": "SeqTools (general stats) — q50 depth", "dmax": 5.0, "dmin": 0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -0.025, 5.025125 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Bases Gt30X", "description": "SeqTools (general stats) — frac bases gt30x", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x": { "namespace": "Custom content: SeqTools (general stats)", "title": "Frac Bases Gt100X", "description": "SeqTools (general stats) — frac bases gt100x", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-n_q30": { "namespace": "Custom content: SeqTools (general stats)", "title": "N Q30", "description": "SeqTools (general stats) — n q30", "dmax": 0.985625, "dmin": 0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": null, "range": [ -0.004928125, 0.990577765625 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_seqtools_general_stats-gc_bias": { "namespace": "Custom content: SeqTools (general stats)", "title": "GC Bias", "description": "SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads", "dmax": 0, "dmin": 0.0, "suffix": "", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "", "tickvals": [ 0 ], "range": [ -0.005, 1.005025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-custom_content_rna_contamination-is_contaminated": { "namespace": "Custom content: RNA contamination", "title": "RNA contaminated", "description": "Whether the sample was classified as contaminated from VAF_p90", "dmax": 0, "dmin": 0, "suffix": "", "color": "255,127,0", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "" }, "show_points": true, "show_only_outliers": false }, "mqc-generalstats-custom_content_rna_contamination-contamination_pct": { "namespace": "Custom content: RNA contamination", "title": "RNA contamination %", "description": "Estimated RNA contamination from VAF_p90; 0% for samples classified as clean", "dmax": 0, "dmin": 0, "suffix": "%", "color": "255,127,0", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": "%" }, "show_points": true, "show_only_outliers": false }, "mqc-generalstats-kallisto-fragment_length": { "namespace": "Kallisto", "title": "Frag Length", "description": "Estimated average fragment length", "dmax": 180.9, "dmin": 0.0, "suffix": "bp", "color": "228,26,28", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "bp", "tickvals": null, "range": [ -0.9045000000000001, 181.8090225 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-kallisto-percent_aligned": { "namespace": "Kallisto", "title": "% Aligned", "description": "% processed reads that were pseudoaligned", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "228,26,28", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-kallisto-pseudoaligned_reads": { "namespace": "Kallisto", "title": "M Aligned", "description": "Pseudoaligned reads (millions)", "dmax": 19.875412, "dmin": 0.0, "suffix": " M", "color": "228,26,28", "hidden": null, "xaxis": { "ticksuffix": " M", "tickvals": null, "range": [ -0.09937706, 19.9752859453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-picard_insertsizemetrics-summed_median": { "namespace": "Picard: InsertSizeMetrics", "title": "Insert Size", "description": "Median Insert Size, all read orientations (bp)", "dmax": 294.0, "dmin": 0.0, "suffix": " bp", "color": "179,179,50", "hidden": null, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -1.47, 295.47735 ] }, "show_points": true, "show_only_outliers": false }, "mqc-generalstats-picard_insertsizemetrics-summed_mean": { "namespace": "Picard: InsertSizeMetrics", "title": "Mean Insert Size", "description": "Mean Insert Size, all read orientations (bp)", "dmax": 762.227728, "dmin": 0.0, "suffix": " bp", "color": "179,179,50", "hidden": true, "modify": null, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -3.81113864, 766.0579223331999 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION": { "namespace": "Picard: Mark Duplicates", "title": "Duplication", "description": "Mark Duplicates - Percent Duplication", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "166,86,40", "hidden": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES": { "namespace": "Picard: RnaSeqMetrics", "title": "rRNA", "description": "Percent of aligned bases overlapping ribosomal RNA regions", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "247,129,191", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES": { "namespace": "Picard: RnaSeqMetrics", "title": "mRNA", "description": "Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "247,129,191", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-rseqc-proper_pairs_percent": { "namespace": "RSeQC", "title": "% Proper Pairs", "description": "% Reads mapped in proper pairs", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "153,153,153", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-star-uniquely_mapped_percent": { "namespace": "STAR", "title": "% Aligned", "description": "% Uniquely mapped reads", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "55,126,184", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-star-uniquely_mapped": { "namespace": "STAR", "title": "M Aligned", "description": "Uniquely mapped reads (millions)", "dmax": 19.875412, "dmin": 0.0, "suffix": " M", "color": "55,126,184", "hidden": null, "xaxis": { "ticksuffix": " M", "tickvals": null, "range": [ -0.09937706, 19.9752859453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-pct_duplication": { "namespace": "fastp", "title": "% Duplication", "description": "Duplication rate before filtering", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "77,175,74", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-after_filtering_q30_rate": { "namespace": "fastp", "title": "% > Q30", "description": "Percentage of reads > Q30 after filtering", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "77,175,74", "hidden": true, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-after_filtering_q30_bases": { "namespace": "fastp", "title": "Mb Q30 bases", "description": "Bases > Q30 after filtering (millions)", "dmax": 2750.3346119999997, "dmin": 0.0, "suffix": " Mb", "color": "77,175,74", "hidden": true, "xaxis": { "ticksuffix": " Mb", "tickvals": null, "range": [ -13.751673059999998, 2764.1550434252995 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-filtering_result_passed_filter_reads": { "namespace": "fastp", "title": "M Reads After Filtering", "description": "Total reads after filtering (millions)", "dmax": 19.875412, "dmin": 0.0, "suffix": " M", "color": "77,175,74", "hidden": null, "xaxis": { "ticksuffix": " M", "tickvals": null, "range": [ -0.09937706, 19.9752859453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-after_filtering_gc_content": { "namespace": "fastp", "title": "GC content", "description": "GC content after filtering", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "77,175,74", "hidden": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-pct_surviving": { "namespace": "fastp", "title": "% PF", "description": "Percent reads passing filter", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "77,175,74", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastp-pct_adapter": { "namespace": "fastp", "title": "% Adapter", "description": "Percentage adapter-trimmed reads", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "77,175,74", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_raw-percent_duplicates": { "namespace": "FastQC (raw)", "title": "% Dups", "description": "% Duplicate Reads", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_raw-percent_gc": { "namespace": "FastQC (raw)", "title": "% GC", "description": "Average % GC Content", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_raw-avg_sequence_length": { "namespace": "FastQC (raw)", "title": "Average Read Length", "description": "Average Read Length (bp)", "dmax": 150.0, "dmin": 0.0, "suffix": " bp", "color": "152,78,163", "hidden": true, "modify": null, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.75, 150.75375 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_raw-median_sequence_length": { "namespace": "FastQC (raw)", "title": "Median Read Length", "description": "Median Read Length (bp)", "dmax": 150.0, "dmin": 0.0, "suffix": " bp", "color": "152,78,163", "hidden": true, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.75, 150.75375 ] }, "show_points": true, "show_only_outliers": false }, "mqc-generalstats-fastqc_raw-percent_fails": { "namespace": "FastQC (raw)", "title": "% Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "152,78,163", "hidden": true, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_raw-total_sequences": { "namespace": "FastQC (raw)", "title": "M Seqs", "description": "Total Sequences (millions)", "dmax": 19.875412, "dmin": 0.0, "suffix": " M", "color": "152,78,163", "hidden": null, "xaxis": { "ticksuffix": " M", "tickvals": null, "range": [ -0.09937706, 19.9752859453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_trimmed-percent_duplicates": { "namespace": "FastQC (trimmed)", "title": "% Dups", "description": "% Duplicate Reads", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "255,127,0", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_trimmed-percent_gc": { "namespace": "FastQC (trimmed)", "title": "% GC", "description": "Average % GC Content", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "255,127,0", "hidden": null, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_trimmed-avg_sequence_length": { "namespace": "FastQC (trimmed)", "title": "Average Read Length", "description": "Average Read Length (bp)", "dmax": 140.53251514987463, "dmin": 0.0, "suffix": " bp", "color": "255,127,0", "hidden": true, "modify": null, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.7026625757493732, 141.23869103850274 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_trimmed-median_sequence_length": { "namespace": "FastQC (trimmed)", "title": "Median Read Length", "description": "Median Read Length (bp)", "dmax": 150.0, "dmin": 0.0, "suffix": " bp", "color": "255,127,0", "hidden": true, "modify": null, "tt_decimals": 2, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -0.75, 150.75375 ] }, "show_points": true, "show_only_outliers": false }, "mqc-generalstats-fastqc_trimmed-percent_fails": { "namespace": "FastQC (trimmed)", "title": "% Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "dmax": 100.0, "dmin": 0.0, "suffix": "%", "color": "255,127,0", "hidden": true, "modify": null, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" }, "mqc-generalstats-fastqc_trimmed-total_sequences": { "namespace": "FastQC (trimmed)", "title": "M Seqs", "description": "Total Sequences (millions)", "dmax": 19.875412, "dmin": 0.0, "suffix": " M", "color": "255,127,0", "hidden": null, "xaxis": { "ticksuffix": " M", "tickvals": null, "range": [ -0.09937706, 19.9752859453 ] }, "show_points": true, "show_only_outliers": false, "hoverformat": ".2f" } }, "violin_values_by_sample_by_metric": { "mqc-generalstats-custom_content_kallisto-fragment_length_mean": { "rna_s1221_S42": 175.9, "rna_s1200_S21": 180.9 }, "mqc-generalstats-custom_content_kallisto-fragment_length_median": { "rna_s1221_S42": 160.0, "rna_s1200_S21": 166.0 }, "mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts": { "rna_s1221_S42": 0.01, "rna_s1200_S21": 0.0 }, "mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts": { "rna_s1221_S42": 4.71, "rna_s1200_S21": 4.58 }, "mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts": { "rna_s1221_S42": 2.83, "rna_s1200_S21": 2.97 }, "mqc-generalstats-custom_content_expression_qc-pct_male_est_counts": { "rna_s1221_S42": 0.0, "rna_s1200_S21": 0.0 }, "mqc-generalstats-custom_content_expression_qc-pct_mito_tpm": { "rna_s1221_S42": 0.01, "rna_s1200_S21": 0.0 }, "mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm": { "rna_s1221_S42": 11.32, "rna_s1200_S21": 10.89 }, "mqc-generalstats-custom_content_expression_qc-pct_hk_tpm": { "rna_s1221_S42": 3.19, "rna_s1200_S21": 3.45 }, "mqc-generalstats-custom_content_expression_qc-pct_male_tpm": { "rna_s1221_S42": 0.0, "rna_s1200_S21": 0.0 }, "mqc-generalstats-custom_content_preseq-total_reads": { "rna_s1200_S21": 9999000000.0, "rna_s1221_S42": 9999000000.0 }, "mqc-generalstats-custom_content_preseq-expected_distinct": { "rna_s1200_S21": 53979070.0, "rna_s1221_S42": 53000545.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-reads": { "rna_s1200_S21": 19875412.0, "rna_s1221_S42": 19864012.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped": { "rna_s1200_S21": 0.003853, "rna_s1221_S42": 0.004391 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes": { "rna_s1200_S21": 0.183621, "rna_s1221_S42": 0.198705 }, "mqc-generalstats-custom_content_seqtools_general_stats-unique_reads": { "rna_s1200_S21": 16225876.0, "rna_s1221_S42": 15916933.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target": { "rna_s1200_S21": 0.945347, "rna_s1221_S42": 0.936077 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target": { "rna_s1200_S21": 0.972121, "rna_s1221_S42": 0.962008 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target": { "rna_s1200_S21": 0.049933, "rna_s1221_S42": 0.058443 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target": { "rna_s1200_S21": 0.027879, "rna_s1221_S42": 0.037992 }, "mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target": { "rna_s1200_S21": 15339088.0, "rna_s1221_S42": 14899481.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target": { "rna_s1200_S21": 7832369.0, "rna_s1221_S42": 7595968.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target": { "rna_s1200_S21": 810206.0, "rna_s1221_S42": 930229.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target": { "rna_s1200_S21": 224622.0, "rna_s1221_S42": 299983.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-mean_depth": { "rna_s1200_S21": 34.559207, "rna_s1221_S42": 32.870035 }, "mqc-generalstats-custom_content_seqtools_general_stats-q50_depth": { "rna_s1200_S21": 5.0, "rna_s1221_S42": 5.0 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x": { "rna_s1200_S21": 0.293198, "rna_s1221_S42": 0.28172 }, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x": { "rna_s1200_S21": 0.084685, "rna_s1221_S42": 0.079333 }, "mqc-generalstats-custom_content_seqtools_general_stats-n_q30": { "rna_s1200_S21": 0.985625, "rna_s1221_S42": 0.98502 }, "mqc-generalstats-custom_content_seqtools_general_stats-gc_bias": { "rna_s1200_S21": 0.0, "rna_s1221_S42": 0.0 }, "mqc-generalstats-custom_content_rna_contamination-is_contaminated": { "rna_s1200_S21": "Skipped", "rna_s1221_S42": "Skipped" }, "mqc-generalstats-custom_content_rna_contamination-contamination_pct": { "rna_s1200_S21": "N/A", "rna_s1221_S42": "N/A" }, "mqc-generalstats-kallisto-fragment_length": { "rna_s1221_S42_1": 175.9, "rna_s1200_S21_1": 180.9 }, "mqc-generalstats-kallisto-percent_aligned": { "rna_s1221_S42_1": 96.36796433671103, "rna_s1200_S21_1": 97.82623877180508 }, "mqc-generalstats-kallisto-pseudoaligned_reads": { "rna_s1221_S42_1": 9.571272, "rna_s1200_S21_1": 9.721684 }, "mqc-generalstats-picard_insertsizemetrics-summed_median": { "rna_s1200_S21": 294, "rna_s1221_S42": 255 }, "mqc-generalstats-picard_insertsizemetrics-summed_mean": { "rna_s1200_S21": 762.227728, "rna_s1221_S42": 661.011966 }, "mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION": { "rna_s1200_S21": 18.4331, "rna_s1221_S42": 19.9581 }, "mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES": { "rna_s1200_S21": 0.0, "rna_s1221_S42": 0.0873 }, "mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES": { "rna_s1200_S21": 96.3936, "rna_s1221_S42": 95.2555 }, "mqc-generalstats-rseqc-proper_pairs_percent": { "rna_s1221_S42": 80.25001383886074, "rna_s1200_S21": 90.33600244662823 }, "mqc-generalstats-star-uniquely_mapped_percent": { "rna_s1200_S21": 95.95, "rna_s1221_S42": 94.32 }, "mqc-generalstats-star-uniquely_mapped": { "rna_s1200_S21": 9.534804, "rna_s1221_S42": 9.368114 }, "mqc-generalstats-fastp-pct_duplication": { "rna_s1200_S21": 13.3191, "rna_s1221_S42": 13.947899999999999 }, "mqc-generalstats-fastp-after_filtering_q30_rate": { "rna_s1200_S21": 98.4633, "rna_s1221_S42": 98.3893 }, "mqc-generalstats-fastp-after_filtering_q30_bases": { "rna_s1200_S21": 2750.3346119999997, "rna_s1221_S42": 2705.779238 }, "mqc-generalstats-fastp-filtering_result_passed_filter_reads": { "rna_s1200_S21": 19.875412, "rna_s1221_S42": 19.864012 }, "mqc-generalstats-fastp-after_filtering_gc_content": { "rna_s1200_S21": 53.576100000000004, "rna_s1221_S42": 53.3166 }, "mqc-generalstats-fastp-pct_surviving": { "rna_s1200_S21": 99.37706, "rna_s1221_S42": 99.32006 }, "mqc-generalstats-fastp-pct_adapter": { "rna_s1200_S21": 32.738935000000005, "rna_s1221_S42": 36.832589999999996 }, "mqc-generalstats-fastqc_raw-percent_duplicates": { "rna_s1221_S42_trimmed_1": 58.26617657347452, "rna_s1200_S21_trimmed_2": 51.30826279941934, "rna_s1221_S42_1": 58.16307867114451, "rna_s1200_S21_1": 55.25002152063861, "rna_s1221_S42_trimmed_2": 52.77153448748192, "rna_s1221_S42_2": 52.65069232510231, "rna_s1200_S21_trimmed_1": 55.31816418825391, "rna_s1200_S21_2": 51.18582796474035 }, "mqc-generalstats-fastqc_raw-percent_gc": { "rna_s1221_S42_trimmed_1": 53.0, "rna_s1200_S21_trimmed_2": 53.0, "rna_s1221_S42_1": 52.0, "rna_s1200_S21_1": 53.0, "rna_s1221_S42_trimmed_2": 53.0, "rna_s1221_S42_2": 53.0, "rna_s1200_S21_trimmed_1": 53.0, "rna_s1200_S21_2": 53.0 }, "mqc-generalstats-fastqc_raw-avg_sequence_length": { "rna_s1221_S42_trimmed_1": 138.4228959386452, "rna_s1200_S21_trimmed_2": 140.53251514987463, "rna_s1221_S42_1": 150.0, "rna_s1200_S21_1": 150.0, "rna_s1221_S42_trimmed_2": 138.44541374622608, "rna_s1221_S42_2": 150.0, "rna_s1200_S21_trimmed_1": 140.52089164239715, "rna_s1200_S21_2": 150.0 }, "mqc-generalstats-fastqc_raw-median_sequence_length": { "rna_s1221_S42_trimmed_1": 150, "rna_s1200_S21_trimmed_2": 150, "rna_s1221_S42_1": 150, "rna_s1200_S21_1": 150, "rna_s1221_S42_trimmed_2": 150, "rna_s1221_S42_2": 150, "rna_s1200_S21_trimmed_1": 150, "rna_s1200_S21_2": 150 }, "mqc-generalstats-fastqc_raw-percent_fails": { "rna_s1221_S42_trimmed_1": 18.181818181818183, "rna_s1200_S21_trimmed_2": 9.090909090909092, "rna_s1221_S42_1": 27.27272727272727, "rna_s1200_S21_1": 27.27272727272727, "rna_s1221_S42_trimmed_2": 9.090909090909092, "rna_s1221_S42_2": 18.181818181818183, "rna_s1200_S21_trimmed_1": 18.181818181818183, "rna_s1200_S21_2": 18.181818181818183 }, "mqc-generalstats-fastqc_raw-total_sequences": { "rna_s1221_S42_trimmed_1": 9.932006, "rna_s1200_S21_trimmed_2": 9.937706, "rna_s1221_S42_1": 10.0, "rna_s1200_S21_1": 10.0, "rna_s1221_S42_trimmed_2": 9.932006, "rna_s1221_S42_2": 10.0, "rna_s1200_S21_trimmed_1": 9.937706, "rna_s1200_S21_2": 10.0 }, "mqc-generalstats-fastqc_trimmed-percent_duplicates": { "rna_s1221_S42_trimmed_1": 58.26617657347452, "rna_s1200_S21_trimmed_2": 51.30826279941934, "rna_s1221_S42_trimmed_2": 52.77153448748192, "rna_s1200_S21_trimmed_1": 55.31816418825391 }, "mqc-generalstats-fastqc_trimmed-percent_gc": { "rna_s1221_S42_trimmed_1": 53.0, "rna_s1200_S21_trimmed_2": 53.0, "rna_s1221_S42_trimmed_2": 53.0, "rna_s1200_S21_trimmed_1": 53.0 }, "mqc-generalstats-fastqc_trimmed-avg_sequence_length": { "rna_s1221_S42_trimmed_1": 138.4228959386452, "rna_s1200_S21_trimmed_2": 140.53251514987463, "rna_s1221_S42_trimmed_2": 138.44541374622608, "rna_s1200_S21_trimmed_1": 140.52089164239715 }, "mqc-generalstats-fastqc_trimmed-median_sequence_length": { "rna_s1221_S42_trimmed_1": 150, "rna_s1200_S21_trimmed_2": 150, "rna_s1221_S42_trimmed_2": 150, "rna_s1200_S21_trimmed_1": 150 }, "mqc-generalstats-fastqc_trimmed-percent_fails": { "rna_s1221_S42_trimmed_1": 18.181818181818183, "rna_s1200_S21_trimmed_2": 9.090909090909092, "rna_s1221_S42_trimmed_2": 9.090909090909092, "rna_s1200_S21_trimmed_1": 18.181818181818183 }, "mqc-generalstats-fastqc_trimmed-total_sequences": { "rna_s1221_S42_trimmed_1": 9.932006, "rna_s1200_S21_trimmed_2": 9.937706, "rna_s1221_S42_trimmed_2": 9.932006, "rna_s1200_S21_trimmed_1": 9.937706 } }, "scatter_values_by_sample_by_metric": { "mqc-generalstats-custom_content_kallisto-fragment_length_mean": {}, "mqc-generalstats-custom_content_kallisto-fragment_length_median": {}, "mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts": {}, "mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts": {}, "mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts": {}, "mqc-generalstats-custom_content_expression_qc-pct_male_est_counts": {}, "mqc-generalstats-custom_content_expression_qc-pct_mito_tpm": {}, "mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm": {}, "mqc-generalstats-custom_content_expression_qc-pct_hk_tpm": {}, "mqc-generalstats-custom_content_expression_qc-pct_male_tpm": {}, "mqc-generalstats-custom_content_preseq-total_reads": {}, "mqc-generalstats-custom_content_preseq-expected_distinct": {}, "mqc-generalstats-custom_content_seqtools_general_stats-reads": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes": {}, "mqc-generalstats-custom_content_seqtools_general_stats-unique_reads": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target": {}, "mqc-generalstats-custom_content_seqtools_general_stats-mean_depth": {}, "mqc-generalstats-custom_content_seqtools_general_stats-q50_depth": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x": {}, "mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x": {}, "mqc-generalstats-custom_content_seqtools_general_stats-n_q30": {}, "mqc-generalstats-custom_content_seqtools_general_stats-gc_bias": {}, "mqc-generalstats-custom_content_rna_contamination-is_contaminated": {}, "mqc-generalstats-custom_content_rna_contamination-contamination_pct": {}, "mqc-generalstats-kallisto-fragment_length": {}, "mqc-generalstats-kallisto-percent_aligned": {}, "mqc-generalstats-kallisto-pseudoaligned_reads": {}, "mqc-generalstats-picard_insertsizemetrics-summed_median": {}, "mqc-generalstats-picard_insertsizemetrics-summed_mean": {}, "mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION": {}, "mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES": {}, "mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES": {}, "mqc-generalstats-rseqc-proper_pairs_percent": {}, "mqc-generalstats-star-uniquely_mapped_percent": {}, "mqc-generalstats-star-uniquely_mapped": {}, "mqc-generalstats-fastp-pct_duplication": {}, "mqc-generalstats-fastp-after_filtering_q30_rate": {}, "mqc-generalstats-fastp-after_filtering_q30_bases": {}, "mqc-generalstats-fastp-filtering_result_passed_filter_reads": {}, "mqc-generalstats-fastp-after_filtering_gc_content": {}, "mqc-generalstats-fastp-pct_surviving": {}, "mqc-generalstats-fastp-pct_adapter": {}, "mqc-generalstats-fastqc_raw-percent_duplicates": {}, "mqc-generalstats-fastqc_raw-percent_gc": {}, "mqc-generalstats-fastqc_raw-avg_sequence_length": {}, "mqc-generalstats-fastqc_raw-median_sequence_length": {}, "mqc-generalstats-fastqc_raw-percent_fails": {}, "mqc-generalstats-fastqc_raw-total_sequences": {}, "mqc-generalstats-fastqc_trimmed-percent_duplicates": {}, "mqc-generalstats-fastqc_trimmed-percent_gc": {}, "mqc-generalstats-fastqc_trimmed-avg_sequence_length": {}, "mqc-generalstats-fastqc_trimmed-median_sequence_length": {}, "mqc-generalstats-fastqc_trimmed-percent_fails": {}, "mqc-generalstats-fastqc_trimmed-total_sequences": {} }, "all_samples": [ "rna_s1200_S21", "rna_s1200_S21_1", "rna_s1200_S21_2", "rna_s1200_S21_trimmed_1", "rna_s1200_S21_trimmed_2", "rna_s1221_S42", "rna_s1221_S42_1", "rna_s1221_S42_2", "rna_s1221_S42_trimmed_1", "rna_s1221_S42_trimmed_2" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "black" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "plot_type": "violin", "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "p_active": false, "l_active": false, "square": null, "config": { "table_title": "General Statistics", "save_file": true, "raw_data_fn": "multiqc_general_stats" }, "static": true, "violin_height": 70, "extra_height": 63 } }, "report_saved_raw_data": { "multiqc_kallisto": { "rna_s1221_S42_1": { "total_reads": 9932006.0, "pseudoaligned_reads": 9571272.0, "not_pseudoaligned_reads": 360734.0, "percent_aligned": 96.36796433671103, "fragment_length": 175.9 }, "rna_s1200_S21_1": { "total_reads": 9937706.0, "pseudoaligned_reads": 9721684.0, "not_pseudoaligned_reads": 216022.0, "percent_aligned": 97.82623877180508, "fragment_length": 180.9 } }, "multiqc_picard_insertSize": { "rna_s1200_S21_FR": { "SAMPLE_NAME": "rna_s1200_S21", "MEDIAN_INSERT_SIZE": 451.0, "MODE_INSERT_SIZE": 118.0, "MEDIAN_ABSOLUTE_DEVIATION": 338.0, "MIN_INSERT_SIZE": 7.0, "MAX_INSERT_SIZE": 597662.0, "MEAN_INSERT_SIZE": 762.227728, "STANDARD_DEVIATION": 904.83788, "READ_PAIRS": 9881192.0, "PAIR_ORIENTATION": "FR", "WIDTH_OF_10_PERCENT": 271.0, "WIDTH_OF_20_PERCENT": 435.0, "WIDTH_OF_30_PERCENT": 545.0, "WIDTH_OF_40_PERCENT": 619.0, "WIDTH_OF_50_PERCENT": 677.0, "WIDTH_OF_60_PERCENT": 861.0, "WIDTH_OF_70_PERCENT": 2331.0, "WIDTH_OF_80_PERCENT": 4953.0, "WIDTH_OF_90_PERCENT": 11487.0, "WIDTH_OF_95_PERCENT": 22255.0, "WIDTH_OF_99_PERCENT": 82867.0, "SAMPLE": "", "LIBRARY": "", "READ_GROUP": "" }, "rna_s1221_S42_FR": { "SAMPLE_NAME": "rna_s1221_S42", "MEDIAN_INSERT_SIZE": 396.0, "MODE_INSERT_SIZE": 118.0, "MEDIAN_ABSOLUTE_DEVIATION": 292.0, "MIN_INSERT_SIZE": 7.0, "MAX_INSERT_SIZE": 597700.0, "MEAN_INSERT_SIZE": 661.011966, "STANDARD_DEVIATION": 788.126952, "READ_PAIRS": 9867787.0, "PAIR_ORIENTATION": "FR", "WIDTH_OF_10_PERCENT": 231.0, "WIDTH_OF_20_PERCENT": 377.0, "WIDTH_OF_30_PERCENT": 471.0, "WIDTH_OF_40_PERCENT": 535.0, "WIDTH_OF_50_PERCENT": 585.0, "WIDTH_OF_60_PERCENT": 823.0, "WIDTH_OF_70_PERCENT": 2291.0, "WIDTH_OF_80_PERCENT": 4891.0, "WIDTH_OF_90_PERCENT": 11387.0, "WIDTH_OF_95_PERCENT": 22103.0, "WIDTH_OF_99_PERCENT": 80755.0, "SAMPLE": "", "LIBRARY": "", "READ_GROUP": "" } }, "multiqc_picard_dups": { "rna_s1200_S21": { "LIBRARY": "Unknown Library", "UNPAIRED_READS_EXAMINED": 2.0, "READ_PAIRS_EXAMINED": 9899414.0, "SECONDARY_OR_SUPPLEMENTARY_RDS": 1326011.0, "UNMAPPED_READS": 76582.0, "UNPAIRED_READ_DUPLICATES": 2.0, "READ_PAIR_DUPLICATES": 1824767.0, "READ_PAIR_OPTICAL_DUPLICATES": 12067.0, "PERCENT_DUPLICATION": 0.184331, "ESTIMATED_LIBRARY_SIZE": 23557470.0, "READS_IN_DUPLICATE_PAIRS": 3649534.0, "READS_IN_UNIQUE_PAIRS": 16149294.0, "READS_IN_UNIQUE_UNPAIRED": 0.0, "READS_IN_DUPLICATE_PAIRS_OPTICAL": 24134.0, "READS_IN_DUPLICATE_PAIRS_NONOPTICAL": 3625400.0, "READS_IN_DUPLICATE_UNPAIRED": 2.0, "READS_UNMAPPED": 76582.0 }, "rna_s1221_S42": { "LIBRARY": "Unknown Library", "UNPAIRED_READS_EXAMINED": 3.0, "READ_PAIRS_EXAMINED": 9888393.0, "SECONDARY_OR_SUPPLEMENTARY_RDS": 3584450.0, "UNMAPPED_READS": 87223.0, "UNPAIRED_READ_DUPLICATES": 3.0, "READ_PAIR_DUPLICATES": 1973538.0, "READ_PAIR_OPTICAL_DUPLICATES": 18255.0, "PERCENT_DUPLICATION": 0.199581, "ESTIMATED_LIBRARY_SIZE": 21499970.0, "READS_IN_DUPLICATE_PAIRS": 3947076.0, "READS_IN_UNIQUE_PAIRS": 15829710.0, "READS_IN_UNIQUE_UNPAIRED": 0.0, "READS_IN_DUPLICATE_PAIRS_OPTICAL": 36510.0, "READS_IN_DUPLICATE_PAIRS_NONOPTICAL": 3910566.0, "READS_IN_DUPLICATE_UNPAIRED": 3.0, "READS_UNMAPPED": 87223.0 } }, "picard_histogram": {}, "picard_histogram_1": {}, "multiqc_picard_RnaSeqMetrics": { "rna_s1200_S21": { "PF_BASES": 2795883347.0, "PF_ALIGNED_BASES": 2772797282.0, "RIBOSOMAL_BASES": 300.0, "CODING_BASES": 2470896529.0, "UTR_BASES": 201902141.0, "INTRONIC_BASES": 86792356.0, "INTERGENIC_BASES": 13205956.0, "IGNORED_READS": 0.0, "CORRECT_STRAND_READS": 0.0, "INCORRECT_STRAND_READS": 0.0, "NUM_R1_TRANSCRIPT_STRAND_READS": 128383.0, "NUM_R2_TRANSCRIPT_STRAND_READS": 8100715.0, "NUM_UNEXPLAINED_READS": 41447.0, "PCT_R1_TRANSCRIPT_STRAND_READS": 1.5601, "PCT_R2_TRANSCRIPT_STRAND_READS": 98.43990000000001, "PCT_RIBOSOMAL_BASES": 0.0, "PCT_CODING_BASES": 89.1121, "PCT_UTR_BASES": 7.2815, "PCT_INTRONIC_BASES": 3.1301, "PCT_INTERGENIC_BASES": 0.4763, "PCT_MRNA_BASES": 96.3936, "PCT_USABLE_BASES": 95.5976, "PCT_CORRECT_STRAND_READS": 0.0, "MEDIAN_CV_COVERAGE": 0.563571, "MEDIAN_5PRIME_BIAS": 0.543049, "MEDIAN_3PRIME_BIAS": 0.68164, "MEDIAN_5PRIME_TO_3PRIME_BIAS": 0.755191, "SAMPLE": "NA", "LIBRARY": "NA", "READ_GROUP": "NA", "PF_NOT_ALIGNED_BASES": 23086065.0 }, "rna_s1221_S42": { "PF_BASES": 2754287345.0, "PF_ALIGNED_BASES": 2727550835.0, "RIBOSOMAL_BASES": 2380143.0, "CODING_BASES": 2400643463.0, "UTR_BASES": 197498918.0, "INTRONIC_BASES": 94951215.0, "INTERGENIC_BASES": 32077096.0, "IGNORED_READS": 0.0, "CORRECT_STRAND_READS": 0.0, "INCORRECT_STRAND_READS": 0.0, "NUM_R1_TRANSCRIPT_STRAND_READS": 82025.0, "NUM_R2_TRANSCRIPT_STRAND_READS": 8016569.0, "NUM_UNEXPLAINED_READS": 44319.0, "PCT_R1_TRANSCRIPT_STRAND_READS": 1.0128, "PCT_R2_TRANSCRIPT_STRAND_READS": 98.9872, "PCT_RIBOSOMAL_BASES": 0.0873, "PCT_CODING_BASES": 88.0146, "PCT_UTR_BASES": 7.2409, "PCT_INTRONIC_BASES": 3.4812000000000003, "PCT_INTERGENIC_BASES": 1.176, "PCT_MRNA_BASES": 95.2555, "PCT_USABLE_BASES": 94.33080000000001, "PCT_CORRECT_STRAND_READS": 0.0, "MEDIAN_CV_COVERAGE": 0.579755, "MEDIAN_5PRIME_BIAS": 0.568567, "MEDIAN_3PRIME_BIAS": 0.670525, "MEDIAN_5PRIME_TO_3PRIME_BIAS": 0.715967, "SAMPLE": "NA", "LIBRARY": "NA", "READ_GROUP": "NA", "PF_NOT_ALIGNED_BASES": 26736510.0 } }, "picard_histogram_2": {}, "preseq": { "rna_s1200_S21.lc_extrap": { "0.0": 0.0, "1000000.0": 965348.5, "2000000.0": 1880124.5, "3000000.0": 2754531.0, "4000000.0": 3593777.0, "5000000.0": 4401418.0, "6000000.0": 5180121.5, "7000000.0": 5932069.5, "8000000.0": 6659084.0, "9000000.0": 7362728.5, "10000000.0": 8044317.2, "11000000.0": 8705142.5, "12000000.0": 9346398.5, "13000000.0": 9968804.0, "14000000.0": 10573548.5, "15000000.0": 11161503.4, "16000000.0": 11733225.1, "17000000.0": 12289426.9, "18000000.0": 12830945.3, "19000000.0": 13358384.4, "20000000.0": 13872380.6, "21000000.0": 14373498.1, "22000000.0": 14861784.1, "23000000.0": 15338342.4, "24000000.0": 15803266.2, "25000000.0": 16257153.8, "26000000.0": 16700079.6, "27000000.0": 17132634.9, "28000000.0": 17555121.2, "29000000.0": 17968131.8, "30000000.0": 18371845.6, "31000000.0": 18766098.2, "32000000.0": 19152640.8, "33000000.0": 19531093.9, "34000000.0": 19900201.9, "35000000.0": 20261794.0, "36000000.0": 20616169.5, "37000000.0": 20963406.1, "38000000.0": 21303315.7, "39000000.0": 21636389.5, "40000000.0": 21962472.4, "41000000.0": 22282052.4, "42000000.0": 22595161.2, "43000000.0": 22902275.0, "44000000.0": 23203331.1, "45000000.0": 23498828.9, "46000000.0": 23788803.3, "47000000.0": 24073609.0, "48000000.0": 24353120.6, "49000000.0": 24627153.6, "50000000.0": 24896641.5, "51000000.0": 25161040.8, "52000000.0": 25421137.6, "53000000.0": 25676825.0, "54000000.0": 25927958.7, "55000000.0": 26174606.3, "56000000.0": 26417013.6, "57000000.0": 26655115.4, "58000000.0": 26889160.1, "59000000.0": 27119278.6, "60000000.0": 27345569.4, "61000000.0": 27568127.8, "62000000.0": 27787045.8, "63000000.0": 28002412.4, "64000000.0": 28214313.7, "65000000.0": 28422833.2, "66000000.0": 28628051.4, "67000000.0": 28830046.5, "68000000.0": 29028894.0, "69000000.0": 29224657.6, "70000000.0": 29416835.8, "71000000.0": 29605719.0, "72000000.0": 29791699.6, "73000000.0": 29974842.7, "74000000.0": 30155228.7, "75000000.0": 30333769.3, "76000000.0": 30509689.9, "77000000.0": 30683047.8, "78000000.0": 30853898.8, "79000000.0": 31022297.0, "80000000.0": 31188295.0, "81000000.0": 31351943.8, "82000000.0": 31513293.1, "83000000.0": 31672391.1, "84000000.0": 31829284.7, "85000000.0": 31984019.5, "86000000.0": 32136639.9, "87000000.0": 32287189.0, "88000000.0": 32435708.7, "89000000.0": 32582239.9, "90000000.0": 32726822.4, "91000000.0": 32869494.8, "92000000.0": 33010294.7, "93000000.0": 33149243.6, "94000000.0": 33286208.5, "95000000.0": 33421407.6, "96000000.0": 33554874.7, "97000000.0": 33686643.1, "98000000.0": 33816745.0, "99000000.0": 33945211.9, "100000000.0": 34072074.3, "101000000.0": 34197362.3, "102000000.0": 34321104.9, "103000000.0": 34443330.6, "104000000.0": 34564067.3, "105000000.0": 34683341.8, "106000000.0": 34801180.7, "107000000.0": 34917609.8, "108000000.0": 35032654.2, "109000000.0": 35146338.5, "110000000.0": 35258686.6, "111000000.0": 35369722.2, "112000000.0": 35479467.9, "113000000.0": 35587946.3, "114000000.0": 35695179.1, "115000000.0": 35801187.6, "116000000.0": 35905992.8, "117000000.0": 36009615.1, "118000000.0": 36112074.3, "119000000.0": 36213389.9, "120000000.0": 36313581.1, "121000000.0": 36412666.4, "122000000.0": 36510664.0, "123000000.0": 36607591.8, "124000000.0": 36703467.2, "125000000.0": 36798307.3, "126000000.0": 36892128.8, "127000000.0": 36984947.9, "128000000.0": 37076780.7, "129000000.0": 37167642.9, "130000000.0": 37257549.6, "131000000.0": 37346516.1, "132000000.0": 37434556.8, "133000000.0": 37521686.3, "134000000.0": 37607918.5, "135000000.0": 37693267.3, "136000000.0": 37777746.3, "137000000.0": 37861368.5, "138000000.0": 37944147.1, "139000000.0": 38026094.7, "140000000.0": 38107223.7, "141000000.0": 38187546.4, "142000000.0": 38267074.8, "143000000.0": 38345820.6, "144000000.0": 38423795.2, "145000000.0": 38501010.1, "146000000.0": 38577476.1, "147000000.0": 38653204.2, "148000000.0": 38728204.9, "149000000.0": 38802488.8, "150000000.0": 38876066.1, "151000000.0": 38948946.8, "152000000.0": 39021140.7, "153000000.0": 39092657.5, "154000000.0": 39163506.7, "155000000.0": 39233697.6, "156000000.0": 39303239.4, "157000000.0": 39372141.0, "158000000.0": 39440411.2, "159000000.0": 39508058.7, "160000000.0": 39575091.9, "161000000.0": 39641519.1, "162000000.0": 39707348.6, "163000000.0": 39772588.5, "164000000.0": 39837246.4, "165000000.0": 39901330.4, "166000000.0": 39964847.8, "167000000.0": 40027806.3, "168000000.0": 40090213.2, "169000000.0": 40152075.6, "170000000.0": 40213400.8, "171000000.0": 40274195.6, "172000000.0": 40334466.9, "173000000.0": 40394221.5, "174000000.0": 40453465.9, "175000000.0": 40512206.7, "176000000.0": 40570450.3, "177000000.0": 40628202.9, "178000000.0": 40685470.8, "179000000.0": 40742260.0, "180000000.0": 40798576.5, "181000000.0": 40854426.2, "182000000.0": 40909814.8, "183000000.0": 40964748.1, "184000000.0": 41019231.6, "185000000.0": 41073270.9, "186000000.0": 41126871.3, "187000000.0": 41180038.2, "188000000.0": 41232776.9, "189000000.0": 41285092.4, "190000000.0": 41336989.8, "191000000.0": 41388474.2, "192000000.0": 41439550.4, "193000000.0": 41490223.4, "194000000.0": 41540497.8, "195000000.0": 41590378.3, "196000000.0": 41639869.6, "197000000.0": 41688976.1, "198000000.0": 41737702.4, "199000000.0": 41786052.9, "200000000.0": 41834031.8, "201000000.0": 41881643.5, "202000000.0": 41928892.2, "203000000.0": 41975781.9, "204000000.0": 42022316.8, "205000000.0": 42068500.9, "206000000.0": 42114338.1, "207000000.0": 42159832.4, "208000000.0": 42204987.5, "209000000.0": 42249807.3, "210000000.0": 42294279.4, "211000000.0": 42338370.8, "212000000.0": 42382138.1, "213000000.0": 42425584.8, "214000000.0": 42468714.4, "215000000.0": 42511530.4, "216000000.0": 42554036.3, "217000000.0": 42596235.3, "218000000.0": 42638130.9, "219000000.0": 42679726.1, "220000000.0": 42721024.4, "221000000.0": 42762028.7, "222000000.0": 42802736.9, "223000000.0": 42843146.3, "224000000.0": 42883271.1, "225000000.0": 42923114.4, "226000000.0": 42962679.0, "227000000.0": 43001968.0, "228000000.0": 43040984.1, "229000000.0": 43079730.2, "230000000.0": 43118209.1, "231000000.0": 43156423.6, "232000000.0": 43194376.3, "233000000.0": 43232070.0, "234000000.0": 43269507.2, "235000000.0": 43306723.2, "236000000.0": 43343716.4, "237000000.0": 43380460.8, "238000000.0": 43416958.7, "239000000.0": 43453212.6, "240000000.0": 43489225.0, "241000000.0": 43524998.3, "242000000.0": 43560534.9, "243000000.0": 43595837.0, "244000000.0": 43630907.1, "245000000.0": 43665747.3, "246000000.0": 43700360.0, "247000000.0": 43734747.4, "248000000.0": 43768911.6, "249000000.0": 43802854.8, "250000000.0": 43836579.2, "251000000.0": 43870086.8, "252000000.0": 43903379.9, "253000000.0": 43936460.3, "254000000.0": 43969360.9, "255000000.0": 44002136.3, "256000000.0": 44034704.6, "257000000.0": 44067067.9, "258000000.0": 44099228.0, "259000000.0": 44131110.7, "260000000.0": 44162788.6, "261000000.0": 44194269.3, "262000000.0": 44225554.8, "263000000.0": 44256645.9, "264000000.0": 44287530.6, "265000000.0": 44318225.5, "266000000.0": 44348732.2, "267000000.0": 44379052.5, "268000000.0": 44409188.0, "269000000.0": 44439140.5, "270000000.0": 44468911.7, "271000000.0": 44498503.1, "272000000.0": 44527916.3, "273000000.0": 44557153.1, "274000000.0": 44586215.0, "275000000.0": 44615135.5, "276000000.0": 44643908.7, "277000000.0": 44672511.4, "278000000.0": 44700945.0, "279000000.0": 44729211.2, "280000000.0": 44757311.3, "281000000.0": 44785246.9, "282000000.0": 44813019.3, "283000000.0": 44840630.1, "284000000.0": 44868080.5, "285000000.0": 44895372.1, "286000000.0": 44922506.1, "287000000.0": 44949483.9, "288000000.0": 44976307.0, "289000000.0": 45002976.5, "290000000.0": 45029493.9, "291000000.0": 45055860.3, "292000000.0": 45082077.2, "293000000.0": 45108145.8, "294000000.0": 45134067.3, "295000000.0": 45159842.9, "296000000.0": 45185474.0, "297000000.0": 45210961.7, "298000000.0": 45236307.1, "299000000.0": 45261511.6, "300000000.0": 45286576.3, "301000000.0": 45311502.3, "302000000.0": 45336290.7, "303000000.0": 45360942.8, "304000000.0": 45385459.6, "305000000.0": 45409842.3, "306000000.0": 45434091.9, "307000000.0": 45458209.5, "308000000.0": 45482196.3, "309000000.0": 45506053.2, "310000000.0": 45529781.4, "311000000.0": 45553381.8, "312000000.0": 45576855.5, "313000000.0": 45600203.4, "314000000.0": 45623426.8, "315000000.0": 45646526.4, "316000000.0": 45669503.3, "317000000.0": 45692358.5, "318000000.0": 45715092.9, "319000000.0": 45737707.6, "320000000.0": 45760203.3, "321000000.0": 45782581.1, "322000000.0": 45804842.0, "323000000.0": 45826986.7, "324000000.0": 45849016.2, "325000000.0": 45870931.5, "326000000.0": 45892733.4, "327000000.0": 45914422.7, "328000000.0": 45936000.4, "329000000.0": 45957467.3, "330000000.0": 45978824.2, "331000000.0": 46000072.1, "332000000.0": 46021225.4, "333000000.0": 46042281.2, "334000000.0": 46063230.3, "335000000.0": 46084073.4, "336000000.0": 46104811.5, "337000000.0": 46125445.3, "338000000.0": 46145975.6, "339000000.0": 46166403.1, "340000000.0": 46186728.6, "341000000.0": 46206953.0, "342000000.0": 46227076.9, "343000000.0": 46247101.1, "344000000.0": 46267026.3, "345000000.0": 46286853.3, "346000000.0": 46306582.8, "347000000.0": 46326215.5, "348000000.0": 46345752.1, "349000000.0": 46365193.3, "350000000.0": 46384539.8, "351000000.0": 46403792.4, "352000000.0": 46422951.6, "353000000.0": 46442018.3, "354000000.0": 46460992.9, "355000000.0": 46479876.3, "356000000.0": 46498669.0, "357000000.0": 46517371.7, "358000000.0": 46535985.1, "359000000.0": 46554509.8, "360000000.0": 46572946.4, "361000000.0": 46591295.6, "362000000.0": 46609557.9, "363000000.0": 46627734.0, "364000000.0": 46645824.5, "365000000.0": 46663830.1, "366000000.0": 46681751.2, "367000000.0": 46699588.5, "368000000.0": 46717342.6, "369000000.0": 46735014.1, "370000000.0": 46752603.5, "371000000.0": 46770111.4, "372000000.0": 46787538.3, "373000000.0": 46804884.9, "374000000.0": 46822151.7, "375000000.0": 46839339.2, "376000000.0": 46856448.0, "377000000.0": 46873478.7, "378000000.0": 46890431.6, "379000000.0": 46907307.5, "380000000.0": 46924106.7, "381000000.0": 46940829.9, "382000000.0": 46957477.6, "383000000.0": 46974050.2, "384000000.0": 46990548.2, "385000000.0": 47006972.2, "386000000.0": 47023322.7, "387000000.0": 47039600.2, "388000000.0": 47055805.0, "389000000.0": 47071937.8, "390000000.0": 47087999.0, "391000000.0": 47103989.1, "392000000.0": 47119908.6, "393000000.0": 47135757.8, "394000000.0": 47151537.4, "395000000.0": 47167247.7, "396000000.0": 47182889.2, "397000000.0": 47198462.3, "398000000.0": 47213967.5, "399000000.0": 47229405.3, "400000000.0": 47244776.0, "401000000.0": 47260080.2, "402000000.0": 47275318.2, "403000000.0": 47290490.5, "404000000.0": 47305597.5, "405000000.0": 47320639.6, "406000000.0": 47335617.2, "407000000.0": 47350530.8, "408000000.0": 47365380.7, "409000000.0": 47380167.4, "410000000.0": 47394891.3, "411000000.0": 47409552.7, "412000000.0": 47424152.1, "413000000.0": 47438689.9, "414000000.0": 47453166.4, "415000000.0": 47467582.0, "416000000.0": 47481937.2, "417000000.0": 47496232.2, "418000000.0": 47510467.6, "419000000.0": 47524643.5, "420000000.0": 47538760.5, "421000000.0": 47552818.9, "422000000.0": 47566819.0, "423000000.0": 47580761.3, "424000000.0": 47594646.0, "425000000.0": 47608473.5, "426000000.0": 47622244.2, "427000000.0": 47635958.4, "428000000.0": 47649616.5, "429000000.0": 47663218.8, "430000000.0": 47676765.7, "431000000.0": 47690257.5, "432000000.0": 47703694.5, "433000000.0": 47717077.1, "434000000.0": 47730405.5, "435000000.0": 47743680.2, "436000000.0": 47756901.4, "437000000.0": 47770069.5, "438000000.0": 47783184.8, "439000000.0": 47796247.6, "440000000.0": 47809258.2, "441000000.0": 47822217.0, "442000000.0": 47835124.1, "443000000.0": 47847980.1, "444000000.0": 47860785.1, "445000000.0": 47873539.4, "446000000.0": 47886243.4, "447000000.0": 47898897.4, "448000000.0": 47911501.6, "449000000.0": 47924056.3, "450000000.0": 47936561.9, "451000000.0": 47949018.6, "452000000.0": 47961426.7, "453000000.0": 47973786.5, "454000000.0": 47986098.2, "455000000.0": 47998362.2, "456000000.0": 48010578.8, "457000000.0": 48022748.1, "458000000.0": 48034870.5, "459000000.0": 48046946.3, "460000000.0": 48058975.7, "461000000.0": 48070959.0, "462000000.0": 48082889.2, "463000000.0": 48094771.6, "464000000.0": 48106608.8, "465000000.0": 48118401.0, "466000000.0": 48130148.4, "467000000.0": 48141851.2, "468000000.0": 48153509.8, "469000000.0": 48165124.4, "470000000.0": 48176695.1, "471000000.0": 48188222.4, "472000000.0": 48199706.4, "473000000.0": 48211147.3, "474000000.0": 48222545.5, "475000000.0": 48233901.1, "476000000.0": 48245214.3, "477000000.0": 48256485.5, "478000000.0": 48267714.9, "479000000.0": 48278902.6, "480000000.0": 48290048.9, "481000000.0": 48301154.1, "482000000.0": 48312218.4, "483000000.0": 48323242.0, "484000000.0": 48334225.0, "485000000.0": 48345167.9, "486000000.0": 48356070.7, "487000000.0": 48366933.6, "488000000.0": 48377757.0, "489000000.0": 48388541.0, "490000000.0": 48399285.9, "491000000.0": 48409991.8, "492000000.0": 48420658.9, "493000000.0": 48431287.5, "494000000.0": 48441877.8, "495000000.0": 48452430.0, "496000000.0": 48462944.2, "497000000.0": 48473420.8, "498000000.0": 48483859.8, "499000000.0": 48494261.6, "500000000.0": 48504626.2, "501000000.0": 48514953.9, "502000000.0": 48525245.0, "503000000.0": 48535499.5, "504000000.0": 48545717.7, "505000000.0": 48555899.7, "506000000.0": 48566045.9, "507000000.0": 48576156.3, "508000000.0": 48586231.1, "509000000.0": 48596270.5, "510000000.0": 48606274.8, "511000000.0": 48616244.1, "512000000.0": 48626178.5, "513000000.0": 48636078.4, "514000000.0": 48645943.7, "515000000.0": 48655774.8, "516000000.0": 48665571.8, "517000000.0": 48675334.9, "518000000.0": 48685064.3, "519000000.0": 48694760.0, "520000000.0": 48704422.4, "521000000.0": 48714051.6, "522000000.0": 48723647.7, "523000000.0": 48733210.9, "524000000.0": 48742741.4, "525000000.0": 48752239.4, "526000000.0": 48761705.0, "527000000.0": 48771138.4, "528000000.0": 48780539.7, "529000000.0": 48789909.1, "530000000.0": 48799246.8, "531000000.0": 48808553.0, "532000000.0": 48817827.7, "533000000.0": 48827071.2, "534000000.0": 48836283.7, "535000000.0": 48845465.2, "536000000.0": 48854615.9, "537000000.0": 48863736.0, "538000000.0": 48872825.6, "539000000.0": 48881884.9, "540000000.0": 48890914.0, "541000000.0": 48899913.2, "542000000.0": 48908882.5, "543000000.0": 48917822.0, "544000000.0": 48926732.0, "545000000.0": 48935612.6, "546000000.0": 48944463.9, "547000000.0": 48953286.0, "548000000.0": 48962079.2, "549000000.0": 48970843.5, "550000000.0": 48979579.2, "551000000.0": 48988286.2, "552000000.0": 48996964.9, "553000000.0": 49005615.2, "554000000.0": 49014237.4, "555000000.0": 49022831.6, "556000000.0": 49031398.0, "557000000.0": 49039936.6, "558000000.0": 49048447.5, "559000000.0": 49056931.1, "560000000.0": 49065387.3, "561000000.0": 49073816.2, "562000000.0": 49082218.2, "563000000.0": 49090593.1, "564000000.0": 49098941.3, "565000000.0": 49107262.7, "566000000.0": 49115557.7, "567000000.0": 49123826.1, "568000000.0": 49132068.3, "569000000.0": 49140284.3, "570000000.0": 49148474.3, "571000000.0": 49156638.3, "572000000.0": 49164776.5, "573000000.0": 49172889.0, "574000000.0": 49180976.0, "575000000.0": 49189037.5, "576000000.0": 49197073.7, "577000000.0": 49205084.7, "578000000.0": 49213070.6, "579000000.0": 49221031.5, "580000000.0": 49228967.6, "581000000.0": 49236879.0, "582000000.0": 49244765.7, "583000000.0": 49252627.9, "584000000.0": 49260465.8, "585000000.0": 49268279.3, "586000000.0": 49276068.7, "587000000.0": 49283834.0, "588000000.0": 49291575.4, "589000000.0": 49299293.0, "590000000.0": 49306986.9, "591000000.0": 49314657.1, "592000000.0": 49322303.8, "593000000.0": 49329927.2, "594000000.0": 49337527.2, "595000000.0": 49345104.1, "596000000.0": 49352657.9, "597000000.0": 49360188.7, "598000000.0": 49367696.6, "599000000.0": 49375181.8, "600000000.0": 49382644.4, "601000000.0": 49390084.3, "602000000.0": 49397501.9, "603000000.0": 49404897.0, "604000000.0": 49412269.9, "605000000.0": 49419620.7, "606000000.0": 49426949.4, "607000000.0": 49434256.2, "608000000.0": 49441541.1, "609000000.0": 49448804.3, "610000000.0": 49456045.8, "611000000.0": 49463265.7, "612000000.0": 49470464.2, "613000000.0": 49477641.3, "614000000.0": 49484797.1, "615000000.0": 49491931.7, "616000000.0": 49499045.3, "617000000.0": 49506137.8, "618000000.0": 49513209.5, "619000000.0": 49520260.3, "620000000.0": 49527290.5, "621000000.0": 49534300.0, "622000000.0": 49541289.0, "623000000.0": 49548257.5, "624000000.0": 49555205.7, "625000000.0": 49562133.6, "626000000.0": 49569041.3, "627000000.0": 49575929.0, "628000000.0": 49582796.6, "629000000.0": 49589644.3, "630000000.0": 49596472.2, "631000000.0": 49603280.4, "632000000.0": 49610068.9, "633000000.0": 49616837.8, "634000000.0": 49623587.2, "635000000.0": 49630317.3, "636000000.0": 49637028.0, "637000000.0": 49643719.5, "638000000.0": 49650391.8, "639000000.0": 49657045.0, "640000000.0": 49663679.3, "641000000.0": 49670294.6, "642000000.0": 49676891.2, "643000000.0": 49683468.9, "644000000.0": 49690028.0, "645000000.0": 49696568.6, "646000000.0": 49703090.6, "647000000.0": 49709594.1, "648000000.0": 49716079.4, "649000000.0": 49722546.3, "650000000.0": 49728995.1, "651000000.0": 49735425.7, "652000000.0": 49741838.3, "653000000.0": 49748232.9, "654000000.0": 49754609.6, "655000000.0": 49760968.5, "656000000.0": 49767309.6, "657000000.0": 49773633.1, "658000000.0": 49779939.0, "659000000.0": 49786227.4, "660000000.0": 49792498.3, "661000000.0": 49798751.8, "662000000.0": 49804988.0, "663000000.0": 49811207.0, "664000000.0": 49817408.8, "665000000.0": 49823593.6, "666000000.0": 49829761.3, "667000000.0": 49835912.0, "668000000.0": 49842045.9, "669000000.0": 49848163.0, "670000000.0": 49854263.3, "671000000.0": 49860346.9, "672000000.0": 49866414.0, "673000000.0": 49872464.5, "674000000.0": 49878498.5, "675000000.0": 49884516.2, "676000000.0": 49890517.5, "677000000.0": 49896502.5, "678000000.0": 49902471.3, "679000000.0": 49908424.0, "680000000.0": 49914360.6, "681000000.0": 49920281.2, "682000000.0": 49926185.8, "683000000.0": 49932074.6, "684000000.0": 49937947.6, "685000000.0": 49943804.8, "686000000.0": 49949646.3, "687000000.0": 49955472.2, "688000000.0": 49961282.5, "689000000.0": 49967077.4, "690000000.0": 49972856.8, "691000000.0": 49978620.8, "692000000.0": 49984369.5, "693000000.0": 49990102.9, "694000000.0": 49995821.2, "695000000.0": 50001524.3, "696000000.0": 50007212.3, "697000000.0": 50012885.4, "698000000.0": 50018543.5, "699000000.0": 50024186.6, "700000000.0": 50029815.0, "701000000.0": 50035428.5, "702000000.0": 50041027.4, "703000000.0": 50046611.6, "704000000.0": 50052181.2, "705000000.0": 50057736.2, "706000000.0": 50063276.7, "707000000.0": 50068802.8, "708000000.0": 50074314.6, "709000000.0": 50079812.0, "710000000.0": 50085295.1, "711000000.0": 50090764.0, "712000000.0": 50096218.8, "713000000.0": 50101659.5, "714000000.0": 50107086.1, "715000000.0": 50112498.8, "716000000.0": 50117897.5, "717000000.0": 50123282.0, "718000000.0": 50128649.2, "719000000.0": 50134002.6, "720000000.0": 50139342.3, "721000000.0": 50144668.3, "722000000.0": 50149980.7, "723000000.0": 50155279.6, "724000000.0": 50160564.9, "725000000.0": 50165836.8, "726000000.0": 50171095.3, "727000000.0": 50176340.4, "728000000.0": 50181572.2, "729000000.0": 50186790.8, "730000000.0": 50191996.2, "731000000.0": 50197188.4, "732000000.0": 50202367.5, "733000000.0": 50207533.6, "734000000.0": 50212686.6, "735000000.0": 50217826.7, "736000000.0": 50222954.0, "737000000.0": 50228068.3, "738000000.0": 50233169.8, "739000000.0": 50238258.6, "740000000.0": 50243334.7, "741000000.0": 50248398.1, "742000000.0": 50253448.9, "743000000.0": 50258487.1, "744000000.0": 50263512.7, "745000000.0": 50268526.0, "746000000.0": 50273526.7, "747000000.0": 50278515.1, "748000000.0": 50283491.2, "749000000.0": 50288454.9, "750000000.0": 50293406.5, "751000000.0": 50298345.8, "752000000.0": 50303272.9, "753000000.0": 50308188.0, "754000000.0": 50313090.9, "755000000.0": 50317981.9, "756000000.0": 50322860.9, "757000000.0": 50327727.9, "758000000.0": 50332583.0, "759000000.0": 50337426.3, "760000000.0": 50342257.8, "761000000.0": 50347077.6, "762000000.0": 50351885.6, "763000000.0": 50356681.9, "764000000.0": 50361466.6, "765000000.0": 50366239.7, "766000000.0": 50371001.3, "767000000.0": 50375751.4, "768000000.0": 50380489.9, "769000000.0": 50385217.1, "770000000.0": 50389932.9, "771000000.0": 50394637.3, "772000000.0": 50399330.5, "773000000.0": 50404012.4, "774000000.0": 50408683.0, "775000000.0": 50413342.5, "776000000.0": 50417990.8, "777000000.0": 50422628.1, "778000000.0": 50427254.3, "779000000.0": 50431869.4, "780000000.0": 50436473.6, "781000000.0": 50441066.8, "782000000.0": 50445649.2, "783000000.0": 50450220.7, "784000000.0": 50454781.3, "785000000.0": 50459331.2, "786000000.0": 50463870.3, "787000000.0": 50468398.7, "788000000.0": 50472916.4, "789000000.0": 50477423.5, "790000000.0": 50481920.0, "791000000.0": 50486405.9, "792000000.0": 50490881.3, "793000000.0": 50495346.3, "794000000.0": 50499800.7, "795000000.0": 50504244.8, "796000000.0": 50508678.5, "797000000.0": 50513101.8, "798000000.0": 50517514.9, "799000000.0": 50521917.6, "800000000.0": 50526310.2, "801000000.0": 50530692.5, "802000000.0": 50535064.7, "803000000.0": 50539426.8, "804000000.0": 50543778.7, "805000000.0": 50548120.7, "806000000.0": 50552452.5, "807000000.0": 50556774.4, "808000000.0": 50561086.4, "809000000.0": 50565388.4, "810000000.0": 50569680.6, "811000000.0": 50573962.9, "812000000.0": 50578235.4, "813000000.0": 50582498.1, "814000000.0": 50586751.1, "815000000.0": 50590994.3, "816000000.0": 50595227.9, "817000000.0": 50599451.8, "818000000.0": 50603666.1, "819000000.0": 50607870.8, "820000000.0": 50612066.0, "821000000.0": 50616251.6, "822000000.0": 50620427.8, "823000000.0": 50624594.5, "824000000.0": 50628751.8, "825000000.0": 50632899.7, "826000000.0": 50637038.2, "827000000.0": 50641167.4, "828000000.0": 50645287.4, "829000000.0": 50649398.0, "830000000.0": 50653499.5, "831000000.0": 50657591.7, "832000000.0": 50661674.8, "833000000.0": 50665748.7, "834000000.0": 50669813.5, "835000000.0": 50673869.2, "836000000.0": 50677915.9, "837000000.0": 50681953.6, "838000000.0": 50685982.3, "839000000.0": 50690002.0, "840000000.0": 50694012.8, "841000000.0": 50698014.7, "842000000.0": 50702007.8, "843000000.0": 50705992.0, "844000000.0": 50709967.4, "845000000.0": 50713934.0, "846000000.0": 50717891.8, "847000000.0": 50721841.0, "848000000.0": 50725781.4, "849000000.0": 50729713.2, "850000000.0": 50733636.3, "851000000.0": 50737550.9, "852000000.0": 50741456.8, "853000000.0": 50745354.2, "854000000.0": 50749243.1, "855000000.0": 50753123.5, "856000000.0": 50756995.4, "857000000.0": 50760858.9, "858000000.0": 50764714.0, "859000000.0": 50768560.7, "860000000.0": 50772399.0, "861000000.0": 50776229.0, "862000000.0": 50780050.7, "863000000.0": 50783864.1, "864000000.0": 50787669.3, "865000000.0": 50791466.3, "866000000.0": 50795255.0, "867000000.0": 50799035.6, "868000000.0": 50802808.1, "869000000.0": 50806572.4, "870000000.0": 50810328.6, "871000000.0": 50814076.8, "872000000.0": 50817816.9, "873000000.0": 50821549.0, "874000000.0": 50825273.2, "875000000.0": 50828989.4, "876000000.0": 50832697.6, "877000000.0": 50836397.9, "878000000.0": 50840090.4, "879000000.0": 50843774.9, "880000000.0": 50847451.7, "881000000.0": 50851120.6, "882000000.0": 50854781.8, "883000000.0": 50858435.2, "884000000.0": 50862080.8, "885000000.0": 50865718.8, "886000000.0": 50869349.1, "887000000.0": 50872971.7, "888000000.0": 50876586.6, "889000000.0": 50880194.0, "890000000.0": 50883793.7, "891000000.0": 50887385.9, "892000000.0": 50890970.6, "893000000.0": 50894547.7, "894000000.0": 50898117.3, "895000000.0": 50901679.5, "896000000.0": 50905234.2, "897000000.0": 50908781.5, "898000000.0": 50912321.4, "899000000.0": 50915853.9, "900000000.0": 50919379.1, "901000000.0": 50922896.9, "902000000.0": 50926407.4, "903000000.0": 50929910.6, "904000000.0": 50933406.6, "905000000.0": 50936895.3, "906000000.0": 50940376.8, "907000000.0": 50943851.2, "908000000.0": 50947318.3, "909000000.0": 50950778.3, "910000000.0": 50954231.1, "911000000.0": 50957676.9, "912000000.0": 50961115.6, "913000000.0": 50964547.2, "914000000.0": 50967971.7, "915000000.0": 50971389.2, "916000000.0": 50974799.8, "917000000.0": 50978203.3, "918000000.0": 50981599.9, "919000000.0": 50984989.6, "920000000.0": 50988372.4, "921000000.0": 50991748.2, "922000000.0": 50995117.2, "923000000.0": 50998479.4, "924000000.0": 51001834.7, "925000000.0": 51005183.2, "926000000.0": 51008524.9, "927000000.0": 51011859.8, "928000000.0": 51015188.0, "929000000.0": 51018509.5, "930000000.0": 51021824.3, "931000000.0": 51025132.4, "932000000.0": 51028433.8, "933000000.0": 51031728.5, "934000000.0": 51035016.7, "935000000.0": 51038298.2, "936000000.0": 51041573.2, "937000000.0": 51044841.6, "938000000.0": 51048103.4, "939000000.0": 51051358.7, "940000000.0": 51054607.5, "941000000.0": 51057849.9, "942000000.0": 51061085.7, "943000000.0": 51064315.1, "944000000.0": 51067538.1, "945000000.0": 51070754.7, "946000000.0": 51073964.8, "947000000.0": 51077168.6, "948000000.0": 51080366.1, "949000000.0": 51083557.2, "950000000.0": 51086742.0, "951000000.0": 51089920.5, "952000000.0": 51093092.7, "953000000.0": 51096258.7, "954000000.0": 51099418.4, "955000000.0": 51102571.9, "956000000.0": 51105719.2, "957000000.0": 51108860.3, "958000000.0": 51111995.3, "959000000.0": 51115124.1, "960000000.0": 51118246.7, "961000000.0": 51121363.3, "962000000.0": 51124473.7, "963000000.0": 51127578.1, "964000000.0": 51130676.4, "965000000.0": 51133768.7, "966000000.0": 51136855.0, "967000000.0": 51139935.2, "968000000.0": 51143009.5, "969000000.0": 51146077.8, "970000000.0": 51149140.1, "971000000.0": 51152196.5, "972000000.0": 51155246.9, "973000000.0": 51158291.5, "974000000.0": 51161330.2, "975000000.0": 51164363.0, "976000000.0": 51167390.0, "977000000.0": 51170411.1, "978000000.0": 51173426.4, "979000000.0": 51176435.9, "980000000.0": 51179439.6, "981000000.0": 51182437.6, "982000000.0": 51185429.8, "983000000.0": 51188416.3, "984000000.0": 51191397.0, "985000000.0": 51194372.1, "986000000.0": 51197341.5, "987000000.0": 51200305.2, "988000000.0": 51203263.2, "989000000.0": 51206215.6, "990000000.0": 51209162.4, "991000000.0": 51212103.6, "992000000.0": 51215039.2, "993000000.0": 51217969.2, "994000000.0": 51220893.7, "995000000.0": 51223812.6, "996000000.0": 51226726.0, "997000000.0": 51229633.9, "998000000.0": 51232536.3, "999000000.0": 51235433.2, "1000000000.0": 51238324.7, "1001000000.0": 51241210.7, "1002000000.0": 51244091.2, "1003000000.0": 51246966.4, "1004000000.0": 51249836.2, "1005000000.0": 51252700.5, "1006000000.0": 51255559.5, "1007000000.0": 51258413.2, "1008000000.0": 51261261.5, "1009000000.0": 51264104.5, "1010000000.0": 51266942.1, "1011000000.0": 51269774.5, "1012000000.0": 51272601.6, "1013000000.0": 51275423.4, "1014000000.0": 51278240.0, "1015000000.0": 51281051.3, "1016000000.0": 51283857.4, "1017000000.0": 51286658.3, "1018000000.0": 51289454.0, "1019000000.0": 51292244.6, "1020000000.0": 51295029.9, "1021000000.0": 51297810.1, "1022000000.0": 51300585.2, "1023000000.0": 51303355.2, "1024000000.0": 51306120.0, "1025000000.0": 51308879.8, "1026000000.0": 51311634.5, "1027000000.0": 51314384.1, "1028000000.0": 51317128.6, "1029000000.0": 51319868.1, "1030000000.0": 51322602.6, "1031000000.0": 51325332.1, "1032000000.0": 51328056.6, "1033000000.0": 51330776.1, "1034000000.0": 51333490.6, "1035000000.0": 51336200.2, "1036000000.0": 51338904.9, "1037000000.0": 51341604.6, "1038000000.0": 51344299.4, "1039000000.0": 51346989.3, "1040000000.0": 51349674.3, "1041000000.0": 51352354.4, "1042000000.0": 51355029.7, "1043000000.0": 51357700.1, "1044000000.0": 51360365.7, "1045000000.0": 51363026.5, "1046000000.0": 51365682.4, "1047000000.0": 51368333.6, "1048000000.0": 51370979.9, "1049000000.0": 51373621.6, "1050000000.0": 51376258.4, "1051000000.0": 51378890.5, "1052000000.0": 51381517.9, "1053000000.0": 51384140.5, "1054000000.0": 51386758.5, "1055000000.0": 51389371.7, "1056000000.0": 51391980.3, "1057000000.0": 51394584.2, "1058000000.0": 51397183.5, "1059000000.0": 51399778.1, "1060000000.0": 51402368.1, "1061000000.0": 51404953.4, "1062000000.0": 51407534.2, "1063000000.0": 51410110.3, "1064000000.0": 51412681.9, "1065000000.0": 51415248.9, "1066000000.0": 51417811.4, "1067000000.0": 51420369.3, "1068000000.0": 51422922.6, "1069000000.0": 51425471.5, "1070000000.0": 51428015.8, "1071000000.0": 51430555.7, "1072000000.0": 51433091.1, "1073000000.0": 51435621.9, "1074000000.0": 51438148.4, "1075000000.0": 51440670.3, "1076000000.0": 51443187.9, "1077000000.0": 51445701.0, "1078000000.0": 51448209.7, "1079000000.0": 51450714.0, "1080000000.0": 51453213.9, "1081000000.0": 51455709.4, "1082000000.0": 51458200.6, "1083000000.0": 51460687.4, "1084000000.0": 51463169.8, "1085000000.0": 51465648.0, "1086000000.0": 51468121.7, "1087000000.0": 51470591.2, "1088000000.0": 51473056.4, "1089000000.0": 51475517.3, "1090000000.0": 51477973.9, "1091000000.0": 51480426.3, "1092000000.0": 51482874.4, "1093000000.0": 51485318.2, "1094000000.0": 51487757.9, "1095000000.0": 51490193.3, "1096000000.0": 51492624.5, "1097000000.0": 51495051.4, "1098000000.0": 51497474.2, "1099000000.0": 51499892.9, "1100000000.0": 51502307.3, "1101000000.0": 51504717.6, "1102000000.0": 51507123.7, "1103000000.0": 51509525.8, "1104000000.0": 51511923.6, "1105000000.0": 51514317.4, "1106000000.0": 51516707.1, "1107000000.0": 51519092.7, "1108000000.0": 51521474.1, "1109000000.0": 51523851.6, "1110000000.0": 51526224.9, "1111000000.0": 51528594.2, "1112000000.0": 51530959.5, "1113000000.0": 51533320.7, "1114000000.0": 51535677.9, "1115000000.0": 51538031.1, "1116000000.0": 51540380.3, "1117000000.0": 51542725.6, "1118000000.0": 51545066.8, "1119000000.0": 51547404.1, "1120000000.0": 51549737.4, "1121000000.0": 51552066.7, "1122000000.0": 51554392.1, "1123000000.0": 51556713.6, "1124000000.0": 51559031.2, "1125000000.0": 51561344.8, "1126000000.0": 51563654.6, "1127000000.0": 51565960.5, "1128000000.0": 51568262.4, "1129000000.0": 51570560.6, "1130000000.0": 51572854.8, "1131000000.0": 51575145.2, "1132000000.0": 51577431.8, "1133000000.0": 51579714.5, "1134000000.0": 51581993.4, "1135000000.0": 51584268.5, "1136000000.0": 51586539.8, "1137000000.0": 51588807.3, "1138000000.0": 51591071.1, "1139000000.0": 51593331.0, "1140000000.0": 51595587.2, "1141000000.0": 51597839.6, "1142000000.0": 51600088.3, "1143000000.0": 51602333.2, "1144000000.0": 51604574.4, "1145000000.0": 51606811.9, "1146000000.0": 51609045.7, "1147000000.0": 51611275.8, "1148000000.0": 51613502.2, "1149000000.0": 51615724.9, "1150000000.0": 51617944.0, "1151000000.0": 51620159.4, "1152000000.0": 51622371.1, "1153000000.0": 51624579.2, "1154000000.0": 51626783.6, "1155000000.0": 51628984.4, "1156000000.0": 51631181.6, "1157000000.0": 51633375.2, "1158000000.0": 51635565.2, "1159000000.0": 51637751.6, "1160000000.0": 51639934.5, "1161000000.0": 51642113.7, "1162000000.0": 51644289.4, "1163000000.0": 51646461.5, "1164000000.0": 51648630.1, "1165000000.0": 51650795.1, "1166000000.0": 51652956.6, "1167000000.0": 51655114.6, "1168000000.0": 51657269.1, "1169000000.0": 51659420.1, "1170000000.0": 51661567.5, "1171000000.0": 51663711.5, "1172000000.0": 51665852.0, "1173000000.0": 51667989.1, "1174000000.0": 51670122.6, "1175000000.0": 51672252.8, "1176000000.0": 51674379.4, "1177000000.0": 51676502.7, "1178000000.0": 51678622.5, "1179000000.0": 51680738.9, "1180000000.0": 51682851.8, "1181000000.0": 51684961.4, "1182000000.0": 51687067.6, "1183000000.0": 51689170.4, "1184000000.0": 51691269.8, "1185000000.0": 51693365.8, "1186000000.0": 51695458.5, "1187000000.0": 51697547.9, "1188000000.0": 51699633.8, "1189000000.0": 51701716.5, "1190000000.0": 51703795.8, "1191000000.0": 51705871.8, "1192000000.0": 51707944.4, "1193000000.0": 51710013.8, "1194000000.0": 51712079.9, "1195000000.0": 51714142.6, "1196000000.0": 51716202.1, "1197000000.0": 51718258.3, "1198000000.0": 51720311.3, "1199000000.0": 51722361.0, "1200000000.0": 51724407.4, "1201000000.0": 51726450.6, "1202000000.0": 51728490.6, "1203000000.0": 51730527.3, "1204000000.0": 51732560.8, "1205000000.0": 51734591.1, "1206000000.0": 51736618.2, "1207000000.0": 51738642.1, "1208000000.0": 51740662.8, "1209000000.0": 51742680.3, "1210000000.0": 51744694.6, "1211000000.0": 51746705.8, "1212000000.0": 51748713.8, "1213000000.0": 51750718.7, "1214000000.0": 51752720.4, "1215000000.0": 51754718.9, "1216000000.0": 51756714.4, "1217000000.0": 51758706.7, "1218000000.0": 51760695.9, "1219000000.0": 51762682.0, "1220000000.0": 51764665.0, "1221000000.0": 51766644.9, "1222000000.0": 51768621.7, "1223000000.0": 51770595.4, "1224000000.0": 51772566.1, "1225000000.0": 51774533.6, "1226000000.0": 51776498.2, "1227000000.0": 51778459.7, "1228000000.0": 51780418.1, "1229000000.0": 51782373.5, "1230000000.0": 51784325.9, "1231000000.0": 51786275.2, "1232000000.0": 51788221.5, "1233000000.0": 51790164.8, "1234000000.0": 51792105.2, "1235000000.0": 51794042.5, "1236000000.0": 51795976.8, "1237000000.0": 51797908.2, "1238000000.0": 51799836.5, "1239000000.0": 51801761.9, "1240000000.0": 51803684.4, "1241000000.0": 51805603.9, "1242000000.0": 51807520.4, "1243000000.0": 51809434.0, "1244000000.0": 51811344.7, "1245000000.0": 51813252.5, "1246000000.0": 51815157.3, "1247000000.0": 51817059.2, "1248000000.0": 51818958.2, "1249000000.0": 51820854.3, "1250000000.0": 51822747.5, "1251000000.0": 51824637.8, "1252000000.0": 51826525.3, "1253000000.0": 51828409.9, "1254000000.0": 51830291.6, "1255000000.0": 51832170.4, "1256000000.0": 51834046.4, "1257000000.0": 51835919.5, "1258000000.0": 51837789.8, "1259000000.0": 51839657.3, "1260000000.0": 51841521.9, "1261000000.0": 51843383.8, "1262000000.0": 51845242.8, "1263000000.0": 51847098.9, "1264000000.0": 51848952.3, "1265000000.0": 51850802.9, "1266000000.0": 51852650.7, "1267000000.0": 51854495.7, "1268000000.0": 51856338.0, "1269000000.0": 51858177.5, "1270000000.0": 51860014.2, "1271000000.0": 51861848.1, "1272000000.0": 51863679.3, "1273000000.0": 51865507.7, "1274000000.0": 51867333.5, "1275000000.0": 51869156.4, "1276000000.0": 51870976.7, "1277000000.0": 51872794.2, "1278000000.0": 51874609.0, "1279000000.0": 51876421.1, "1280000000.0": 51878230.5, "1281000000.0": 51880037.2, "1282000000.0": 51881841.2, "1283000000.0": 51883642.5, "1284000000.0": 51885441.2, "1285000000.0": 51887237.1, "1286000000.0": 51889030.4, "1287000000.0": 51890821.1, "1288000000.0": 51892609.1, "1289000000.0": 51894394.4, "1290000000.0": 51896177.1, "1291000000.0": 51897957.1, "1292000000.0": 51899734.6, "1293000000.0": 51901509.3, "1294000000.0": 51903281.5, "1295000000.0": 51905051.1, "1296000000.0": 51906818.0, "1297000000.0": 51908582.4, "1298000000.0": 51910344.1, "1299000000.0": 51912103.3, "1300000000.0": 51913859.9, "1301000000.0": 51915613.9, "1302000000.0": 51917365.3, "1303000000.0": 51919114.1, "1304000000.0": 51920860.4, "1305000000.0": 51922604.1, "1306000000.0": 51924345.3, "1307000000.0": 51926083.9, "1308000000.0": 51927820.0, "1309000000.0": 51929553.6, "1310000000.0": 51931284.6, "1311000000.0": 51933013.1, "1312000000.0": 51934739.1, "1313000000.0": 51936462.6, "1314000000.0": 51938183.5, "1315000000.0": 51939902.0, "1316000000.0": 51941617.9, "1317000000.0": 51943331.4, "1318000000.0": 51945042.4, "1319000000.0": 51946750.9, "1320000000.0": 51948456.9, "1321000000.0": 51950160.5, "1322000000.0": 51951861.6, "1323000000.0": 51953560.2, "1324000000.0": 51955256.4, "1325000000.0": 51956950.1, "1326000000.0": 51958641.4, "1327000000.0": 51960330.3, "1328000000.0": 51962016.7, "1329000000.0": 51963700.7, "1330000000.0": 51965382.3, "1331000000.0": 51967061.4, "1332000000.0": 51968738.2, "1333000000.0": 51970412.5, "1334000000.0": 51972084.4, "1335000000.0": 51973754.0, "1336000000.0": 51975421.1, "1337000000.0": 51977085.9, "1338000000.0": 51978748.3, "1339000000.0": 51980408.3, "1340000000.0": 51982065.9, "1341000000.0": 51983721.2, "1342000000.0": 51985374.1, "1343000000.0": 51987024.7, "1344000000.0": 51988672.9, "1345000000.0": 51990318.7, "1346000000.0": 51991962.3, "1347000000.0": 51993603.4, "1348000000.0": 51995242.3, "1349000000.0": 51996878.8, "1350000000.0": 51998513.0, "1351000000.0": 52000144.9, "1352000000.0": 52001774.5, "1353000000.0": 52003401.8, "1354000000.0": 52005026.8, "1355000000.0": 52006649.4, "1356000000.0": 52008269.8, "1357000000.0": 52009887.9, "1358000000.0": 52011503.8, "1359000000.0": 52013117.3, "1360000000.0": 52014728.6, "1361000000.0": 52016337.6, "1362000000.0": 52017944.3, "1363000000.0": 52019548.8, "1364000000.0": 52021151.1, "1365000000.0": 52022751.0, "1366000000.0": 52024348.8, "1367000000.0": 52025944.3, "1368000000.0": 52027537.6, "1369000000.0": 52029128.6, "1370000000.0": 52030717.4, "1371000000.0": 52032304.0, "1372000000.0": 52033888.4, "1373000000.0": 52035470.6, "1374000000.0": 52037050.6, "1375000000.0": 52038628.3, "1376000000.0": 52040203.9, "1377000000.0": 52041777.3, "1378000000.0": 52043348.5, "1379000000.0": 52044917.5, "1380000000.0": 52046484.3, "1381000000.0": 52048049.0, "1382000000.0": 52049611.5, "1383000000.0": 52051171.8, "1384000000.0": 52052729.9, "1385000000.0": 52054286.0, "1386000000.0": 52055839.8, "1387000000.0": 52057391.5, "1388000000.0": 52058941.1, "1389000000.0": 52060488.5, "1390000000.0": 52062033.8, "1391000000.0": 52063577.0, "1392000000.0": 52065118.0, "1393000000.0": 52066656.9, "1394000000.0": 52068193.7, "1395000000.0": 52069728.4, "1396000000.0": 52071261.0, "1397000000.0": 52072791.5, "1398000000.0": 52074319.9, "1399000000.0": 52075846.2, "1400000000.0": 52077370.4, "1401000000.0": 52078892.5, "1402000000.0": 52080412.5, "1403000000.0": 52081930.5, "1404000000.0": 52083446.4, "1405000000.0": 52084960.2, "1406000000.0": 52086471.9, "1407000000.0": 52087981.6, "1408000000.0": 52089489.3, "1409000000.0": 52090994.8, "1410000000.0": 52092498.4, "1411000000.0": 52093999.9, "1412000000.0": 52095499.3, "1413000000.0": 52096996.7, "1414000000.0": 52098492.1, "1415000000.0": 52099985.5, "1416000000.0": 52101476.8, "1417000000.0": 52102966.1, "1418000000.0": 52104453.4, "1419000000.0": 52105938.7, "1420000000.0": 52107422.0, "1421000000.0": 52108903.3, "1422000000.0": 52110382.6, "1423000000.0": 52111859.9, "1424000000.0": 52113335.2, "1425000000.0": 52114808.5, "1426000000.0": 52116279.8, "1427000000.0": 52117749.2, "1428000000.0": 52119216.6, "1429000000.0": 52120682.0, "1430000000.0": 52122145.4, "1431000000.0": 52123606.9, "1432000000.0": 52125066.4, "1433000000.0": 52126524.0, "1434000000.0": 52127979.6, "1435000000.0": 52129433.3, "1436000000.0": 52130885.0, "1437000000.0": 52132334.8, "1438000000.0": 52133782.7, "1439000000.0": 52135228.6, "1440000000.0": 52136672.6, "1441000000.0": 52138114.7, "1442000000.0": 52139554.8, "1443000000.0": 52140993.1, "1444000000.0": 52142429.4, "1445000000.0": 52143863.8, "1446000000.0": 52145296.3, "1447000000.0": 52146726.9, "1448000000.0": 52148155.7, "1449000000.0": 52149582.5, "1450000000.0": 52151007.4, "1451000000.0": 52152430.5, "1452000000.0": 52153851.7, "1453000000.0": 52155270.9, "1454000000.0": 52156688.4, "1455000000.0": 52158103.9, "1456000000.0": 52159517.6, "1457000000.0": 52160929.4, "1458000000.0": 52162339.4, "1459000000.0": 52163747.5, "1460000000.0": 52165153.7, "1461000000.0": 52166558.1, "1462000000.0": 52167960.7, "1463000000.0": 52169361.4, "1464000000.0": 52170760.3, "1465000000.0": 52172157.3, "1466000000.0": 52173552.5, "1467000000.0": 52174945.9, "1468000000.0": 52176337.5, "1469000000.0": 52177727.2, "1470000000.0": 52179115.2, "1471000000.0": 52180501.3, "1472000000.0": 52181885.6, "1473000000.0": 52183268.1, "1474000000.0": 52184648.8, "1475000000.0": 52186027.7, "1476000000.0": 52187404.8, "1477000000.0": 52188780.1, "1478000000.0": 52190153.7, "1479000000.0": 52191525.4, "1480000000.0": 52192895.4, "1481000000.0": 52194263.5, "1482000000.0": 52195630.0, "1483000000.0": 52196994.6, "1484000000.0": 52198357.5, "1485000000.0": 52199718.6, "1486000000.0": 52201077.9, "1487000000.0": 52202435.5, "1488000000.0": 52203791.4, "1489000000.0": 52205145.5, "1490000000.0": 52206497.8, "1491000000.0": 52207848.4, "1492000000.0": 52209197.3, "1493000000.0": 52210544.4, "1494000000.0": 52211889.8, "1495000000.0": 52213233.5, "1496000000.0": 52214575.4, "1497000000.0": 52215915.6, "1498000000.0": 52217254.1, "1499000000.0": 52218590.9, "1500000000.0": 52219925.9, "1501000000.0": 52221259.3, "1502000000.0": 52222590.9, "1503000000.0": 52223920.9, "1504000000.0": 52225249.1, "1505000000.0": 52226575.7, "1506000000.0": 52227900.5, "1507000000.0": 52229223.7, "1508000000.0": 52230545.2, "1509000000.0": 52231865.0, "1510000000.0": 52233183.1, "1511000000.0": 52234499.5, "1512000000.0": 52235814.3, "1513000000.0": 52237127.4, "1514000000.0": 52238438.8, "1515000000.0": 52239748.5, "1516000000.0": 52241056.6, "1517000000.0": 52242363.1, "1518000000.0": 52243667.9, "1519000000.0": 52244971.0, "1520000000.0": 52246272.5, "1521000000.0": 52247572.3, "1522000000.0": 52248870.5, "1523000000.0": 52250167.0, "1524000000.0": 52251462.0, "1525000000.0": 52252755.2, "1526000000.0": 52254046.9, "1527000000.0": 52255336.9, "1528000000.0": 52256625.3, "1529000000.0": 52257912.1, "1530000000.0": 52259197.3, "1531000000.0": 52260480.8, "1532000000.0": 52261762.8, "1533000000.0": 52263043.1, "1534000000.0": 52264321.8, "1535000000.0": 52265598.9, "1536000000.0": 52266874.4, "1537000000.0": 52268148.4, "1538000000.0": 52269420.7, "1539000000.0": 52270691.4, "1540000000.0": 52271960.6, "1541000000.0": 52273228.1, "1542000000.0": 52274494.1, "1543000000.0": 52275758.5, "1544000000.0": 52277021.3, "1545000000.0": 52278282.6, "1546000000.0": 52279542.3, "1547000000.0": 52280800.4, "1548000000.0": 52282057.0, "1549000000.0": 52283311.9, "1550000000.0": 52284565.4, "1551000000.0": 52285817.3, "1552000000.0": 52287067.6, "1553000000.0": 52288316.4, "1554000000.0": 52289563.6, "1555000000.0": 52290809.3, "1556000000.0": 52292053.4, "1557000000.0": 52293296.0, "1558000000.0": 52294537.1, "1559000000.0": 52295776.6, "1560000000.0": 52297014.6, "1561000000.0": 52298251.1, "1562000000.0": 52299486.1, "1563000000.0": 52300719.5, "1564000000.0": 52301951.4, "1565000000.0": 52303181.8, "1566000000.0": 52304410.7, "1567000000.0": 52305638.1, "1568000000.0": 52306864.0, "1569000000.0": 52308088.3, "1570000000.0": 52309311.2, "1571000000.0": 52310532.5, "1572000000.0": 52311752.4, "1573000000.0": 52312970.8, "1574000000.0": 52314187.7, "1575000000.0": 52315403.1, "1576000000.0": 52316617.0, "1577000000.0": 52317829.4, "1578000000.0": 52319040.4, "1579000000.0": 52320249.8, "1580000000.0": 52321457.8, "1581000000.0": 52322664.4, "1582000000.0": 52323869.4, "1583000000.0": 52325073.0, "1584000000.0": 52326275.1, "1585000000.0": 52327475.8, "1586000000.0": 52328675.0, "1587000000.0": 52329872.8, "1588000000.0": 52331069.1, "1589000000.0": 52332263.9, "1590000000.0": 52333457.3, "1591000000.0": 52334649.3, "1592000000.0": 52335839.8, "1593000000.0": 52337028.8, "1594000000.0": 52338216.5, "1595000000.0": 52339402.7, "1596000000.0": 52340587.5, "1597000000.0": 52341770.8, "1598000000.0": 52342952.7, "1599000000.0": 52344133.2, "1600000000.0": 52345312.3, "1601000000.0": 52346489.9, "1602000000.0": 52347666.1, "1603000000.0": 52348841.0, "1604000000.0": 52350014.4, "1605000000.0": 52351186.4, "1606000000.0": 52352356.9, "1607000000.0": 52353526.1, "1608000000.0": 52354693.9, "1609000000.0": 52355860.3, "1610000000.0": 52357025.3, "1611000000.0": 52358188.9, "1612000000.0": 52359351.1, "1613000000.0": 52360511.9, "1614000000.0": 52361671.3, "1615000000.0": 52362829.4, "1616000000.0": 52363986.0, "1617000000.0": 52365141.3, "1618000000.0": 52366295.2, "1619000000.0": 52367447.8, "1620000000.0": 52368598.9, "1621000000.0": 52369748.7, "1622000000.0": 52370897.1, "1623000000.0": 52372044.2, "1624000000.0": 52373189.9, "1625000000.0": 52374334.2, "1626000000.0": 52375477.2, "1627000000.0": 52376618.9, "1628000000.0": 52377759.1, "1629000000.0": 52378898.1, "1630000000.0": 52380035.6, "1631000000.0": 52381171.9, "1632000000.0": 52382306.8, "1633000000.0": 52383440.3, "1634000000.0": 52384572.5, "1635000000.0": 52385703.4, "1636000000.0": 52386833.0, "1637000000.0": 52387961.2, "1638000000.0": 52389088.1, "1639000000.0": 52390213.6, "1640000000.0": 52391337.8, "1641000000.0": 52392460.8, "1642000000.0": 52393582.4, "1643000000.0": 52394702.6, "1644000000.0": 52395821.6, "1645000000.0": 52396939.3, "1646000000.0": 52398055.6, "1647000000.0": 52399170.6, "1648000000.0": 52400284.4, "1649000000.0": 52401396.8, "1650000000.0": 52402507.9, "1651000000.0": 52403617.7, "1652000000.0": 52404726.3, "1653000000.0": 52405833.5, "1654000000.0": 52406939.5, "1655000000.0": 52408044.1, "1656000000.0": 52409147.5, "1657000000.0": 52410249.6, "1658000000.0": 52411350.4, "1659000000.0": 52412449.9, "1660000000.0": 52413548.1, "1661000000.0": 52414645.1, "1662000000.0": 52415740.8, "1663000000.0": 52416835.2, "1664000000.0": 52417928.4, "1665000000.0": 52419020.3, "1666000000.0": 52420110.9, "1667000000.0": 52421200.3, "1668000000.0": 52422288.4, "1669000000.0": 52423375.2, "1670000000.0": 52424460.8, "1671000000.0": 52425545.1, "1672000000.0": 52426628.2, "1673000000.0": 52427710.0, "1674000000.0": 52428790.6, "1675000000.0": 52429870.0, "1676000000.0": 52430948.0, "1677000000.0": 52432024.9, "1678000000.0": 52433100.5, "1679000000.0": 52434174.9, "1680000000.0": 52435248.0, "1681000000.0": 52436320.0, "1682000000.0": 52437390.6, "1683000000.0": 52438460.1, "1684000000.0": 52439528.3, "1685000000.0": 52440595.3, "1686000000.0": 52441661.1, "1687000000.0": 52442725.7, "1688000000.0": 52443789.0, "1689000000.0": 52444851.1, "1690000000.0": 52445912.1, "1691000000.0": 52446971.8, "1692000000.0": 52448030.3, "1693000000.0": 52449087.5, "1694000000.0": 52450143.6, "1695000000.0": 52451198.5, "1696000000.0": 52452252.2, "1697000000.0": 52453304.7, "1698000000.0": 52454355.9, "1699000000.0": 52455406.0, "1700000000.0": 52456454.9, "1701000000.0": 52457502.6, "1702000000.0": 52458549.1, "1703000000.0": 52459594.5, "1704000000.0": 52460638.6, "1705000000.0": 52461681.6, "1706000000.0": 52462723.4, "1707000000.0": 52463764.0, "1708000000.0": 52464803.4, "1709000000.0": 52465841.6, "1710000000.0": 52466878.7, "1711000000.0": 52467914.6, "1712000000.0": 52468949.3, "1713000000.0": 52469982.9, "1714000000.0": 52471015.3, "1715000000.0": 52472046.6, "1716000000.0": 52473076.6, "1717000000.0": 52474105.6, "1718000000.0": 52475133.3, "1719000000.0": 52476159.9, "1720000000.0": 52477185.4, "1721000000.0": 52478209.7, "1722000000.0": 52479232.9, "1723000000.0": 52480254.9, "1724000000.0": 52481275.7, "1725000000.0": 52482295.5, "1726000000.0": 52483314.0, "1727000000.0": 52484331.5, "1728000000.0": 52485347.8, "1729000000.0": 52486362.9, "1730000000.0": 52487377.0, "1731000000.0": 52488389.9, "1732000000.0": 52489401.6, "1733000000.0": 52490412.3, "1734000000.0": 52491421.8, "1735000000.0": 52492430.2, "1736000000.0": 52493437.5, "1737000000.0": 52494443.6, "1738000000.0": 52495448.6, "1739000000.0": 52496452.6, "1740000000.0": 52497455.4, "1741000000.0": 52498457.0, "1742000000.0": 52499457.6, "1743000000.0": 52500457.1, "1744000000.0": 52501455.4, "1745000000.0": 52502452.7, "1746000000.0": 52503448.8, "1747000000.0": 52504443.9, "1748000000.0": 52505437.8, "1749000000.0": 52506430.7, "1750000000.0": 52507422.4, "1751000000.0": 52508413.1, "1752000000.0": 52509402.6, "1753000000.0": 52510391.1, "1754000000.0": 52511378.5, "1755000000.0": 52512364.8, "1756000000.0": 52513350.0, "1757000000.0": 52514334.1, "1758000000.0": 52515317.1, "1759000000.0": 52516299.1, "1760000000.0": 52517280.0, "1761000000.0": 52518259.8, "1762000000.0": 52519238.5, "1763000000.0": 52520216.1, "1764000000.0": 52521192.7, "1765000000.0": 52522168.2, "1766000000.0": 52523142.7, "1767000000.0": 52524116.1, "1768000000.0": 52525088.4, "1769000000.0": 52526059.6, "1770000000.0": 52527029.8, "1771000000.0": 52527998.9, "1772000000.0": 52528967.0, "1773000000.0": 52529934.0, "1774000000.0": 52530900.0, "1775000000.0": 52531864.9, "1776000000.0": 52532828.8, "1777000000.0": 52533791.6, "1778000000.0": 52534753.3, "1779000000.0": 52535714.1, "1780000000.0": 52536673.7, "1781000000.0": 52537632.4, "1782000000.0": 52538590.0, "1783000000.0": 52539546.5, "1784000000.0": 52540502.0, "1785000000.0": 52541456.5, "1786000000.0": 52542409.9, "1787000000.0": 52543362.4, "1788000000.0": 52544313.7, "1789000000.0": 52545264.1, "1790000000.0": 52546213.4, "1791000000.0": 52547161.7, "1792000000.0": 52548109.0, "1793000000.0": 52549055.3, "1794000000.0": 52550000.5, "1795000000.0": 52550944.7, "1796000000.0": 52551887.9, "1797000000.0": 52552830.1, "1798000000.0": 52553771.3, "1799000000.0": 52554711.4, "1800000000.0": 52555650.6, "1801000000.0": 52556588.7, "1802000000.0": 52557525.8, "1803000000.0": 52558462.0, "1804000000.0": 52559397.1, "1805000000.0": 52560331.2, "1806000000.0": 52561264.3, "1807000000.0": 52562196.4, "1808000000.0": 52563127.6, "1809000000.0": 52564057.7, "1810000000.0": 52564986.8, "1811000000.0": 52565915.0, "1812000000.0": 52566842.1, "1813000000.0": 52567768.3, "1814000000.0": 52568693.4, "1815000000.0": 52569617.6, "1816000000.0": 52570540.8, "1817000000.0": 52571463.0, "1818000000.0": 52572384.2, "1819000000.0": 52573304.5, "1820000000.0": 52574223.8, "1821000000.0": 52575142.1, "1822000000.0": 52576059.4, "1823000000.0": 52576975.7, "1824000000.0": 52577891.1, "1825000000.0": 52578805.5, "1826000000.0": 52579718.9, "1827000000.0": 52580631.4, "1828000000.0": 52581542.9, "1829000000.0": 52582453.4, "1830000000.0": 52583363.0, "1831000000.0": 52584271.6, "1832000000.0": 52585179.3, "1833000000.0": 52586086.0, "1834000000.0": 52586991.7, "1835000000.0": 52587896.5, "1836000000.0": 52588800.3, "1837000000.0": 52589703.2, "1838000000.0": 52590605.1, "1839000000.0": 52591506.1, "1840000000.0": 52592406.1, "1841000000.0": 52593305.2, "1842000000.0": 52594203.3, "1843000000.0": 52595100.5, "1844000000.0": 52595996.7, "1845000000.0": 52596892.0, "1846000000.0": 52597786.4, "1847000000.0": 52598679.8, "1848000000.0": 52599572.3, "1849000000.0": 52600463.9, "1850000000.0": 52601354.5, "1851000000.0": 52602244.2, "1852000000.0": 52603132.9, "1853000000.0": 52604020.8, "1854000000.0": 52604907.7, "1855000000.0": 52605793.7, "1856000000.0": 52606678.7, "1857000000.0": 52607562.8, "1858000000.0": 52608446.1, "1859000000.0": 52609328.3, "1860000000.0": 52610209.7, "1861000000.0": 52611090.2, "1862000000.0": 52611969.7, "1863000000.0": 52612848.3, "1864000000.0": 52613726.0, "1865000000.0": 52614602.8, "1866000000.0": 52615478.7, "1867000000.0": 52616353.7, "1868000000.0": 52617227.8, "1869000000.0": 52618100.9, "1870000000.0": 52618973.2, "1871000000.0": 52619844.6, "1872000000.0": 52620715.0, "1873000000.0": 52621584.6, "1874000000.0": 52622453.2, "1875000000.0": 52623321.0, "1876000000.0": 52624187.8, "1877000000.0": 52625053.8, "1878000000.0": 52625918.9, "1879000000.0": 52626783.1, "1880000000.0": 52627646.4, "1881000000.0": 52628508.8, "1882000000.0": 52629370.3, "1883000000.0": 52630230.9, "1884000000.0": 52631090.7, "1885000000.0": 52631949.5, "1886000000.0": 52632807.5, "1887000000.0": 52633664.6, "1888000000.0": 52634520.8, "1889000000.0": 52635376.1, "1890000000.0": 52636230.6, "1891000000.0": 52637084.2, "1892000000.0": 52637936.9, "1893000000.0": 52638788.7, "1894000000.0": 52639639.7, "1895000000.0": 52640489.8, "1896000000.0": 52641339.0, "1897000000.0": 52642187.4, "1898000000.0": 52643034.9, "1899000000.0": 52643881.5, "1900000000.0": 52644727.3, "1901000000.0": 52645572.2, "1902000000.0": 52646416.2, "1903000000.0": 52647259.4, "1904000000.0": 52648101.7, "1905000000.0": 52648943.2, "1906000000.0": 52649783.8, "1907000000.0": 52650623.6, "1908000000.0": 52651462.5, "1909000000.0": 52652300.5, "1910000000.0": 52653137.7, "1911000000.0": 52653974.1, "1912000000.0": 52654809.6, "1913000000.0": 52655644.2, "1914000000.0": 52656478.0, "1915000000.0": 52657311.0, "1916000000.0": 52658143.1, "1917000000.0": 52658974.4, "1918000000.0": 52659804.9, "1919000000.0": 52660634.5, "1920000000.0": 52661463.2, "1921000000.0": 52662291.2, "1922000000.0": 52663118.3, "1923000000.0": 52663944.5, "1924000000.0": 52664769.9, "1925000000.0": 52665594.5, "1926000000.0": 52666418.3, "1927000000.0": 52667241.2, "1928000000.0": 52668063.4, "1929000000.0": 52668884.6, "1930000000.0": 52669705.1, "1931000000.0": 52670524.7, "1932000000.0": 52671343.5, "1933000000.0": 52672161.5, "1934000000.0": 52672978.7, "1935000000.0": 52673795.0, "1936000000.0": 52674610.6, "1937000000.0": 52675425.3, "1938000000.0": 52676239.2, "1939000000.0": 52677052.3, "1940000000.0": 52677864.6, "1941000000.0": 52678676.0, "1942000000.0": 52679486.7, "1943000000.0": 52680296.5, "1944000000.0": 52681105.6, "1945000000.0": 52681913.8, "1946000000.0": 52682721.2, "1947000000.0": 52683527.8, "1948000000.0": 52684333.6, "1949000000.0": 52685138.7, "1950000000.0": 52685942.9, "1951000000.0": 52686746.3, "1952000000.0": 52687548.9, "1953000000.0": 52688350.7, "1954000000.0": 52689151.7, "1955000000.0": 52689952.0, "1956000000.0": 52690751.4, "1957000000.0": 52691550.0, "1958000000.0": 52692347.9, "1959000000.0": 52693144.9, "1960000000.0": 52693941.2, "1961000000.0": 52694736.7, "1962000000.0": 52695531.4, "1963000000.0": 52696325.3, "1964000000.0": 52697118.4, "1965000000.0": 52697910.8, "1966000000.0": 52698702.3, "1967000000.0": 52699493.1, "1968000000.0": 52700283.1, "1969000000.0": 52701072.3, "1970000000.0": 52701860.8, "1971000000.0": 52702648.4, "1972000000.0": 52703435.3, "1973000000.0": 52704221.5, "1974000000.0": 52705006.8, "1975000000.0": 52705791.4, "1976000000.0": 52706575.2, "1977000000.0": 52707358.2, "1978000000.0": 52708140.5, "1979000000.0": 52708922.0, "1980000000.0": 52709702.7, "1981000000.0": 52710482.7, "1982000000.0": 52711261.9, "1983000000.0": 52712040.3, "1984000000.0": 52712818.0, "1985000000.0": 52713594.9, "1986000000.0": 52714371.1, "1987000000.0": 52715146.5, "1988000000.0": 52715921.1, "1989000000.0": 52716695.0, "1990000000.0": 52717468.2, "1991000000.0": 52718240.6, "1992000000.0": 52719012.2, "1993000000.0": 52719783.1, "1994000000.0": 52720553.2, "1995000000.0": 52721322.6, "1996000000.0": 52722091.2, "1997000000.0": 52722859.1, "1998000000.0": 52723626.2, "1999000000.0": 52724392.6, "2000000000.0": 52725158.3, "2001000000.0": 52725923.2, "2002000000.0": 52726687.3, "2003000000.0": 52727450.8, "2004000000.0": 52728213.4, "2005000000.0": 52728975.4, "2006000000.0": 52729736.6, "2007000000.0": 52730497.1, "2008000000.0": 52731256.8, "2009000000.0": 52732015.8, "2010000000.0": 52732774.1, "2011000000.0": 52733531.6, "2012000000.0": 52734288.4, "2013000000.0": 52735044.5, "2014000000.0": 52735799.8, "2015000000.0": 52736554.5, "2016000000.0": 52737308.4, "2017000000.0": 52738061.5, "2018000000.0": 52738814.0, "2019000000.0": 52739565.7, "2020000000.0": 52740316.7, "2021000000.0": 52741067.0, "2022000000.0": 52741816.5, "2023000000.0": 52742565.3, "2024000000.0": 52743313.5, "2025000000.0": 52744060.9, "2026000000.0": 52744807.5, "2027000000.0": 52745553.5, "2028000000.0": 52746298.8, "2029000000.0": 52747043.3, "2030000000.0": 52747787.1, "2031000000.0": 52748530.2, "2032000000.0": 52749272.6, "2033000000.0": 52750014.3, "2034000000.0": 52750755.3, "2035000000.0": 52751495.6, "2036000000.0": 52752235.2, "2037000000.0": 52752974.1, "2038000000.0": 52753712.2, "2039000000.0": 52754449.7, "2040000000.0": 52755186.4, "2041000000.0": 52755922.5, "2042000000.0": 52756657.9, "2043000000.0": 52757392.5, "2044000000.0": 52758126.5, "2045000000.0": 52758859.7, "2046000000.0": 52759592.3, "2047000000.0": 52760324.2, "2048000000.0": 52761055.4, "2049000000.0": 52761785.8, "2050000000.0": 52762515.6, "2051000000.0": 52763244.7, "2052000000.0": 52763973.2, "2053000000.0": 52764700.9, "2054000000.0": 52765427.9, "2055000000.0": 52766154.3, "2056000000.0": 52766879.9, "2057000000.0": 52767604.9, "2058000000.0": 52768329.2, "2059000000.0": 52769052.8, "2060000000.0": 52769775.7, "2061000000.0": 52770498.0, "2062000000.0": 52771219.5, "2063000000.0": 52771940.4, "2064000000.0": 52772660.6, "2065000000.0": 52773380.1, "2066000000.0": 52774099.0, "2067000000.0": 52774817.2, "2068000000.0": 52775534.7, "2069000000.0": 52776251.5, "2070000000.0": 52776967.6, "2071000000.0": 52777683.1, "2072000000.0": 52778397.9, "2073000000.0": 52779112.1, "2074000000.0": 52779825.5, "2075000000.0": 52780538.4, "2076000000.0": 52781250.5, "2077000000.0": 52781962.0, "2078000000.0": 52782672.8, "2079000000.0": 52783382.9, "2080000000.0": 52784092.4, "2081000000.0": 52784801.2, "2082000000.0": 52785509.3, "2083000000.0": 52786216.8, "2084000000.0": 52786923.7, "2085000000.0": 52787629.8, "2086000000.0": 52788335.4, "2087000000.0": 52789040.2, "2088000000.0": 52789744.4, "2089000000.0": 52790448.0, "2090000000.0": 52791150.9, "2091000000.0": 52791853.1, "2092000000.0": 52792554.7, "2093000000.0": 52793255.6, "2094000000.0": 52793955.9, "2095000000.0": 52794655.5, "2096000000.0": 52795354.5, "2097000000.0": 52796052.9, "2098000000.0": 52796750.5, "2099000000.0": 52797447.6, "2100000000.0": 52798144.0, "2101000000.0": 52798839.7, "2102000000.0": 52799534.9, "2103000000.0": 52800229.3, "2104000000.0": 52800923.1, "2105000000.0": 52801616.3, "2106000000.0": 52802308.9, "2107000000.0": 52803000.8, "2108000000.0": 52803692.1, "2109000000.0": 52804382.7, "2110000000.0": 52805072.7, "2111000000.0": 52805762.0, "2112000000.0": 52806450.8, "2113000000.0": 52807138.9, "2114000000.0": 52807826.3, "2115000000.0": 52808513.2, "2116000000.0": 52809199.3, "2117000000.0": 52809884.9, "2118000000.0": 52810569.8, "2119000000.0": 52811254.2, "2120000000.0": 52811937.8, "2121000000.0": 52812620.9, "2122000000.0": 52813303.3, "2123000000.0": 52813985.1, "2124000000.0": 52814666.3, "2125000000.0": 52815346.9, "2126000000.0": 52816026.8, "2127000000.0": 52816706.1, "2128000000.0": 52817384.8, "2129000000.0": 52818062.9, "2130000000.0": 52818740.3, "2131000000.0": 52819417.1, "2132000000.0": 52820093.4, "2133000000.0": 52820769.0, "2134000000.0": 52821443.9, "2135000000.0": 52822118.3, "2136000000.0": 52822792.1, "2137000000.0": 52823465.2, "2138000000.0": 52824137.7, "2139000000.0": 52824809.7, "2140000000.0": 52825481.0, "2141000000.0": 52826151.7, "2142000000.0": 52826821.7, "2143000000.0": 52827491.2, "2144000000.0": 52828160.1, "2145000000.0": 52828828.4, "2146000000.0": 52829496.0, "2147000000.0": 52830163.1, "2148000000.0": 52830829.5, "2149000000.0": 52831495.4, "2150000000.0": 52832160.6, "2151000000.0": 52832825.3, "2152000000.0": 52833489.3, "2153000000.0": 52834152.8, "2154000000.0": 52834815.6, "2155000000.0": 52835477.8, "2156000000.0": 52836139.5, "2157000000.0": 52836800.5, "2158000000.0": 52837461.0, "2159000000.0": 52838120.9, "2160000000.0": 52838780.1, "2161000000.0": 52839438.8, "2162000000.0": 52840096.9, "2163000000.0": 52840754.4, "2164000000.0": 52841411.3, "2165000000.0": 52842067.6, "2166000000.0": 52842723.3, "2167000000.0": 52843378.4, "2168000000.0": 52844033.0, "2169000000.0": 52844686.9, "2170000000.0": 52845340.3, "2171000000.0": 52845993.1, "2172000000.0": 52846645.3, "2173000000.0": 52847296.9, "2174000000.0": 52847947.9, "2175000000.0": 52848598.3, "2176000000.0": 52849248.2, "2177000000.0": 52849897.5, "2178000000.0": 52850546.2, "2179000000.0": 52851194.3, "2180000000.0": 52851841.9, "2181000000.0": 52852488.8, "2182000000.0": 52853135.2, "2183000000.0": 52853781.0, "2184000000.0": 52854426.3, "2185000000.0": 52855071.0, "2186000000.0": 52855715.0, "2187000000.0": 52856358.6, "2188000000.0": 52857001.5, "2189000000.0": 52857643.9, "2190000000.0": 52858285.7, "2191000000.0": 52858926.9, "2192000000.0": 52859567.6, "2193000000.0": 52860207.7, "2194000000.0": 52860847.2, "2195000000.0": 52861486.2, "2196000000.0": 52862124.6, "2197000000.0": 52862762.4, "2198000000.0": 52863399.7, "2199000000.0": 52864036.4, "2200000000.0": 52864672.5, "2201000000.0": 52865308.1, "2202000000.0": 52865943.1, "2203000000.0": 52866577.5, "2204000000.0": 52867211.4, "2205000000.0": 52867844.8, "2206000000.0": 52868477.5, "2207000000.0": 52869109.7, "2208000000.0": 52869741.4, "2209000000.0": 52870372.5, "2210000000.0": 52871003.0, "2211000000.0": 52871633.0, "2212000000.0": 52872262.5, "2213000000.0": 52872891.4, "2214000000.0": 52873519.7, "2215000000.0": 52874147.5, "2216000000.0": 52874774.7, "2217000000.0": 52875401.4, "2218000000.0": 52876027.5, "2219000000.0": 52876653.1, "2220000000.0": 52877278.1, "2221000000.0": 52877902.6, "2222000000.0": 52878526.5, "2223000000.0": 52879149.9, "2224000000.0": 52879772.7, "2225000000.0": 52880395.0, "2226000000.0": 52881016.8, "2227000000.0": 52881638.0, "2228000000.0": 52882258.6, "2229000000.0": 52882878.7, "2230000000.0": 52883498.3, "2231000000.0": 52884117.4, "2232000000.0": 52884735.9, "2233000000.0": 52885353.8, "2234000000.0": 52885971.2, "2235000000.0": 52886588.1, "2236000000.0": 52887204.5, "2237000000.0": 52887820.3, "2238000000.0": 52888435.6, "2239000000.0": 52889050.3, "2240000000.0": 52889664.5, "2241000000.0": 52890278.2, "2242000000.0": 52890891.3, "2243000000.0": 52891503.9, "2244000000.0": 52892116.0, "2245000000.0": 52892727.5, "2246000000.0": 52893338.5, "2247000000.0": 52893949.0, "2248000000.0": 52894559.0, "2249000000.0": 52895168.4, "2250000000.0": 52895777.3, "2251000000.0": 52896385.7, "2252000000.0": 52896993.5, "2253000000.0": 52897600.8, "2254000000.0": 52898207.6, "2255000000.0": 52898813.9, "2256000000.0": 52899419.6, "2257000000.0": 52900024.9, "2258000000.0": 52900629.6, "2259000000.0": 52901233.7, "2260000000.0": 52901837.4, "2261000000.0": 52902440.5, "2262000000.0": 52903043.2, "2263000000.0": 52903645.3, "2264000000.0": 52904246.9, "2265000000.0": 52904847.9, "2266000000.0": 52905448.5, "2267000000.0": 52906048.5, "2268000000.0": 52906648.0, "2269000000.0": 52907247.0, "2270000000.0": 52907845.5, "2271000000.0": 52908443.5, "2272000000.0": 52909041.0, "2273000000.0": 52909637.9, "2274000000.0": 52910234.3, "2275000000.0": 52910830.3, "2276000000.0": 52911425.7, "2277000000.0": 52912020.6, "2278000000.0": 52912615.0, "2279000000.0": 52913208.9, "2280000000.0": 52913802.3, "2281000000.0": 52914395.2, "2282000000.0": 52914987.5, "2283000000.0": 52915579.4, "2284000000.0": 52916170.8, "2285000000.0": 52916761.6, "2286000000.0": 52917352.0, "2287000000.0": 52917941.8, "2288000000.0": 52918531.2, "2289000000.0": 52919120.0, "2290000000.0": 52919708.4, "2291000000.0": 52920296.2, "2292000000.0": 52920883.6, "2293000000.0": 52921470.4, "2294000000.0": 52922056.8, "2295000000.0": 52922642.6, "2296000000.0": 52923228.0, "2297000000.0": 52923812.8, "2298000000.0": 52924397.2, "2299000000.0": 52924981.0, "2300000000.0": 52925564.4, "2301000000.0": 52926147.3, "2302000000.0": 52926729.7, "2303000000.0": 52927311.6, "2304000000.0": 52927893.0, "2305000000.0": 52928473.9, "2306000000.0": 52929054.3, "2307000000.0": 52929634.2, "2308000000.0": 52930213.7, "2309000000.0": 52930792.6, "2310000000.0": 52931371.1, "2311000000.0": 52931949.0, "2312000000.0": 52932526.5, "2313000000.0": 52933103.5, "2314000000.0": 52933680.0, "2315000000.0": 52934256.1, "2316000000.0": 52934831.6, "2317000000.0": 52935406.7, "2318000000.0": 52935981.2, "2319000000.0": 52936555.3, "2320000000.0": 52937128.9, "2321000000.0": 52937702.0, "2322000000.0": 52938274.7, "2323000000.0": 52938846.9, "2324000000.0": 52939418.5, "2325000000.0": 52939989.8, "2326000000.0": 52940560.5, "2327000000.0": 52941130.7, "2328000000.0": 52941700.5, "2329000000.0": 52942269.8, "2330000000.0": 52942838.6, "2331000000.0": 52943407.0, "2332000000.0": 52943974.8, "2333000000.0": 52944542.2, "2334000000.0": 52945109.1, "2335000000.0": 52945675.6, "2336000000.0": 52946241.6, "2337000000.0": 52946807.1, "2338000000.0": 52947372.1, "2339000000.0": 52947936.6, "2340000000.0": 52948500.7, "2341000000.0": 52949064.3, "2342000000.0": 52949627.5, "2343000000.0": 52950190.2, "2344000000.0": 52950752.4, "2345000000.0": 52951314.1, "2346000000.0": 52951875.4, "2347000000.0": 52952436.2, "2348000000.0": 52952996.6, "2349000000.0": 52953556.5, "2350000000.0": 52954115.9, "2351000000.0": 52954674.8, "2352000000.0": 52955233.3, "2353000000.0": 52955791.3, "2354000000.0": 52956348.9, "2355000000.0": 52956906.0, "2356000000.0": 52957462.7, "2357000000.0": 52958018.8, "2358000000.0": 52958574.6, "2359000000.0": 52959129.8, "2360000000.0": 52959684.6, "2361000000.0": 52960239.0, "2362000000.0": 52960792.9, "2363000000.0": 52961346.3, "2364000000.0": 52961899.3, "2365000000.0": 52962451.8, "2366000000.0": 52963003.8, "2367000000.0": 52963555.4, "2368000000.0": 52964106.6, "2369000000.0": 52964657.3, "2370000000.0": 52965207.5, "2371000000.0": 52965757.3, "2372000000.0": 52966306.7, "2373000000.0": 52966855.6, "2374000000.0": 52967404.0, "2375000000.0": 52967952.0, "2376000000.0": 52968499.5, "2377000000.0": 52969046.6, "2378000000.0": 52969593.3, "2379000000.0": 52970139.5, "2380000000.0": 52970685.2, "2381000000.0": 52971230.5, "2382000000.0": 52971775.4, "2383000000.0": 52972319.8, "2384000000.0": 52972863.7, "2385000000.0": 52973407.3, "2386000000.0": 52973950.3, "2387000000.0": 52974493.0, "2388000000.0": 52975035.1, "2389000000.0": 52975576.9, "2390000000.0": 52976118.2, "2391000000.0": 52976659.0, "2392000000.0": 52977199.5, "2393000000.0": 52977739.4, "2394000000.0": 52978279.0, "2395000000.0": 52978818.1, "2396000000.0": 52979356.7, "2397000000.0": 52979894.9, "2398000000.0": 52980432.7, "2399000000.0": 52980970.1, "2400000000.0": 52981507.0, "2401000000.0": 52982043.5, "2402000000.0": 52982579.5, "2403000000.0": 52983115.1, "2404000000.0": 52983650.3, "2405000000.0": 52984185.0, "2406000000.0": 52984719.3, "2407000000.0": 52985253.2, "2408000000.0": 52985786.6, "2409000000.0": 52986319.6, "2410000000.0": 52986852.2, "2411000000.0": 52987384.3, "2412000000.0": 52987916.0, "2413000000.0": 52988447.3, "2414000000.0": 52988978.1, "2415000000.0": 52989508.6, "2416000000.0": 52990038.5, "2417000000.0": 52990568.1, "2418000000.0": 52991097.3, "2419000000.0": 52991626.0, "2420000000.0": 52992154.2, "2421000000.0": 52992682.1, "2422000000.0": 52993209.5, "2423000000.0": 52993736.5, "2424000000.0": 52994263.1, "2425000000.0": 52994789.3, "2426000000.0": 52995315.0, "2427000000.0": 52995840.3, "2428000000.0": 52996365.2, "2429000000.0": 52996889.7, "2430000000.0": 52997413.8, "2431000000.0": 52997937.4, "2432000000.0": 52998460.6, "2433000000.0": 52998983.4, "2434000000.0": 52999505.7, "2435000000.0": 53000027.7, "2436000000.0": 53000549.2, "2437000000.0": 53001070.3, "2438000000.0": 53001591.0, "2439000000.0": 53002111.3, "2440000000.0": 53002631.2, "2441000000.0": 53003150.6, "2442000000.0": 53003669.7, "2443000000.0": 53004188.3, "2444000000.0": 53004706.5, "2445000000.0": 53005224.3, "2446000000.0": 53005741.7, "2447000000.0": 53006258.6, "2448000000.0": 53006775.2, "2449000000.0": 53007291.3, "2450000000.0": 53007807.1, "2451000000.0": 53008322.4, "2452000000.0": 53008837.3, "2453000000.0": 53009351.8, "2454000000.0": 53009865.9, "2455000000.0": 53010379.6, "2456000000.0": 53010892.9, "2457000000.0": 53011405.7, "2458000000.0": 53011918.2, "2459000000.0": 53012430.2, "2460000000.0": 53012941.9, "2461000000.0": 53013453.1, "2462000000.0": 53013964.0, "2463000000.0": 53014474.4, "2464000000.0": 53014984.4, "2465000000.0": 53015494.0, "2466000000.0": 53016003.3, "2467000000.0": 53016512.1, "2468000000.0": 53017020.5, "2469000000.0": 53017528.5, "2470000000.0": 53018036.1, "2471000000.0": 53018543.3, "2472000000.0": 53019050.1, "2473000000.0": 53019556.5, "2474000000.0": 53020062.5, "2475000000.0": 53020568.2, "2476000000.0": 53021073.4, "2477000000.0": 53021578.2, "2478000000.0": 53022082.6, "2479000000.0": 53022586.6, "2480000000.0": 53023090.2, "2481000000.0": 53023593.5, "2482000000.0": 53024096.3, "2483000000.0": 53024598.7, "2484000000.0": 53025100.8, "2485000000.0": 53025602.4, "2486000000.0": 53026103.7, "2487000000.0": 53026604.5, "2488000000.0": 53027105.0, "2489000000.0": 53027605.0, "2490000000.0": 53028104.7, "2491000000.0": 53028604.0, "2492000000.0": 53029102.9, "2493000000.0": 53029601.4, "2494000000.0": 53030099.5, "2495000000.0": 53030597.3, "2496000000.0": 53031094.6, "2497000000.0": 53031591.5, "2498000000.0": 53032088.1, "2499000000.0": 53032584.3, "2500000000.0": 53033080.0, "2501000000.0": 53033575.4, "2502000000.0": 53034070.5, "2503000000.0": 53034565.1, "2504000000.0": 53035059.3, "2505000000.0": 53035553.2, "2506000000.0": 53036046.6, "2507000000.0": 53036539.7, "2508000000.0": 53037032.4, "2509000000.0": 53037524.7, "2510000000.0": 53038016.7, "2511000000.0": 53038508.2, "2512000000.0": 53038999.4, "2513000000.0": 53039490.2, "2514000000.0": 53039980.6, "2515000000.0": 53040470.6, "2516000000.0": 53040960.2, "2517000000.0": 53041449.5, "2518000000.0": 53041938.4, "2519000000.0": 53042426.9, "2520000000.0": 53042915.0, "2521000000.0": 53043402.8, "2522000000.0": 53043890.1, "2523000000.0": 53044377.1, "2524000000.0": 53044863.8, "2525000000.0": 53045350.0, "2526000000.0": 53045835.9, "2527000000.0": 53046321.3, "2528000000.0": 53046806.5, "2529000000.0": 53047291.2, "2530000000.0": 53047775.6, "2531000000.0": 53048259.6, "2532000000.0": 53048743.2, "2533000000.0": 53049226.4, "2534000000.0": 53049709.3, "2535000000.0": 53050191.8, "2536000000.0": 53050673.9, "2537000000.0": 53051155.7, "2538000000.0": 53051637.1, "2539000000.0": 53052118.1, "2540000000.0": 53052598.7, "2541000000.0": 53053079.0, "2542000000.0": 53053558.9, "2543000000.0": 53054038.5, "2544000000.0": 53054517.6, "2545000000.0": 53054996.4, "2546000000.0": 53055474.9, "2547000000.0": 53055952.9, "2548000000.0": 53056430.6, "2549000000.0": 53056908.0, "2550000000.0": 53057384.9, "2551000000.0": 53057861.5, "2552000000.0": 53058337.8, "2553000000.0": 53058813.7, "2554000000.0": 53059289.2, "2555000000.0": 53059764.3, "2556000000.0": 53060239.1, "2557000000.0": 53060713.5, "2558000000.0": 53061187.6, "2559000000.0": 53061661.3, "2560000000.0": 53062134.6, "2561000000.0": 53062607.6, "2562000000.0": 53063080.2, "2563000000.0": 53063552.5, "2564000000.0": 53064024.4, "2565000000.0": 53064495.9, "2566000000.0": 53064967.1, "2567000000.0": 53065437.9, "2568000000.0": 53065908.3, "2569000000.0": 53066378.4, "2570000000.0": 53066848.2, "2571000000.0": 53067317.6, "2572000000.0": 53067786.6, "2573000000.0": 53068255.3, "2574000000.0": 53068723.6, "2575000000.0": 53069191.6, "2576000000.0": 53069659.2, "2577000000.0": 53070126.4, "2578000000.0": 53070593.3, "2579000000.0": 53071059.9, "2580000000.0": 53071526.1, "2581000000.0": 53071991.9, "2582000000.0": 53072457.4, "2583000000.0": 53072922.5, "2584000000.0": 53073387.3, "2585000000.0": 53073851.7, "2586000000.0": 53074315.8, "2587000000.0": 53074779.5, "2588000000.0": 53075242.9, "2589000000.0": 53075706.0, "2590000000.0": 53076168.6, "2591000000.0": 53076631.0, "2592000000.0": 53077093.0, "2593000000.0": 53077554.6, "2594000000.0": 53078015.9, "2595000000.0": 53078476.8, "2596000000.0": 53078937.4, "2597000000.0": 53079397.7, "2598000000.0": 53079857.6, "2599000000.0": 53080317.1, "2600000000.0": 53080776.3, "2601000000.0": 53081235.2, "2602000000.0": 53081693.7, "2603000000.0": 53082151.9, "2604000000.0": 53082609.7, "2605000000.0": 53083067.2, "2606000000.0": 53083524.3, "2607000000.0": 53083981.1, "2608000000.0": 53084437.6, "2609000000.0": 53084893.7, "2610000000.0": 53085349.5, "2611000000.0": 53085804.9, "2612000000.0": 53086260.0, "2613000000.0": 53086714.8, "2614000000.0": 53087169.2, "2615000000.0": 53087623.2, "2616000000.0": 53088077.0, "2617000000.0": 53088530.4, "2618000000.0": 53088983.4, "2619000000.0": 53089436.2, "2620000000.0": 53089888.5, "2621000000.0": 53090340.6, "2622000000.0": 53090792.3, "2623000000.0": 53091243.6, "2624000000.0": 53091694.7, "2625000000.0": 53092145.4, "2626000000.0": 53092595.7, "2627000000.0": 53093045.8, "2628000000.0": 53093495.5, "2629000000.0": 53093944.8, "2630000000.0": 53094393.8, "2631000000.0": 53094842.5, "2632000000.0": 53095290.9, "2633000000.0": 53095738.9, "2634000000.0": 53096186.6, "2635000000.0": 53096634.0, "2636000000.0": 53097081.0, "2637000000.0": 53097527.7, "2638000000.0": 53097974.0, "2639000000.0": 53098420.1, "2640000000.0": 53098865.8, "2641000000.0": 53099311.2, "2642000000.0": 53099756.2, "2643000000.0": 53100200.9, "2644000000.0": 53100645.3, "2645000000.0": 53101089.4, "2646000000.0": 53101533.1, "2647000000.0": 53101976.5, "2648000000.0": 53102419.6, "2649000000.0": 53102862.3, "2650000000.0": 53103304.7, "2651000000.0": 53103746.8, "2652000000.0": 53104188.6, "2653000000.0": 53104630.0, "2654000000.0": 53105071.2, "2655000000.0": 53105511.9, "2656000000.0": 53105952.4, "2657000000.0": 53106392.6, "2658000000.0": 53106832.4, "2659000000.0": 53107271.9, "2660000000.0": 53107711.0, "2661000000.0": 53108149.9, "2662000000.0": 53108588.4, "2663000000.0": 53109026.6, "2664000000.0": 53109464.5, "2665000000.0": 53109902.1, "2666000000.0": 53110339.3, "2667000000.0": 53110776.2, "2668000000.0": 53111212.8, "2669000000.0": 53111649.1, "2670000000.0": 53112085.1, "2671000000.0": 53112520.7, "2672000000.0": 53112956.1, "2673000000.0": 53113391.1, "2674000000.0": 53113825.7, "2675000000.0": 53114260.1, "2676000000.0": 53114694.2, "2677000000.0": 53115127.9, "2678000000.0": 53115561.3, "2679000000.0": 53115994.4, "2680000000.0": 53116427.2, "2681000000.0": 53116859.7, "2682000000.0": 53117291.8, "2683000000.0": 53117723.7, "2684000000.0": 53118155.2, "2685000000.0": 53118586.4, "2686000000.0": 53119017.3, "2687000000.0": 53119447.9, "2688000000.0": 53119878.2, "2689000000.0": 53120308.1, "2690000000.0": 53120737.8, "2691000000.0": 53121167.1, "2692000000.0": 53121596.1, "2693000000.0": 53122024.8, "2694000000.0": 53122453.2, "2695000000.0": 53122881.3, "2696000000.0": 53123309.1, "2697000000.0": 53123736.5, "2698000000.0": 53124163.7, "2699000000.0": 53124590.5, "2700000000.0": 53125017.1, "2701000000.0": 53125443.3, "2702000000.0": 53125869.2, "2703000000.0": 53126294.8, "2704000000.0": 53126720.1, "2705000000.0": 53127145.1, "2706000000.0": 53127569.8, "2707000000.0": 53127994.2, "2708000000.0": 53128418.3, "2709000000.0": 53128842.0, "2710000000.0": 53129265.5, "2711000000.0": 53129688.7, "2712000000.0": 53130111.5, "2713000000.0": 53130534.1, "2714000000.0": 53130956.3, "2715000000.0": 53131378.2, "2716000000.0": 53131799.9, "2717000000.0": 53132221.2, "2718000000.0": 53132642.2, "2719000000.0": 53133063.0, "2720000000.0": 53133483.4, "2721000000.0": 53133903.5, "2722000000.0": 53134323.3, "2723000000.0": 53134742.8, "2724000000.0": 53135162.0, "2725000000.0": 53135581.0, "2726000000.0": 53135999.6, "2727000000.0": 53136417.9, "2728000000.0": 53136835.9, "2729000000.0": 53137253.6, "2730000000.0": 53137671.0, "2731000000.0": 53138088.1, "2732000000.0": 53138504.9, "2733000000.0": 53138921.5, "2734000000.0": 53139337.7, "2735000000.0": 53139753.6, "2736000000.0": 53140169.2, "2737000000.0": 53140584.6, "2738000000.0": 53140999.6, "2739000000.0": 53141414.3, "2740000000.0": 53141828.8, "2741000000.0": 53142242.9, "2742000000.0": 53142656.7, "2743000000.0": 53143070.3, "2744000000.0": 53143483.5, "2745000000.0": 53143896.5, "2746000000.0": 53144309.2, "2747000000.0": 53144721.5, "2748000000.0": 53145133.6, "2749000000.0": 53145545.4, "2750000000.0": 53145956.9, "2751000000.0": 53146368.1, "2752000000.0": 53146779.0, "2753000000.0": 53147189.6, "2754000000.0": 53147600.0, "2755000000.0": 53148010.0, "2756000000.0": 53148419.7, "2757000000.0": 53148829.2, "2758000000.0": 53149238.3, "2759000000.0": 53149647.2, "2760000000.0": 53150055.8, "2761000000.0": 53150464.1, "2762000000.0": 53150872.1, "2763000000.0": 53151279.8, "2764000000.0": 53151687.2, "2765000000.0": 53152094.3, "2766000000.0": 53152501.2, "2767000000.0": 53152907.7, "2768000000.0": 53153314.0, "2769000000.0": 53153720.0, "2770000000.0": 53154125.7, "2771000000.0": 53154531.1, "2772000000.0": 53154936.2, "2773000000.0": 53155341.1, "2774000000.0": 53155745.6, "2775000000.0": 53156149.9, "2776000000.0": 53156553.9, "2777000000.0": 53156957.6, "2778000000.0": 53157361.0, "2779000000.0": 53157764.1, "2780000000.0": 53158167.0, "2781000000.0": 53158569.5, "2782000000.0": 53158971.8, "2783000000.0": 53159373.8, "2784000000.0": 53159775.5, "2785000000.0": 53160176.9, "2786000000.0": 53160578.1, "2787000000.0": 53160979.0, "2788000000.0": 53161379.5, "2789000000.0": 53161779.8, "2790000000.0": 53162179.9, "2791000000.0": 53162579.6, "2792000000.0": 53162979.1, "2793000000.0": 53163378.3, "2794000000.0": 53163777.2, "2795000000.0": 53164175.8, "2796000000.0": 53164574.1, "2797000000.0": 53164972.2, "2798000000.0": 53165370.0, "2799000000.0": 53165767.5, "2800000000.0": 53166164.7, "2801000000.0": 53166561.7, "2802000000.0": 53166958.4, "2803000000.0": 53167354.8, "2804000000.0": 53167750.9, "2805000000.0": 53168146.7, "2806000000.0": 53168542.3, "2807000000.0": 53168937.6, "2808000000.0": 53169332.6, "2809000000.0": 53169727.3, "2810000000.0": 53170121.8, "2811000000.0": 53170516.0, "2812000000.0": 53170909.9, "2813000000.0": 53171303.6, "2814000000.0": 53171696.9, "2815000000.0": 53172090.0, "2816000000.0": 53172482.9, "2817000000.0": 53172875.4, "2818000000.0": 53173267.7, "2819000000.0": 53173659.7, "2820000000.0": 53174051.4, "2821000000.0": 53174442.9, "2822000000.0": 53174834.1, "2823000000.0": 53175225.0, "2824000000.0": 53175615.6, "2825000000.0": 53176006.0, "2826000000.0": 53176396.1, "2827000000.0": 53176786.0, "2828000000.0": 53177175.5, "2829000000.0": 53177564.8, "2830000000.0": 53177953.9, "2831000000.0": 53178342.6, "2832000000.0": 53178731.1, "2833000000.0": 53179119.3, "2834000000.0": 53179507.3, "2835000000.0": 53179895.0, "2836000000.0": 53180282.4, "2837000000.0": 53180669.5, "2838000000.0": 53181056.4, "2839000000.0": 53181443.0, "2840000000.0": 53181829.4, "2841000000.0": 53182215.5, "2842000000.0": 53182601.3, "2843000000.0": 53182986.8, "2844000000.0": 53183372.1, "2845000000.0": 53183757.1, "2846000000.0": 53184141.9, "2847000000.0": 53184526.4, "2848000000.0": 53184910.6, "2849000000.0": 53185294.6, "2850000000.0": 53185678.3, "2851000000.0": 53186061.7, "2852000000.0": 53186444.9, "2853000000.0": 53186827.8, "2854000000.0": 53187210.4, "2855000000.0": 53187592.8, "2856000000.0": 53187974.9, "2857000000.0": 53188356.8, "2858000000.0": 53188738.4, "2859000000.0": 53189119.7, "2860000000.0": 53189500.8, "2861000000.0": 53189881.6, "2862000000.0": 53190262.2, "2863000000.0": 53190642.5, "2864000000.0": 53191022.5, "2865000000.0": 53191402.3, "2866000000.0": 53191781.8, "2867000000.0": 53192161.0, "2868000000.0": 53192540.0, "2869000000.0": 53192918.8, "2870000000.0": 53193297.2, "2871000000.0": 53193675.5, "2872000000.0": 53194053.4, "2873000000.0": 53194431.1, "2874000000.0": 53194808.6, "2875000000.0": 53195185.8, "2876000000.0": 53195562.7, "2877000000.0": 53195939.4, "2878000000.0": 53196315.8, "2879000000.0": 53196692.0, "2880000000.0": 53197067.9, "2881000000.0": 53197443.5, "2882000000.0": 53197818.9, "2883000000.0": 53198194.1, "2884000000.0": 53198568.9, "2885000000.0": 53198943.6, "2886000000.0": 53199317.9, "2887000000.0": 53199692.1, "2888000000.0": 53200065.9, "2889000000.0": 53200439.6, "2890000000.0": 53200812.9, "2891000000.0": 53201186.0, "2892000000.0": 53201558.9, "2893000000.0": 53201931.5, "2894000000.0": 53202303.9, "2895000000.0": 53202676.0, "2896000000.0": 53203047.8, "2897000000.0": 53203419.4, "2898000000.0": 53203790.7, "2899000000.0": 53204161.8, "2900000000.0": 53204532.7, "2901000000.0": 53204903.3, "2902000000.0": 53205273.6, "2903000000.0": 53205643.7, "2904000000.0": 53206013.6, "2905000000.0": 53206383.2, "2906000000.0": 53206752.5, "2907000000.0": 53207121.6, "2908000000.0": 53207490.5, "2909000000.0": 53207859.1, "2910000000.0": 53208227.4, "2911000000.0": 53208595.5, "2912000000.0": 53208963.4, "2913000000.0": 53209331.0, "2914000000.0": 53209698.3, "2915000000.0": 53210065.5, "2916000000.0": 53210432.3, "2917000000.0": 53210799.0, "2918000000.0": 53211165.3, "2919000000.0": 53211531.5, "2920000000.0": 53211897.3, "2921000000.0": 53212263.0, "2922000000.0": 53212628.4, "2923000000.0": 53212993.5, "2924000000.0": 53213358.4, "2925000000.0": 53213723.1, "2926000000.0": 53214087.5, "2927000000.0": 53214451.7, "2928000000.0": 53214815.6, "2929000000.0": 53215179.3, "2930000000.0": 53215542.7, "2931000000.0": 53215905.9, "2932000000.0": 53216268.9, "2933000000.0": 53216631.6, "2934000000.0": 53216994.1, "2935000000.0": 53217356.3, "2936000000.0": 53217718.3, "2937000000.0": 53218080.0, "2938000000.0": 53218441.5, "2939000000.0": 53218802.8, "2940000000.0": 53219163.8, "2941000000.0": 53219524.6, "2942000000.0": 53219885.1, "2943000000.0": 53220245.4, "2944000000.0": 53220605.5, "2945000000.0": 53220965.3, "2946000000.0": 53221324.9, "2947000000.0": 53221684.3, "2948000000.0": 53222043.4, "2949000000.0": 53222402.2, "2950000000.0": 53222760.8, "2951000000.0": 53223119.2, "2952000000.0": 53223477.4, "2953000000.0": 53223835.3, "2954000000.0": 53224193.0, "2955000000.0": 53224550.4, "2956000000.0": 53224907.6, "2957000000.0": 53225264.6, "2958000000.0": 53225621.3, "2959000000.0": 53225977.8, "2960000000.0": 53226334.1, "2961000000.0": 53226690.1, "2962000000.0": 53227045.9, "2963000000.0": 53227401.4, "2964000000.0": 53227756.7, "2965000000.0": 53228111.8, "2966000000.0": 53228466.7, "2967000000.0": 53228821.3, "2968000000.0": 53229175.6, "2969000000.0": 53229529.8, "2970000000.0": 53229883.7, "2971000000.0": 53230237.4, "2972000000.0": 53230590.8, "2973000000.0": 53230944.0, "2974000000.0": 53231297.0, "2975000000.0": 53231649.7, "2976000000.0": 53232002.3, "2977000000.0": 53232354.5, "2978000000.0": 53232706.6, "2979000000.0": 53233058.4, "2980000000.0": 53233410.0, "2981000000.0": 53233761.3, "2982000000.0": 53234112.5, "2983000000.0": 53234463.4, "2984000000.0": 53234814.0, "2985000000.0": 53235164.4, "2986000000.0": 53235514.6, "2987000000.0": 53235864.6, "2988000000.0": 53236214.4, "2989000000.0": 53236563.9, "2990000000.0": 53236913.2, "2991000000.0": 53237262.2, "2992000000.0": 53237611.0, "2993000000.0": 53237959.6, "2994000000.0": 53238308.0, "2995000000.0": 53238656.1, "2996000000.0": 53239004.1, "2997000000.0": 53239351.7, "2998000000.0": 53239699.2, "2999000000.0": 53240046.4, "3000000000.0": 53240393.4, "3001000000.0": 53240740.2, "3002000000.0": 53241086.8, "3003000000.0": 53241433.1, "3004000000.0": 53241779.2, "3005000000.0": 53242125.1, "3006000000.0": 53242470.7, "3007000000.0": 53242816.1, "3008000000.0": 53243161.3, "3009000000.0": 53243506.3, "3010000000.0": 53243851.0, "3011000000.0": 53244195.6, "3012000000.0": 53244539.9, "3013000000.0": 53244883.9, "3014000000.0": 53245227.8, "3015000000.0": 53245571.4, "3016000000.0": 53245914.8, "3017000000.0": 53246258.0, "3018000000.0": 53246601.0, "3019000000.0": 53246943.7, "3020000000.0": 53247286.2, "3021000000.0": 53247628.5, "3022000000.0": 53247970.6, "3023000000.0": 53248312.4, "3024000000.0": 53248654.0, "3025000000.0": 53248995.4, "3026000000.0": 53249336.6, "3027000000.0": 53249677.6, "3028000000.0": 53250018.3, "3029000000.0": 53250358.8, "3030000000.0": 53250699.1, "3031000000.0": 53251039.2, "3032000000.0": 53251379.1, "3033000000.0": 53251718.7, "3034000000.0": 53252058.1, "3035000000.0": 53252397.3, "3036000000.0": 53252736.3, "3037000000.0": 53253075.1, "3038000000.0": 53253413.6, "3039000000.0": 53253751.9, "3040000000.0": 53254090.1, "3041000000.0": 53254427.9, "3042000000.0": 53254765.6, "3043000000.0": 53255103.1, "3044000000.0": 53255440.3, "3045000000.0": 53255777.3, "3046000000.0": 53256114.1, "3047000000.0": 53256450.7, "3048000000.0": 53256787.1, "3049000000.0": 53257123.2, "3050000000.0": 53257459.2, "3051000000.0": 53257794.9, "3052000000.0": 53258130.4, "3053000000.0": 53258465.7, "3054000000.0": 53258800.8, "3055000000.0": 53259135.6, "3056000000.0": 53259470.3, "3057000000.0": 53259804.7, "3058000000.0": 53260138.9, "3059000000.0": 53260472.9, "3060000000.0": 53260806.7, "3061000000.0": 53261140.3, "3062000000.0": 53261473.6, "3063000000.0": 53261806.8, "3064000000.0": 53262139.7, "3065000000.0": 53262472.4, "3066000000.0": 53262804.9, "3067000000.0": 53263137.2, "3068000000.0": 53263469.3, "3069000000.0": 53263801.2, "3070000000.0": 53264132.8, "3071000000.0": 53264464.3, "3072000000.0": 53264795.5, "3073000000.0": 53265126.5, "3074000000.0": 53265457.3, "3075000000.0": 53265787.9, "3076000000.0": 53266118.3, "3077000000.0": 53266448.5, "3078000000.0": 53266778.5, "3079000000.0": 53267108.2, "3080000000.0": 53267437.8, "3081000000.0": 53267767.1, "3082000000.0": 53268096.2, "3083000000.0": 53268425.2, "3084000000.0": 53268753.9, "3085000000.0": 53269082.4, "3086000000.0": 53269410.7, "3087000000.0": 53269738.7, "3088000000.0": 53270066.6, "3089000000.0": 53270394.3, "3090000000.0": 53270721.7, "3091000000.0": 53271049.0, "3092000000.0": 53271376.0, "3093000000.0": 53271702.9, "3094000000.0": 53272029.5, "3095000000.0": 53272355.9, "3096000000.0": 53272682.1, "3097000000.0": 53273008.2, "3098000000.0": 53273334.0, "3099000000.0": 53273659.6, "3100000000.0": 53273984.9, "3101000000.0": 53274310.1, "3102000000.0": 53274635.1, "3103000000.0": 53274959.9, "3104000000.0": 53275284.4, "3105000000.0": 53275608.8, "3106000000.0": 53275933.0, "3107000000.0": 53276256.9, "3108000000.0": 53276580.7, "3109000000.0": 53276904.2, "3110000000.0": 53277227.6, "3111000000.0": 53277550.7, "3112000000.0": 53277873.6, "3113000000.0": 53278196.3, "3114000000.0": 53278518.9, "3115000000.0": 53278841.2, "3116000000.0": 53279163.3, "3117000000.0": 53279485.2, "3118000000.0": 53279806.9, "3119000000.0": 53280128.5, "3120000000.0": 53280449.8, "3121000000.0": 53280770.9, "3122000000.0": 53281091.8, "3123000000.0": 53281412.5, "3124000000.0": 53281733.0, "3125000000.0": 53282053.3, "3126000000.0": 53282373.4, "3127000000.0": 53282693.3, "3128000000.0": 53283013.0, "3129000000.0": 53283332.5, "3130000000.0": 53283651.8, "3131000000.0": 53283970.9, "3132000000.0": 53284289.8, "3133000000.0": 53284608.5, "3134000000.0": 53284927.0, "3135000000.0": 53285245.3, "3136000000.0": 53285563.4, "3137000000.0": 53285881.3, "3138000000.0": 53286199.0, "3139000000.0": 53286516.5, "3140000000.0": 53286833.8, "3141000000.0": 53287150.9, "3142000000.0": 53287467.8, "3143000000.0": 53287784.5, "3144000000.0": 53288101.0, "3145000000.0": 53288417.4, "3146000000.0": 53288733.5, "3147000000.0": 53289049.4, "3148000000.0": 53289365.1, "3149000000.0": 53289680.7, "3150000000.0": 53289996.0, "3151000000.0": 53290311.1, "3152000000.0": 53290626.1, "3153000000.0": 53290940.8, "3154000000.0": 53291255.4, "3155000000.0": 53291569.7, "3156000000.0": 53291883.9, "3157000000.0": 53292197.8, "3158000000.0": 53292511.6, "3159000000.0": 53292825.2, "3160000000.0": 53293138.5, "3161000000.0": 53293451.7, "3162000000.0": 53293764.7, "3163000000.0": 53294077.5, "3164000000.0": 53294390.1, "3165000000.0": 53294702.5, "3166000000.0": 53295014.7, "3167000000.0": 53295326.7, "3168000000.0": 53295638.6, "3169000000.0": 53295950.2, "3170000000.0": 53296261.6, "3171000000.0": 53296572.9, "3172000000.0": 53296883.9, "3173000000.0": 53297194.8, "3174000000.0": 53297505.5, "3175000000.0": 53297816.0, "3176000000.0": 53298126.2, "3177000000.0": 53298436.3, "3178000000.0": 53298746.2, "3179000000.0": 53299055.9, "3180000000.0": 53299365.5, "3181000000.0": 53299674.8, "3182000000.0": 53299983.9, "3183000000.0": 53300292.9, "3184000000.0": 53300601.6, "3185000000.0": 53300910.2, "3186000000.0": 53301218.6, "3187000000.0": 53301526.8, "3188000000.0": 53301834.8, "3189000000.0": 53302142.6, "3190000000.0": 53302450.2, "3191000000.0": 53302757.6, "3192000000.0": 53303064.9, "3193000000.0": 53303371.9, "3194000000.0": 53303678.8, "3195000000.0": 53303985.5, "3196000000.0": 53304291.9, "3197000000.0": 53304598.2, "3198000000.0": 53304904.3, "3199000000.0": 53305210.3, "3200000000.0": 53305516.0, "3201000000.0": 53305821.5, "3202000000.0": 53306126.9, "3203000000.0": 53306432.1, "3204000000.0": 53306737.1, "3205000000.0": 53307041.9, "3206000000.0": 53307346.5, "3207000000.0": 53307650.9, "3208000000.0": 53307955.1, "3209000000.0": 53308259.2, "3210000000.0": 53308563.1, "3211000000.0": 53308866.7, "3212000000.0": 53309170.2, "3213000000.0": 53309473.5, "3214000000.0": 53309776.7, "3215000000.0": 53310079.6, "3216000000.0": 53310382.4, "3217000000.0": 53310684.9, "3218000000.0": 53310987.3, "3219000000.0": 53311289.5, "3220000000.0": 53311591.5, "3221000000.0": 53311893.4, "3222000000.0": 53312195.0, "3223000000.0": 53312496.5, "3224000000.0": 53312797.8, "3225000000.0": 53313098.9, "3226000000.0": 53313399.8, "3227000000.0": 53313700.5, "3228000000.0": 53314001.1, "3229000000.0": 53314301.4, "3230000000.0": 53314601.6, "3231000000.0": 53314901.6, "3232000000.0": 53315201.4, "3233000000.0": 53315501.1, "3234000000.0": 53315800.5, "3235000000.0": 53316099.8, "3236000000.0": 53316398.9, "3237000000.0": 53316697.8, "3238000000.0": 53316996.5, "3239000000.0": 53317295.1, "3240000000.0": 53317593.4, "3241000000.0": 53317891.6, "3242000000.0": 53318189.6, "3243000000.0": 53318487.5, "3244000000.0": 53318785.1, "3245000000.0": 53319082.6, "3246000000.0": 53319379.9, "3247000000.0": 53319677.0, "3248000000.0": 53319973.9, "3249000000.0": 53320270.6, "3250000000.0": 53320567.2, "3251000000.0": 53320863.6, "3252000000.0": 53321159.8, "3253000000.0": 53321455.8, "3254000000.0": 53321751.7, "3255000000.0": 53322047.4, "3256000000.0": 53322342.9, "3257000000.0": 53322638.2, "3258000000.0": 53322933.3, "3259000000.0": 53323228.3, "3260000000.0": 53323523.1, "3261000000.0": 53323817.7, "3262000000.0": 53324112.1, "3263000000.0": 53324406.3, "3264000000.0": 53324700.4, "3265000000.0": 53324994.3, "3266000000.0": 53325288.0, "3267000000.0": 53325581.6, "3268000000.0": 53325874.9, "3269000000.0": 53326168.1, "3270000000.0": 53326461.2, "3271000000.0": 53326754.0, "3272000000.0": 53327046.7, "3273000000.0": 53327339.1, "3274000000.0": 53327631.5, "3275000000.0": 53327923.6, "3276000000.0": 53328215.6, "3277000000.0": 53328507.4, "3278000000.0": 53328799.0, "3279000000.0": 53329090.4, "3280000000.0": 53329381.7, "3281000000.0": 53329672.8, "3282000000.0": 53329963.7, "3283000000.0": 53330254.4, "3284000000.0": 53330545.0, "3285000000.0": 53330835.4, "3286000000.0": 53331125.6, "3287000000.0": 53331415.6, "3288000000.0": 53331705.5, "3289000000.0": 53331995.2, "3290000000.0": 53332284.7, "3291000000.0": 53332574.1, "3292000000.0": 53332863.3, "3293000000.0": 53333152.3, "3294000000.0": 53333441.1, "3295000000.0": 53333729.8, "3296000000.0": 53334018.3, "3297000000.0": 53334306.6, "3298000000.0": 53334594.8, "3299000000.0": 53334882.7, "3300000000.0": 53335170.5, "3301000000.0": 53335458.2, "3302000000.0": 53335745.6, "3303000000.0": 53336032.9, "3304000000.0": 53336320.1, "3305000000.0": 53336607.0, "3306000000.0": 53336893.8, "3307000000.0": 53337180.4, "3308000000.0": 53337466.8, "3309000000.0": 53337753.1, "3310000000.0": 53338039.2, "3311000000.0": 53338325.2, "3312000000.0": 53338610.9, "3313000000.0": 53338896.5, "3314000000.0": 53339181.9, "3315000000.0": 53339467.2, "3316000000.0": 53339752.3, "3317000000.0": 53340037.2, "3318000000.0": 53340321.9, "3319000000.0": 53340606.5, "3320000000.0": 53340890.9, "3321000000.0": 53341175.2, "3322000000.0": 53341459.2, "3323000000.0": 53341743.1, "3324000000.0": 53342026.9, "3325000000.0": 53342310.5, "3326000000.0": 53342593.9, "3327000000.0": 53342877.1, "3328000000.0": 53343160.2, "3329000000.0": 53343443.1, "3330000000.0": 53343725.8, "3331000000.0": 53344008.4, "3332000000.0": 53344290.8, "3333000000.0": 53344573.0, "3334000000.0": 53344855.1, "3335000000.0": 53345137.0, "3336000000.0": 53345418.7, "3337000000.0": 53345700.3, "3338000000.0": 53345981.7, "3339000000.0": 53346262.9, "3340000000.0": 53346544.0, "3341000000.0": 53346824.9, "3342000000.0": 53347105.7, "3343000000.0": 53347386.3, "3344000000.0": 53347666.7, "3345000000.0": 53347946.9, "3346000000.0": 53348227.0, "3347000000.0": 53348506.9, "3348000000.0": 53348786.7, "3349000000.0": 53349066.3, "3350000000.0": 53349345.7, "3351000000.0": 53349625.0, "3352000000.0": 53349904.1, "3353000000.0": 53350183.0, "3354000000.0": 53350461.8, "3355000000.0": 53350740.4, "3356000000.0": 53351018.8, "3357000000.0": 53351297.1, "3358000000.0": 53351575.2, "3359000000.0": 53351853.2, "3360000000.0": 53352131.0, "3361000000.0": 53352408.6, "3362000000.0": 53352686.1, "3363000000.0": 53352963.4, "3364000000.0": 53353240.6, "3365000000.0": 53353517.6, "3366000000.0": 53353794.4, "3367000000.0": 53354071.0, "3368000000.0": 53354347.6, "3369000000.0": 53354623.9, "3370000000.0": 53354900.1, "3371000000.0": 53355176.1, "3372000000.0": 53355451.9, "3373000000.0": 53355727.6, "3374000000.0": 53356003.2, "3375000000.0": 53356278.6, "3376000000.0": 53356553.8, "3377000000.0": 53356828.8, "3378000000.0": 53357103.7, "3379000000.0": 53357378.5, "3380000000.0": 53357653.0, "3381000000.0": 53357927.5, "3382000000.0": 53358201.7, "3383000000.0": 53358475.8, "3384000000.0": 53358749.8, "3385000000.0": 53359023.5, "3386000000.0": 53359297.2, "3387000000.0": 53359570.6, "3388000000.0": 53359843.9, "3389000000.0": 53360117.1, "3390000000.0": 53360390.1, "3391000000.0": 53360662.9, "3392000000.0": 53360935.6, "3393000000.0": 53361208.1, "3394000000.0": 53361480.4, "3395000000.0": 53361752.6, "3396000000.0": 53362024.7, "3397000000.0": 53362296.5, "3398000000.0": 53362568.3, "3399000000.0": 53362839.8, "3400000000.0": 53363111.2, "3401000000.0": 53363382.5, "3402000000.0": 53363653.6, "3403000000.0": 53363924.5, "3404000000.0": 53364195.3, "3405000000.0": 53364466.0, "3406000000.0": 53364736.4, "3407000000.0": 53365006.7, "3408000000.0": 53365276.9, "3409000000.0": 53365546.9, "3410000000.0": 53365816.8, "3411000000.0": 53366086.5, "3412000000.0": 53366356.0, "3413000000.0": 53366625.4, "3414000000.0": 53366894.6, "3415000000.0": 53367163.7, "3416000000.0": 53367432.6, "3417000000.0": 53367701.4, "3418000000.0": 53367970.0, "3419000000.0": 53368238.4, "3420000000.0": 53368506.7, "3421000000.0": 53368774.9, "3422000000.0": 53369042.9, "3423000000.0": 53369310.7, "3424000000.0": 53369578.4, "3425000000.0": 53369845.9, "3426000000.0": 53370113.3, "3427000000.0": 53370380.5, "3428000000.0": 53370647.6, "3429000000.0": 53370914.5, "3430000000.0": 53371181.3, "3431000000.0": 53371447.9, "3432000000.0": 53371714.4, "3433000000.0": 53371980.7, "3434000000.0": 53372246.8, "3435000000.0": 53372512.8, "3436000000.0": 53372778.7, "3437000000.0": 53373044.4, "3438000000.0": 53373309.9, "3439000000.0": 53373575.3, "3440000000.0": 53373840.6, "3441000000.0": 53374105.6, "3442000000.0": 53374370.6, "3443000000.0": 53374635.4, "3444000000.0": 53374900.0, "3445000000.0": 53375164.5, "3446000000.0": 53375428.8, "3447000000.0": 53375693.0, "3448000000.0": 53375957.1, "3449000000.0": 53376220.9, "3450000000.0": 53376484.7, "3451000000.0": 53376748.3, "3452000000.0": 53377011.7, "3453000000.0": 53377275.0, "3454000000.0": 53377538.1, "3455000000.0": 53377801.1, "3456000000.0": 53378063.9, "3457000000.0": 53378326.6, "3458000000.0": 53378589.2, "3459000000.0": 53378851.5, "3460000000.0": 53379113.8, "3461000000.0": 53379375.9, "3462000000.0": 53379637.8, "3463000000.0": 53379899.6, "3464000000.0": 53380161.2, "3465000000.0": 53380422.7, "3466000000.0": 53380684.1, "3467000000.0": 53380945.3, "3468000000.0": 53381206.3, "3469000000.0": 53381467.2, "3470000000.0": 53381728.0, "3471000000.0": 53381988.6, "3472000000.0": 53382249.1, "3473000000.0": 53382509.4, "3474000000.0": 53382769.5, "3475000000.0": 53383029.5, "3476000000.0": 53383289.4, "3477000000.0": 53383549.1, "3478000000.0": 53383808.7, "3479000000.0": 53384068.1, "3480000000.0": 53384327.4, "3481000000.0": 53384586.6, "3482000000.0": 53384845.6, "3483000000.0": 53385104.4, "3484000000.0": 53385363.1, "3485000000.0": 53385621.7, "3486000000.0": 53385880.1, "3487000000.0": 53386138.3, "3488000000.0": 53386396.4, "3489000000.0": 53386654.4, "3490000000.0": 53386912.2, "3491000000.0": 53387169.9, "3492000000.0": 53387427.4, "3493000000.0": 53387684.8, "3494000000.0": 53387942.1, "3495000000.0": 53388199.2, "3496000000.0": 53388456.1, "3497000000.0": 53388712.9, "3498000000.0": 53388969.6, "3499000000.0": 53389226.1, "3500000000.0": 53389482.5, "3501000000.0": 53389738.7, "3502000000.0": 53389994.8, "3503000000.0": 53390250.8, "3504000000.0": 53390506.6, "3505000000.0": 53390762.2, "3506000000.0": 53391017.8, "3507000000.0": 53391273.1, "3508000000.0": 53391528.4, "3509000000.0": 53391783.5, "3510000000.0": 53392038.4, "3511000000.0": 53392293.2, "3512000000.0": 53392547.9, "3513000000.0": 53392802.4, "3514000000.0": 53393056.7, "3515000000.0": 53393311.0, "3516000000.0": 53393565.1, "3517000000.0": 53393819.0, "3518000000.0": 53394072.8, "3519000000.0": 53394326.5, "3520000000.0": 53394580.0, "3521000000.0": 53394833.4, "3522000000.0": 53395086.6, "3523000000.0": 53395339.7, "3524000000.0": 53395592.7, "3525000000.0": 53395845.5, "3526000000.0": 53396098.2, "3527000000.0": 53396350.7, "3528000000.0": 53396603.1, "3529000000.0": 53396855.3, "3530000000.0": 53397107.5, "3531000000.0": 53397359.4, "3532000000.0": 53397611.3, "3533000000.0": 53397862.9, "3534000000.0": 53398114.5, "3535000000.0": 53398365.9, "3536000000.0": 53398617.2, "3537000000.0": 53398868.3, "3538000000.0": 53399119.3, "3539000000.0": 53399370.2, "3540000000.0": 53399620.9, "3541000000.0": 53399871.4, "3542000000.0": 53400121.9, "3543000000.0": 53400372.2, "3544000000.0": 53400622.3, "3545000000.0": 53400872.3, "3546000000.0": 53401122.2, "3547000000.0": 53401372.0, "3548000000.0": 53401621.6, "3549000000.0": 53401871.0, "3550000000.0": 53402120.4, "3551000000.0": 53402369.5, "3552000000.0": 53402618.6, "3553000000.0": 53402867.5, "3554000000.0": 53403116.3, "3555000000.0": 53403364.9, "3556000000.0": 53403613.4, "3557000000.0": 53403861.8, "3558000000.0": 53404110.0, "3559000000.0": 53404358.1, "3560000000.0": 53404606.0, "3561000000.0": 53404853.9, "3562000000.0": 53405101.5, "3563000000.0": 53405349.1, "3564000000.0": 53405596.5, "3565000000.0": 53405843.7, "3566000000.0": 53406090.9, "3567000000.0": 53406337.9, "3568000000.0": 53406584.7, "3569000000.0": 53406831.4, "3570000000.0": 53407078.0, "3571000000.0": 53407324.5, "3572000000.0": 53407570.8, "3573000000.0": 53407817.0, "3574000000.0": 53408063.0, "3575000000.0": 53408308.9, "3576000000.0": 53408554.7, "3577000000.0": 53408800.3, "3578000000.0": 53409045.8, "3579000000.0": 53409291.2, "3580000000.0": 53409536.4, "3581000000.0": 53409781.5, "3582000000.0": 53410026.5, "3583000000.0": 53410271.3, "3584000000.0": 53410516.0, "3585000000.0": 53410760.6, "3586000000.0": 53411005.0, "3587000000.0": 53411249.3, "3588000000.0": 53411493.5, "3589000000.0": 53411737.5, "3590000000.0": 53411981.4, "3591000000.0": 53412225.1, "3592000000.0": 53412468.8, "3593000000.0": 53412712.3, "3594000000.0": 53412955.6, "3595000000.0": 53413198.8, "3596000000.0": 53413441.9, "3597000000.0": 53413684.9, "3598000000.0": 53413927.7, "3599000000.0": 53414170.4, "3600000000.0": 53414413.0, "3601000000.0": 53414655.4, "3602000000.0": 53414897.7, "3603000000.0": 53415139.9, "3604000000.0": 53415381.9, "3605000000.0": 53415623.8, "3606000000.0": 53415865.5, "3607000000.0": 53416107.2, "3608000000.0": 53416348.7, "3609000000.0": 53416590.1, "3610000000.0": 53416831.3, "3611000000.0": 53417072.4, "3612000000.0": 53417313.4, "3613000000.0": 53417554.2, "3614000000.0": 53417794.9, "3615000000.0": 53418035.5, "3616000000.0": 53418276.0, "3617000000.0": 53418516.3, "3618000000.0": 53418756.5, "3619000000.0": 53418996.6, "3620000000.0": 53419236.5, "3621000000.0": 53419476.3, "3622000000.0": 53419716.0, "3623000000.0": 53419955.5, "3624000000.0": 53420194.9, "3625000000.0": 53420434.2, "3626000000.0": 53420673.3, "3627000000.0": 53420912.4, "3628000000.0": 53421151.3, "3629000000.0": 53421390.0, "3630000000.0": 53421628.6, "3631000000.0": 53421867.2, "3632000000.0": 53422105.5, "3633000000.0": 53422343.8, "3634000000.0": 53422581.9, "3635000000.0": 53422819.9, "3636000000.0": 53423057.7, "3637000000.0": 53423295.5, "3638000000.0": 53423533.1, "3639000000.0": 53423770.5, "3640000000.0": 53424007.9, "3641000000.0": 53424245.1, "3642000000.0": 53424482.2, "3643000000.0": 53424719.1, "3644000000.0": 53424956.0, "3645000000.0": 53425192.7, "3646000000.0": 53425429.3, "3647000000.0": 53425665.7, "3648000000.0": 53425902.0, "3649000000.0": 53426138.2, "3650000000.0": 53426374.3, "3651000000.0": 53426610.2, "3652000000.0": 53426846.0, "3653000000.0": 53427081.7, "3654000000.0": 53427317.3, "3655000000.0": 53427552.7, "3656000000.0": 53427788.0, "3657000000.0": 53428023.2, "3658000000.0": 53428258.2, "3659000000.0": 53428493.2, "3660000000.0": 53428728.0, "3661000000.0": 53428962.6, "3662000000.0": 53429197.2, "3663000000.0": 53429431.6, "3664000000.0": 53429665.9, "3665000000.0": 53429900.1, "3666000000.0": 53430134.1, "3667000000.0": 53430368.0, "3668000000.0": 53430601.8, "3669000000.0": 53430835.5, "3670000000.0": 53431069.0, "3671000000.0": 53431302.5, "3672000000.0": 53431535.7, "3673000000.0": 53431768.9, "3674000000.0": 53432002.0, "3675000000.0": 53432234.9, "3676000000.0": 53432467.7, "3677000000.0": 53432700.3, "3678000000.0": 53432932.9, "3679000000.0": 53433165.3, "3680000000.0": 53433397.6, "3681000000.0": 53433629.8, "3682000000.0": 53433861.8, "3683000000.0": 53434093.7, "3684000000.0": 53434325.5, "3685000000.0": 53434557.2, "3686000000.0": 53434788.8, "3687000000.0": 53435020.2, "3688000000.0": 53435251.5, "3689000000.0": 53435482.7, "3690000000.0": 53435713.7, "3691000000.0": 53435944.7, "3692000000.0": 53436175.5, "3693000000.0": 53436406.2, "3694000000.0": 53436636.7, "3695000000.0": 53436867.2, "3696000000.0": 53437097.5, "3697000000.0": 53437327.7, "3698000000.0": 53437557.8, "3699000000.0": 53437787.7, "3700000000.0": 53438017.5, "3701000000.0": 53438247.2, "3702000000.0": 53438476.8, "3703000000.0": 53438706.3, "3704000000.0": 53438935.6, "3705000000.0": 53439164.9, "3706000000.0": 53439394.0, "3707000000.0": 53439622.9, "3708000000.0": 53439851.8, "3709000000.0": 53440080.5, "3710000000.0": 53440309.1, "3711000000.0": 53440537.6, "3712000000.0": 53440766.0, "3713000000.0": 53440994.2, "3714000000.0": 53441222.4, "3715000000.0": 53441450.4, "3716000000.0": 53441678.3, "3717000000.0": 53441906.0, "3718000000.0": 53442133.7, "3719000000.0": 53442361.2, "3720000000.0": 53442588.6, "3721000000.0": 53442815.9, "3722000000.0": 53443043.1, "3723000000.0": 53443270.1, "3724000000.0": 53443497.0, "3725000000.0": 53443723.8, "3726000000.0": 53443950.5, "3727000000.0": 53444177.1, "3728000000.0": 53444403.5, "3729000000.0": 53444629.8, "3730000000.0": 53444856.1, "3731000000.0": 53445082.1, "3732000000.0": 53445308.1, "3733000000.0": 53445534.0, "3734000000.0": 53445759.7, "3735000000.0": 53445985.3, "3736000000.0": 53446210.8, "3737000000.0": 53446436.2, "3738000000.0": 53446661.4, "3739000000.0": 53446886.5, "3740000000.0": 53447111.6, "3741000000.0": 53447336.5, "3742000000.0": 53447561.2, "3743000000.0": 53447785.9, "3744000000.0": 53448010.5, "3745000000.0": 53448234.9, "3746000000.0": 53448459.2, "3747000000.0": 53448683.4, "3748000000.0": 53448907.4, "3749000000.0": 53449131.4, "3750000000.0": 53449355.2, "3751000000.0": 53449579.0, "3752000000.0": 53449802.6, "3753000000.0": 53450026.0, "3754000000.0": 53450249.4, "3755000000.0": 53450472.7, "3756000000.0": 53450695.8, "3757000000.0": 53450918.8, "3758000000.0": 53451141.7, "3759000000.0": 53451364.5, "3760000000.0": 53451587.2, "3761000000.0": 53451809.7, "3762000000.0": 53452032.2, "3763000000.0": 53452254.5, "3764000000.0": 53452476.7, "3765000000.0": 53452698.8, "3766000000.0": 53452920.7, "3767000000.0": 53453142.6, "3768000000.0": 53453364.3, "3769000000.0": 53453585.9, "3770000000.0": 53453807.4, "3771000000.0": 53454028.8, "3772000000.0": 53454250.1, "3773000000.0": 53454471.3, "3774000000.0": 53454692.3, "3775000000.0": 53454913.2, "3776000000.0": 53455134.1, "3777000000.0": 53455354.8, "3778000000.0": 53455575.3, "3779000000.0": 53455795.8, "3780000000.0": 53456016.2, "3781000000.0": 53456236.4, "3782000000.0": 53456456.5, "3783000000.0": 53456676.5, "3784000000.0": 53456896.4, "3785000000.0": 53457116.2, "3786000000.0": 53457335.9, "3787000000.0": 53457555.4, "3788000000.0": 53457774.9, "3789000000.0": 53457994.2, "3790000000.0": 53458213.4, "3791000000.0": 53458432.5, "3792000000.0": 53458651.5, "3793000000.0": 53458870.4, "3794000000.0": 53459089.1, "3795000000.0": 53459307.8, "3796000000.0": 53459526.3, "3797000000.0": 53459744.7, "3798000000.0": 53459963.0, "3799000000.0": 53460181.2, "3800000000.0": 53460399.3, "3801000000.0": 53460617.2, "3802000000.0": 53460835.1, "3803000000.0": 53461052.8, "3804000000.0": 53461270.4, "3805000000.0": 53461488.0, "3806000000.0": 53461705.4, "3807000000.0": 53461922.6, "3808000000.0": 53462139.8, "3809000000.0": 53462356.9, "3810000000.0": 53462573.8, "3811000000.0": 53462790.7, "3812000000.0": 53463007.4, "3813000000.0": 53463224.0, "3814000000.0": 53463440.5, "3815000000.0": 53463656.9, "3816000000.0": 53463873.2, "3817000000.0": 53464089.4, "3818000000.0": 53464305.4, "3819000000.0": 53464521.4, "3820000000.0": 53464737.2, "3821000000.0": 53464952.9, "3822000000.0": 53465168.5, "3823000000.0": 53465384.0, "3824000000.0": 53465599.4, "3825000000.0": 53465814.7, "3826000000.0": 53466029.9, "3827000000.0": 53466244.9, "3828000000.0": 53466459.9, "3829000000.0": 53466674.7, "3830000000.0": 53466889.4, "3831000000.0": 53467104.0, "3832000000.0": 53467318.5, "3833000000.0": 53467532.9, "3834000000.0": 53467747.2, "3835000000.0": 53467961.4, "3836000000.0": 53468175.5, "3837000000.0": 53468389.4, "3838000000.0": 53468603.3, "3839000000.0": 53468817.0, "3840000000.0": 53469030.6, "3841000000.0": 53469244.1, "3842000000.0": 53469457.6, "3843000000.0": 53469670.9, "3844000000.0": 53469884.0, "3845000000.0": 53470097.1, "3846000000.0": 53470310.1, "3847000000.0": 53470522.9, "3848000000.0": 53470735.7, "3849000000.0": 53470948.3, "3850000000.0": 53471160.9, "3851000000.0": 53471373.3, "3852000000.0": 53471585.6, "3853000000.0": 53471797.8, "3854000000.0": 53472009.9, "3855000000.0": 53472221.9, "3856000000.0": 53472433.8, "3857000000.0": 53472645.6, "3858000000.0": 53472857.3, "3859000000.0": 53473068.8, "3860000000.0": 53473280.3, "3861000000.0": 53473491.6, "3862000000.0": 53473702.8, "3863000000.0": 53473914.0, "3864000000.0": 53474125.0, "3865000000.0": 53474335.9, "3866000000.0": 53474546.7, "3867000000.0": 53474757.4, "3868000000.0": 53474968.0, "3869000000.0": 53475178.5, "3870000000.0": 53475388.9, "3871000000.0": 53475599.1, "3872000000.0": 53475809.3, "3873000000.0": 53476019.4, "3874000000.0": 53476229.3, "3875000000.0": 53476439.1, "3876000000.0": 53476648.9, "3877000000.0": 53476858.5, "3878000000.0": 53477068.0, "3879000000.0": 53477277.5, "3880000000.0": 53477486.8, "3881000000.0": 53477696.0, "3882000000.0": 53477905.1, "3883000000.0": 53478114.1, "3884000000.0": 53478322.9, "3885000000.0": 53478531.7, "3886000000.0": 53478740.4, "3887000000.0": 53478949.0, "3888000000.0": 53479157.4, "3889000000.0": 53479365.8, "3890000000.0": 53479574.0, "3891000000.0": 53479782.2, "3892000000.0": 53479990.2, "3893000000.0": 53480198.2, "3894000000.0": 53480406.0, "3895000000.0": 53480613.7, "3896000000.0": 53480821.3, "3897000000.0": 53481028.9, "3898000000.0": 53481236.3, "3899000000.0": 53481443.6, "3900000000.0": 53481650.8, "3901000000.0": 53481857.9, "3902000000.0": 53482064.9, "3903000000.0": 53482271.8, "3904000000.0": 53482478.5, "3905000000.0": 53482685.2, "3906000000.0": 53482891.8, "3907000000.0": 53483098.3, "3908000000.0": 53483304.6, "3909000000.0": 53483510.9, "3910000000.0": 53483717.1, "3911000000.0": 53483923.1, "3912000000.0": 53484129.1, "3913000000.0": 53484334.9, "3914000000.0": 53484540.7, "3915000000.0": 53484746.3, "3916000000.0": 53484951.8, "3917000000.0": 53485157.3, "3918000000.0": 53485362.6, "3919000000.0": 53485567.8, "3920000000.0": 53485772.9, "3921000000.0": 53485978.0, "3922000000.0": 53486182.9, "3923000000.0": 53486387.7, "3924000000.0": 53486592.4, "3925000000.0": 53486797.0, "3926000000.0": 53487001.5, "3927000000.0": 53487205.9, "3928000000.0": 53487410.2, "3929000000.0": 53487614.4, "3930000000.0": 53487818.5, "3931000000.0": 53488022.5, "3932000000.0": 53488226.4, "3933000000.0": 53488430.2, "3934000000.0": 53488633.9, "3935000000.0": 53488837.5, "3936000000.0": 53489041.0, "3937000000.0": 53489244.4, "3938000000.0": 53489447.6, "3939000000.0": 53489650.8, "3940000000.0": 53489853.9, "3941000000.0": 53490056.9, "3942000000.0": 53490259.8, "3943000000.0": 53490462.5, "3944000000.0": 53490665.2, "3945000000.0": 53490867.8, "3946000000.0": 53491070.2, "3947000000.0": 53491272.6, "3948000000.0": 53491474.9, "3949000000.0": 53491677.1, "3950000000.0": 53491879.1, "3951000000.0": 53492081.1, "3952000000.0": 53492283.0, "3953000000.0": 53492484.7, "3954000000.0": 53492686.4, "3955000000.0": 53492887.9, "3956000000.0": 53493089.4, "3957000000.0": 53493290.8, "3958000000.0": 53493492.0, "3959000000.0": 53493693.2, "3960000000.0": 53493894.3, "3961000000.0": 53494095.2, "3962000000.0": 53494296.1, "3963000000.0": 53494496.8, "3964000000.0": 53494697.5, "3965000000.0": 53494898.1, "3966000000.0": 53495098.5, "3967000000.0": 53495298.9, "3968000000.0": 53495499.2, "3969000000.0": 53495699.3, "3970000000.0": 53495899.4, "3971000000.0": 53496099.4, "3972000000.0": 53496299.2, "3973000000.0": 53496499.0, "3974000000.0": 53496698.7, "3975000000.0": 53496898.2, "3976000000.0": 53497097.7, "3977000000.0": 53497297.1, "3978000000.0": 53497496.4, "3979000000.0": 53497695.5, "3980000000.0": 53497894.6, "3981000000.0": 53498093.6, "3982000000.0": 53498292.5, "3983000000.0": 53498491.3, "3984000000.0": 53498689.9, "3985000000.0": 53498888.5, "3986000000.0": 53499087.0, "3987000000.0": 53499285.4, "3988000000.0": 53499483.7, "3989000000.0": 53499681.9, "3990000000.0": 53499880.0, "3991000000.0": 53500078.0, "3992000000.0": 53500275.9, "3993000000.0": 53500473.7, "3994000000.0": 53500671.4, "3995000000.0": 53500869.0, "3996000000.0": 53501066.5, "3997000000.0": 53501263.9, "3998000000.0": 53501461.2, "3999000000.0": 53501658.4, "4000000000.0": 53501855.6, "4001000000.0": 53502052.6, "4002000000.0": 53502249.5, "4003000000.0": 53502446.3, "4004000000.0": 53502643.1, "4005000000.0": 53502839.7, "4006000000.0": 53503036.3, "4007000000.0": 53503232.7, "4008000000.0": 53503429.0, "4009000000.0": 53503625.3, "4010000000.0": 53503821.4, "4011000000.0": 53504017.5, "4012000000.0": 53504213.5, "4013000000.0": 53504409.3, "4014000000.0": 53504605.1, "4015000000.0": 53504800.8, "4016000000.0": 53504996.3, "4017000000.0": 53505191.8, "4018000000.0": 53505387.2, "4019000000.0": 53505582.5, "4020000000.0": 53505777.7, "4021000000.0": 53505972.8, "4022000000.0": 53506167.8, "4023000000.0": 53506362.7, "4024000000.0": 53506557.5, "4025000000.0": 53506752.2, "4026000000.0": 53506946.8, "4027000000.0": 53507141.4, "4028000000.0": 53507335.8, "4029000000.0": 53507530.1, "4030000000.0": 53507724.4, "4031000000.0": 53507918.5, "4032000000.0": 53508112.6, "4033000000.0": 53508306.5, "4034000000.0": 53508500.4, "4035000000.0": 53508694.1, "4036000000.0": 53508887.8, "4037000000.0": 53509081.4, "4038000000.0": 53509274.9, "4039000000.0": 53509468.3, "4040000000.0": 53509661.6, "4041000000.0": 53509854.8, "4042000000.0": 53510047.9, "4043000000.0": 53510240.9, "4044000000.0": 53510433.8, "4045000000.0": 53510626.6, "4046000000.0": 53510819.3, "4047000000.0": 53511012.0, "4048000000.0": 53511204.5, "4049000000.0": 53511397.0, "4050000000.0": 53511589.3, "4051000000.0": 53511781.6, "4052000000.0": 53511973.7, "4053000000.0": 53512165.8, "4054000000.0": 53512357.8, "4055000000.0": 53512549.7, "4056000000.0": 53512741.5, "4057000000.0": 53512933.2, "4058000000.0": 53513124.8, "4059000000.0": 53513316.3, "4060000000.0": 53513507.7, "4061000000.0": 53513699.1, "4062000000.0": 53513890.3, "4063000000.0": 53514081.4, "4064000000.0": 53514272.5, "4065000000.0": 53514463.4, "4066000000.0": 53514654.3, "4067000000.0": 53514845.1, "4068000000.0": 53515035.8, "4069000000.0": 53515226.3, "4070000000.0": 53515416.8, "4071000000.0": 53515607.2, "4072000000.0": 53515797.6, "4073000000.0": 53515987.8, "4074000000.0": 53516177.9, "4075000000.0": 53516367.9, "4076000000.0": 53516557.9, "4077000000.0": 53516747.7, "4078000000.0": 53516937.5, "4079000000.0": 53517127.2, "4080000000.0": 53517316.7, "4081000000.0": 53517506.2, "4082000000.0": 53517695.6, "4083000000.0": 53517884.9, "4084000000.0": 53518074.1, "4085000000.0": 53518263.2, "4086000000.0": 53518452.3, "4087000000.0": 53518641.2, "4088000000.0": 53518830.1, "4089000000.0": 53519018.8, "4090000000.0": 53519207.5, "4091000000.0": 53519396.0, "4092000000.0": 53519584.5, "4093000000.0": 53519772.9, "4094000000.0": 53519961.2, "4095000000.0": 53520149.4, "4096000000.0": 53520337.5, "4097000000.0": 53520525.6, "4098000000.0": 53520713.5, "4099000000.0": 53520901.4, "4100000000.0": 53521089.1, "4101000000.0": 53521276.8, "4102000000.0": 53521464.4, "4103000000.0": 53521651.9, "4104000000.0": 53521839.2, "4105000000.0": 53522026.6, "4106000000.0": 53522213.8, "4107000000.0": 53522400.9, "4108000000.0": 53522587.9, "4109000000.0": 53522774.9, "4110000000.0": 53522961.7, "4111000000.0": 53523148.5, "4112000000.0": 53523335.2, "4113000000.0": 53523521.8, "4114000000.0": 53523708.3, "4115000000.0": 53523894.7, "4116000000.0": 53524081.0, "4117000000.0": 53524267.2, "4118000000.0": 53524453.4, "4119000000.0": 53524639.4, "4120000000.0": 53524825.4, "4121000000.0": 53525011.3, "4122000000.0": 53525197.1, "4123000000.0": 53525382.8, "4124000000.0": 53525568.4, "4125000000.0": 53525753.9, "4126000000.0": 53525939.3, "4127000000.0": 53526124.7, "4128000000.0": 53526309.9, "4129000000.0": 53526495.1, "4130000000.0": 53526680.2, "4131000000.0": 53526865.2, "4132000000.0": 53527050.1, "4133000000.0": 53527234.9, "4134000000.0": 53527419.6, "4135000000.0": 53527604.3, "4136000000.0": 53527788.8, "4137000000.0": 53527973.3, "4138000000.0": 53528157.6, "4139000000.0": 53528341.9, "4140000000.0": 53528526.1, "4141000000.0": 53528710.2, "4142000000.0": 53528894.3, "4143000000.0": 53529078.2, "4144000000.0": 53529262.0, "4145000000.0": 53529445.8, "4146000000.0": 53529629.5, "4147000000.0": 53529813.1, "4148000000.0": 53529996.6, "4149000000.0": 53530180.0, "4150000000.0": 53530363.3, "4151000000.0": 53530546.5, "4152000000.0": 53530729.7, "4153000000.0": 53530912.8, "4154000000.0": 53531095.7, "4155000000.0": 53531278.6, "4156000000.0": 53531461.4, "4157000000.0": 53531644.1, "4158000000.0": 53531826.8, "4159000000.0": 53532009.3, "4160000000.0": 53532191.8, "4161000000.0": 53532374.1, "4162000000.0": 53532556.4, "4163000000.0": 53532738.6, "4164000000.0": 53532920.7, "4165000000.0": 53533102.8, "4166000000.0": 53533284.7, "4167000000.0": 53533466.5, "4168000000.0": 53533648.3, "4169000000.0": 53533830.0, "4170000000.0": 53534011.6, "4171000000.0": 53534193.1, "4172000000.0": 53534374.5, "4173000000.0": 53534555.9, "4174000000.0": 53534737.1, "4175000000.0": 53534918.3, "4176000000.0": 53535099.4, "4177000000.0": 53535280.4, "4178000000.0": 53535461.3, "4179000000.0": 53535642.1, "4180000000.0": 53535822.8, "4181000000.0": 53536003.5, "4182000000.0": 53536184.1, "4183000000.0": 53536364.5, "4184000000.0": 53536544.9, "4185000000.0": 53536725.3, "4186000000.0": 53536905.5, "4187000000.0": 53537085.6, "4188000000.0": 53537265.7, "4189000000.0": 53537445.7, "4190000000.0": 53537625.6, "4191000000.0": 53537805.4, "4192000000.0": 53537985.1, "4193000000.0": 53538164.7, "4194000000.0": 53538344.3, "4195000000.0": 53538523.7, "4196000000.0": 53538703.1, "4197000000.0": 53538882.4, "4198000000.0": 53539061.6, "4199000000.0": 53539240.8, "4200000000.0": 53539419.8, "4201000000.0": 53539598.8, "4202000000.0": 53539777.7, "4203000000.0": 53539956.4, "4204000000.0": 53540135.2, "4205000000.0": 53540313.8, "4206000000.0": 53540492.3, "4207000000.0": 53540670.8, "4208000000.0": 53540849.2, "4209000000.0": 53541027.5, "4210000000.0": 53541205.7, "4211000000.0": 53541383.8, "4212000000.0": 53541561.8, "4213000000.0": 53541739.8, "4214000000.0": 53541917.7, "4215000000.0": 53542095.5, "4216000000.0": 53542273.2, "4217000000.0": 53542450.8, "4218000000.0": 53542628.3, "4219000000.0": 53542805.8, "4220000000.0": 53542983.2, "4221000000.0": 53543160.5, "4222000000.0": 53543337.7, "4223000000.0": 53543514.8, "4224000000.0": 53543691.9, "4225000000.0": 53543868.8, "4226000000.0": 53544045.7, "4227000000.0": 53544222.5, "4228000000.0": 53544399.2, "4229000000.0": 53544575.8, "4230000000.0": 53544752.4, "4231000000.0": 53544928.9, "4232000000.0": 53545105.3, "4233000000.0": 53545281.6, "4234000000.0": 53545457.8, "4235000000.0": 53545633.9, "4236000000.0": 53545810.0, "4237000000.0": 53545986.0, "4238000000.0": 53546161.9, "4239000000.0": 53546337.7, "4240000000.0": 53546513.4, "4241000000.0": 53546689.0, "4242000000.0": 53546864.6, "4243000000.0": 53547040.1, "4244000000.0": 53547215.5, "4245000000.0": 53547390.8, "4246000000.0": 53547566.1, "4247000000.0": 53547741.2, "4248000000.0": 53547916.3, "4249000000.0": 53548091.3, "4250000000.0": 53548266.2, "4251000000.0": 53548441.1, "4252000000.0": 53548615.8, "4253000000.0": 53548790.5, "4254000000.0": 53548965.1, "4255000000.0": 53549139.6, "4256000000.0": 53549314.0, "4257000000.0": 53549488.4, "4258000000.0": 53549662.6, "4259000000.0": 53549836.8, "4260000000.0": 53550010.9, "4261000000.0": 53550185.0, "4262000000.0": 53550358.9, "4263000000.0": 53550532.8, "4264000000.0": 53550706.6, "4265000000.0": 53550880.3, "4266000000.0": 53551053.9, "4267000000.0": 53551227.4, "4268000000.0": 53551400.9, "4269000000.0": 53551574.3, "4270000000.0": 53551747.6, "4271000000.0": 53551920.8, "4272000000.0": 53552094.0, "4273000000.0": 53552267.0, "4274000000.0": 53552440.0, "4275000000.0": 53552612.9, "4276000000.0": 53552785.7, "4277000000.0": 53552958.5, "4278000000.0": 53553131.1, "4279000000.0": 53553303.7, "4280000000.0": 53553476.2, "4281000000.0": 53553648.7, "4282000000.0": 53553821.0, "4283000000.0": 53553993.3, "4284000000.0": 53554165.5, "4285000000.0": 53554337.6, "4286000000.0": 53554509.6, "4287000000.0": 53554681.6, "4288000000.0": 53554853.4, "4289000000.0": 53555025.2, "4290000000.0": 53555196.9, "4291000000.0": 53555368.6, "4292000000.0": 53555540.1, "4293000000.0": 53555711.6, "4294000000.0": 53555883.0, "4295000000.0": 53556054.3, "4296000000.0": 53556225.6, "4297000000.0": 53556396.7, "4298000000.0": 53556567.8, "4299000000.0": 53556738.8, "4300000000.0": 53556909.8, "4301000000.0": 53557080.6, "4302000000.0": 53557251.4, "4303000000.0": 53557422.1, "4304000000.0": 53557592.7, "4305000000.0": 53557763.2, "4306000000.0": 53557933.7, "4307000000.0": 53558104.1, "4308000000.0": 53558274.4, "4309000000.0": 53558444.6, "4310000000.0": 53558614.7, "4311000000.0": 53558784.8, "4312000000.0": 53558954.8, "4313000000.0": 53559124.7, "4314000000.0": 53559294.5, "4315000000.0": 53559464.3, "4316000000.0": 53559634.0, "4317000000.0": 53559803.6, "4318000000.0": 53559973.1, "4319000000.0": 53560142.6, "4320000000.0": 53560311.9, "4321000000.0": 53560481.2, "4322000000.0": 53560650.4, "4323000000.0": 53560819.6, "4324000000.0": 53560988.6, "4325000000.0": 53561157.6, "4326000000.0": 53561326.5, "4327000000.0": 53561495.4, "4328000000.0": 53561664.1, "4329000000.0": 53561832.8, "4330000000.0": 53562001.4, "4331000000.0": 53562169.9, "4332000000.0": 53562338.4, "4333000000.0": 53562506.7, "4334000000.0": 53562675.0, "4335000000.0": 53562843.2, "4336000000.0": 53563011.4, "4337000000.0": 53563179.4, "4338000000.0": 53563347.4, "4339000000.0": 53563515.3, "4340000000.0": 53563683.2, "4341000000.0": 53563850.9, "4342000000.0": 53564018.6, "4343000000.0": 53564186.2, "4344000000.0": 53564353.7, "4345000000.0": 53564521.2, "4346000000.0": 53564688.6, "4347000000.0": 53564855.9, "4348000000.0": 53565023.1, "4349000000.0": 53565190.3, "4350000000.0": 53565357.3, "4351000000.0": 53565524.3, "4352000000.0": 53565691.2, "4353000000.0": 53565858.1, "4354000000.0": 53566024.9, "4355000000.0": 53566191.6, "4356000000.0": 53566358.2, "4357000000.0": 53566524.7, "4358000000.0": 53566691.2, "4359000000.0": 53566857.6, "4360000000.0": 53567023.9, "4361000000.0": 53567190.2, "4362000000.0": 53567356.3, "4363000000.0": 53567522.4, "4364000000.0": 53567688.4, "4365000000.0": 53567854.4, "4366000000.0": 53568020.2, "4367000000.0": 53568186.0, "4368000000.0": 53568351.8, "4369000000.0": 53568517.4, "4370000000.0": 53568683.0, "4371000000.0": 53568848.5, "4372000000.0": 53569013.9, "4373000000.0": 53569179.2, "4374000000.0": 53569344.5, "4375000000.0": 53569509.7, "4376000000.0": 53569674.8, "4377000000.0": 53569839.9, "4378000000.0": 53570004.8, "4379000000.0": 53570169.7, "4380000000.0": 53570334.6, "4381000000.0": 53570499.3, "4382000000.0": 53570664.0, "4383000000.0": 53570828.6, "4384000000.0": 53570993.1, "4385000000.0": 53571157.6, "4386000000.0": 53571321.9, "4387000000.0": 53571486.2, "4388000000.0": 53571650.5, "4389000000.0": 53571814.6, "4390000000.0": 53571978.7, "4391000000.0": 53572142.7, "4392000000.0": 53572306.7, "4393000000.0": 53572470.5, "4394000000.0": 53572634.3, "4395000000.0": 53572798.0, "4396000000.0": 53572961.7, "4397000000.0": 53573125.2, "4398000000.0": 53573288.7, "4399000000.0": 53573452.2, "4400000000.0": 53573615.5, "4401000000.0": 53573778.8, "4402000000.0": 53573942.0, "4403000000.0": 53574105.1, "4404000000.0": 53574268.2, "4405000000.0": 53574431.2, "4406000000.0": 53574594.1, "4407000000.0": 53574756.9, "4408000000.0": 53574919.7, "4409000000.0": 53575082.4, "4410000000.0": 53575245.0, "4411000000.0": 53575407.5, "4412000000.0": 53575570.0, "4413000000.0": 53575732.4, "4414000000.0": 53575894.7, "4415000000.0": 53576057.0, "4416000000.0": 53576219.2, "4417000000.0": 53576381.3, "4418000000.0": 53576543.3, "4419000000.0": 53576705.3, "4420000000.0": 53576867.2, "4421000000.0": 53577029.0, "4422000000.0": 53577190.8, "4423000000.0": 53577352.4, "4424000000.0": 53577514.0, "4425000000.0": 53577675.6, "4426000000.0": 53577837.0, "4427000000.0": 53577998.4, "4428000000.0": 53578159.7, "4429000000.0": 53578321.0, "4430000000.0": 53578482.2, "4431000000.0": 53578643.3, "4432000000.0": 53578804.3, "4433000000.0": 53578965.2, "4434000000.0": 53579126.1, "4435000000.0": 53579286.9, "4436000000.0": 53579447.7, "4437000000.0": 53579608.4, "4438000000.0": 53579769.0, "4439000000.0": 53579929.5, "4440000000.0": 53580090.0, "4441000000.0": 53580250.3, "4442000000.0": 53580410.7, "4443000000.0": 53580570.9, "4444000000.0": 53580731.1, "4445000000.0": 53580891.2, "4446000000.0": 53581051.2, "4447000000.0": 53581211.2, "4448000000.0": 53581371.1, "4449000000.0": 53581530.9, "4450000000.0": 53581690.6, "4451000000.0": 53581850.3, "4452000000.0": 53582009.9, "4453000000.0": 53582169.4, "4454000000.0": 53582328.9, "4455000000.0": 53582488.3, "4456000000.0": 53582647.6, "4457000000.0": 53582806.9, "4458000000.0": 53582966.0, "4459000000.0": 53583125.2, "4460000000.0": 53583284.2, "4461000000.0": 53583443.2, "4462000000.0": 53583602.1, "4463000000.0": 53583760.9, "4464000000.0": 53583919.7, "4465000000.0": 53584078.4, "4466000000.0": 53584237.0, "4467000000.0": 53584395.5, "4468000000.0": 53584554.0, "4469000000.0": 53584712.4, "4470000000.0": 53584870.8, "4471000000.0": 53585029.0, "4472000000.0": 53585187.2, "4473000000.0": 53585345.4, "4474000000.0": 53585503.4, "4475000000.0": 53585661.4, "4476000000.0": 53585819.3, "4477000000.0": 53585977.2, "4478000000.0": 53586135.0, "4479000000.0": 53586292.7, "4480000000.0": 53586450.3, "4481000000.0": 53586607.9, "4482000000.0": 53586765.4, "4483000000.0": 53586922.8, "4484000000.0": 53587080.2, "4485000000.0": 53587237.5, "4486000000.0": 53587394.7, "4487000000.0": 53587551.9, "4488000000.0": 53587709.0, "4489000000.0": 53587866.0, "4490000000.0": 53588022.9, "4491000000.0": 53588179.8, "4492000000.0": 53588336.6, "4493000000.0": 53588493.4, "4494000000.0": 53588650.0, "4495000000.0": 53588806.7, "4496000000.0": 53588963.2, "4497000000.0": 53589119.7, "4498000000.0": 53589276.1, "4499000000.0": 53589432.4, "4500000000.0": 53589588.7, "4501000000.0": 53589744.9, "4502000000.0": 53589901.0, "4503000000.0": 53590057.0, "4504000000.0": 53590213.0, "4505000000.0": 53590368.9, "4506000000.0": 53590524.8, "4507000000.0": 53590680.6, "4508000000.0": 53590836.3, "4509000000.0": 53590991.9, "4510000000.0": 53591147.5, "4511000000.0": 53591303.0, "4512000000.0": 53591458.5, "4513000000.0": 53591613.9, "4514000000.0": 53591769.2, "4515000000.0": 53591924.4, "4516000000.0": 53592079.6, "4517000000.0": 53592234.7, "4518000000.0": 53592389.7, "4519000000.0": 53592544.7, "4520000000.0": 53592699.6, "4521000000.0": 53592854.4, "4522000000.0": 53593009.2, "4523000000.0": 53593163.9, "4524000000.0": 53593318.5, "4525000000.0": 53593473.1, "4526000000.0": 53593627.6, "4527000000.0": 53593782.0, "4528000000.0": 53593936.4, "4529000000.0": 53594090.7, "4530000000.0": 53594244.9, "4531000000.0": 53594399.1, "4532000000.0": 53594553.2, "4533000000.0": 53594707.2, "4534000000.0": 53594861.1, "4535000000.0": 53595015.0, "4536000000.0": 53595168.9, "4537000000.0": 53595322.6, "4538000000.0": 53595476.3, "4539000000.0": 53595629.9, "4540000000.0": 53595783.5, "4541000000.0": 53595937.0, "4542000000.0": 53596090.4, "4543000000.0": 53596243.8, "4544000000.0": 53596397.0, "4545000000.0": 53596550.3, "4546000000.0": 53596703.4, "4547000000.0": 53596856.5, "4548000000.0": 53597009.5, "4549000000.0": 53597162.5, "4550000000.0": 53597315.4, "4551000000.0": 53597468.2, "4552000000.0": 53597621.0, "4553000000.0": 53597773.7, "4554000000.0": 53597926.3, "4555000000.0": 53598078.9, "4556000000.0": 53598231.4, "4557000000.0": 53598383.8, "4558000000.0": 53598536.1, "4559000000.0": 53598688.4, "4560000000.0": 53598840.7, "4561000000.0": 53598992.8, "4562000000.0": 53599144.9, "4563000000.0": 53599297.0, "4564000000.0": 53599448.9, "4565000000.0": 53599600.8, "4566000000.0": 53599752.7, "4567000000.0": 53599904.4, "4568000000.0": 53600056.2, "4569000000.0": 53600207.8, "4570000000.0": 53600359.4, "4571000000.0": 53600510.9, "4572000000.0": 53600662.3, "4573000000.0": 53600813.7, "4574000000.0": 53600965.0, "4575000000.0": 53601116.3, "4576000000.0": 53601267.4, "4577000000.0": 53601418.6, "4578000000.0": 53601569.6, "4579000000.0": 53601720.6, "4580000000.0": 53601871.5, "4581000000.0": 53602022.4, "4582000000.0": 53602173.2, "4583000000.0": 53602323.9, "4584000000.0": 53602474.6, "4585000000.0": 53602625.1, "4586000000.0": 53602775.7, "4587000000.0": 53602926.1, "4588000000.0": 53603076.5, "4589000000.0": 53603226.9, "4590000000.0": 53603377.2, "4591000000.0": 53603527.4, "4592000000.0": 53603677.5, "4593000000.0": 53603827.6, "4594000000.0": 53603977.6, "4595000000.0": 53604127.6, "4596000000.0": 53604277.4, "4597000000.0": 53604427.3, "4598000000.0": 53604577.0, "4599000000.0": 53604726.7, "4600000000.0": 53604876.3, "4601000000.0": 53605025.9, "4602000000.0": 53605175.4, "4603000000.0": 53605324.8, "4604000000.0": 53605474.2, "4605000000.0": 53605623.5, "4606000000.0": 53605772.8, "4607000000.0": 53605922.0, "4608000000.0": 53606071.1, "4609000000.0": 53606220.1, "4610000000.0": 53606369.1, "4611000000.0": 53606518.0, "4612000000.0": 53606666.9, "4613000000.0": 53606815.7, "4614000000.0": 53606964.4, "4615000000.0": 53607113.1, "4616000000.0": 53607261.7, "4617000000.0": 53607410.2, "4618000000.0": 53607558.7, "4619000000.0": 53607707.1, "4620000000.0": 53607855.5, "4621000000.0": 53608003.8, "4622000000.0": 53608152.0, "4623000000.0": 53608300.2, "4624000000.0": 53608448.3, "4625000000.0": 53608596.3, "4626000000.0": 53608744.3, "4627000000.0": 53608892.2, "4628000000.0": 53609040.0, "4629000000.0": 53609187.8, "4630000000.0": 53609335.5, "4631000000.0": 53609483.2, "4632000000.0": 53609630.8, "4633000000.0": 53609778.3, "4634000000.0": 53609925.8, "4635000000.0": 53610073.2, "4636000000.0": 53610220.5, "4637000000.0": 53610367.8, "4638000000.0": 53610515.0, "4639000000.0": 53610662.2, "4640000000.0": 53610809.3, "4641000000.0": 53610956.3, "4642000000.0": 53611103.3, "4643000000.0": 53611250.2, "4644000000.0": 53611397.0, "4645000000.0": 53611543.8, "4646000000.0": 53611690.5, "4647000000.0": 53611837.2, "4648000000.0": 53611983.8, "4649000000.0": 53612130.3, "4650000000.0": 53612276.8, "4651000000.0": 53612423.2, "4652000000.0": 53612569.5, "4653000000.0": 53612715.8, "4654000000.0": 53612862.0, "4655000000.0": 53613008.2, "4656000000.0": 53613154.3, "4657000000.0": 53613300.3, "4658000000.0": 53613446.3, "4659000000.0": 53613592.2, "4660000000.0": 53613738.1, "4661000000.0": 53613883.8, "4662000000.0": 53614029.6, "4663000000.0": 53614175.2, "4664000000.0": 53614320.8, "4665000000.0": 53614466.4, "4666000000.0": 53614611.9, "4667000000.0": 53614757.3, "4668000000.0": 53614902.6, "4669000000.0": 53615047.9, "4670000000.0": 53615193.2, "4671000000.0": 53615338.3, "4672000000.0": 53615483.4, "4673000000.0": 53615628.5, "4674000000.0": 53615773.5, "4675000000.0": 53615918.4, "4676000000.0": 53616063.3, "4677000000.0": 53616208.1, "4678000000.0": 53616352.8, "4679000000.0": 53616497.5, "4680000000.0": 53616642.1, "4681000000.0": 53616786.7, "4682000000.0": 53616931.2, "4683000000.0": 53617075.6, "4684000000.0": 53617220.0, "4685000000.0": 53617364.3, "4686000000.0": 53617508.6, "4687000000.0": 53617652.8, "4688000000.0": 53617796.9, "4689000000.0": 53617941.0, "4690000000.0": 53618085.0, "4691000000.0": 53618228.9, "4692000000.0": 53618372.8, "4693000000.0": 53618516.6, "4694000000.0": 53618660.4, "4695000000.0": 53618804.1, "4696000000.0": 53618947.8, "4697000000.0": 53619091.4, "4698000000.0": 53619234.9, "4699000000.0": 53619378.4, "4700000000.0": 53619521.8, "4701000000.0": 53619665.1, "4702000000.0": 53619808.4, "4703000000.0": 53619951.6, "4704000000.0": 53620094.8, "4705000000.0": 53620237.9, "4706000000.0": 53620381.0, "4707000000.0": 53620523.9, "4708000000.0": 53620666.9, "4709000000.0": 53620809.7, "4710000000.0": 53620952.5, "4711000000.0": 53621095.3, "4712000000.0": 53621238.0, "4713000000.0": 53621380.6, "4714000000.0": 53621523.2, "4715000000.0": 53621665.7, "4716000000.0": 53621808.1, "4717000000.0": 53621950.5, "4718000000.0": 53622092.9, "4719000000.0": 53622235.1, "4720000000.0": 53622377.3, "4721000000.0": 53622519.5, "4722000000.0": 53622661.6, "4723000000.0": 53622803.6, "4724000000.0": 53622945.6, "4725000000.0": 53623087.5, "4726000000.0": 53623229.3, "4727000000.0": 53623371.1, "4728000000.0": 53623512.9, "4729000000.0": 53623654.6, "4730000000.0": 53623796.2, "4731000000.0": 53623937.7, "4732000000.0": 53624079.2, "4733000000.0": 53624220.7, "4734000000.0": 53624362.1, "4735000000.0": 53624503.4, "4736000000.0": 53624644.6, "4737000000.0": 53624785.8, "4738000000.0": 53624927.0, "4739000000.0": 53625068.1, "4740000000.0": 53625209.1, "4741000000.0": 53625350.1, "4742000000.0": 53625491.0, "4743000000.0": 53625631.8, "4744000000.0": 53625772.6, "4745000000.0": 53625913.4, "4746000000.0": 53626054.0, "4747000000.0": 53626194.7, "4748000000.0": 53626335.2, "4749000000.0": 53626475.7, "4750000000.0": 53626616.2, "4751000000.0": 53626756.5, "4752000000.0": 53626896.9, "4753000000.0": 53627037.1, "4754000000.0": 53627177.3, "4755000000.0": 53627317.5, "4756000000.0": 53627457.6, "4757000000.0": 53627597.6, "4758000000.0": 53627737.6, "4759000000.0": 53627877.5, "4760000000.0": 53628017.4, "4761000000.0": 53628157.2, "4762000000.0": 53628296.9, "4763000000.0": 53628436.6, "4764000000.0": 53628576.2, "4765000000.0": 53628715.8, "4766000000.0": 53628855.3, "4767000000.0": 53628994.8, "4768000000.0": 53629134.2, "4769000000.0": 53629273.5, "4770000000.0": 53629412.8, "4771000000.0": 53629552.0, "4772000000.0": 53629691.2, "4773000000.0": 53629830.3, "4774000000.0": 53629969.3, "4775000000.0": 53630108.3, "4776000000.0": 53630247.3, "4777000000.0": 53630386.1, "4778000000.0": 53630525.0, "4779000000.0": 53630663.7, "4780000000.0": 53630802.4, "4781000000.0": 53630941.1, "4782000000.0": 53631079.7, "4783000000.0": 53631218.2, "4784000000.0": 53631356.7, "4785000000.0": 53631495.1, "4786000000.0": 53631633.5, "4787000000.0": 53631771.8, "4788000000.0": 53631910.0, "4789000000.0": 53632048.2, "4790000000.0": 53632186.4, "4791000000.0": 53632324.4, "4792000000.0": 53632462.5, "4793000000.0": 53632600.4, "4794000000.0": 53632738.3, "4795000000.0": 53632876.2, "4796000000.0": 53633014.0, "4797000000.0": 53633151.7, "4798000000.0": 53633289.4, "4799000000.0": 53633427.0, "4800000000.0": 53633564.6, "4801000000.0": 53633702.1, "4802000000.0": 53633839.5, "4803000000.0": 53633976.9, "4804000000.0": 53634114.3, "4805000000.0": 53634251.6, "4806000000.0": 53634388.8, "4807000000.0": 53634526.0, "4808000000.0": 53634663.1, "4809000000.0": 53634800.1, "4810000000.0": 53634937.2, "4811000000.0": 53635074.1, "4812000000.0": 53635211.0, "4813000000.0": 53635347.8, "4814000000.0": 53635484.6, "4815000000.0": 53635621.3, "4816000000.0": 53635758.0, "4817000000.0": 53635894.6, "4818000000.0": 53636031.2, "4819000000.0": 53636167.6, "4820000000.0": 53636304.1, "4821000000.0": 53636440.5, "4822000000.0": 53636576.8, "4823000000.0": 53636713.1, "4824000000.0": 53636849.3, "4825000000.0": 53636985.5, "4826000000.0": 53637121.6, "4827000000.0": 53637257.6, "4828000000.0": 53637393.6, "4829000000.0": 53637529.6, "4830000000.0": 53637665.4, "4831000000.0": 53637801.3, "4832000000.0": 53637937.0, "4833000000.0": 53638072.8, "4834000000.0": 53638208.4, "4835000000.0": 53638344.0, "4836000000.0": 53638479.6, "4837000000.0": 53638615.1, "4838000000.0": 53638750.5, "4839000000.0": 53638885.9, "4840000000.0": 53639021.2, "4841000000.0": 53639156.5, "4842000000.0": 53639291.7, "4843000000.0": 53639426.9, "4844000000.0": 53639562.0, "4845000000.0": 53639697.1, "4846000000.0": 53639832.1, "4847000000.0": 53639967.0, "4848000000.0": 53640101.9, "4849000000.0": 53640236.7, "4850000000.0": 53640371.5, "4851000000.0": 53640506.2, "4852000000.0": 53640640.9, "4853000000.0": 53640775.5, "4854000000.0": 53640910.1, "4855000000.0": 53641044.6, "4856000000.0": 53641179.0, "4857000000.0": 53641313.4, "4858000000.0": 53641447.8, "4859000000.0": 53641582.1, "4860000000.0": 53641716.3, "4861000000.0": 53641850.5, "4862000000.0": 53641984.6, "4863000000.0": 53642118.7, "4864000000.0": 53642252.7, "4865000000.0": 53642386.6, "4866000000.0": 53642520.5, "4867000000.0": 53642654.4, "4868000000.0": 53642788.2, "4869000000.0": 53642921.9, "4870000000.0": 53643055.6, "4871000000.0": 53643189.3, "4872000000.0": 53643322.8, "4873000000.0": 53643456.4, "4874000000.0": 53643589.8, "4875000000.0": 53643723.3, "4876000000.0": 53643856.6, "4877000000.0": 53643989.9, "4878000000.0": 53644123.2, "4879000000.0": 53644256.4, "4880000000.0": 53644389.5, "4881000000.0": 53644522.6, "4882000000.0": 53644655.7, "4883000000.0": 53644788.7, "4884000000.0": 53644921.6, "4885000000.0": 53645054.5, "4886000000.0": 53645187.3, "4887000000.0": 53645320.1, "4888000000.0": 53645452.8, "4889000000.0": 53645585.4, "4890000000.0": 53645718.1, "4891000000.0": 53645850.6, "4892000000.0": 53645983.1, "4893000000.0": 53646115.6, "4894000000.0": 53646248.0, "4895000000.0": 53646380.3, "4896000000.0": 53646512.6, "4897000000.0": 53646644.8, "4898000000.0": 53646777.0, "4899000000.0": 53646909.1, "4900000000.0": 53647041.2, "4901000000.0": 53647173.2, "4902000000.0": 53647305.2, "4903000000.0": 53647437.1, "4904000000.0": 53647569.0, "4905000000.0": 53647700.8, "4906000000.0": 53647832.6, "4907000000.0": 53647964.3, "4908000000.0": 53648095.9, "4909000000.0": 53648227.5, "4910000000.0": 53648359.1, "4911000000.0": 53648490.6, "4912000000.0": 53648622.0, "4913000000.0": 53648753.4, "4914000000.0": 53648884.7, "4915000000.0": 53649016.0, "4916000000.0": 53649147.2, "4917000000.0": 53649278.4, "4918000000.0": 53649409.5, "4919000000.0": 53649540.6, "4920000000.0": 53649671.6, "4921000000.0": 53649802.6, "4922000000.0": 53649933.5, "4923000000.0": 53650064.3, "4924000000.0": 53650195.2, "4925000000.0": 53650325.9, "4926000000.0": 53650456.6, "4927000000.0": 53650587.3, "4928000000.0": 53650717.9, "4929000000.0": 53650848.4, "4930000000.0": 53650978.9, "4931000000.0": 53651109.3, "4932000000.0": 53651239.7, "4933000000.0": 53651370.1, "4934000000.0": 53651500.3, "4935000000.0": 53651630.6, "4936000000.0": 53651760.8, "4937000000.0": 53651890.9, "4938000000.0": 53652021.0, "4939000000.0": 53652151.0, "4940000000.0": 53652281.0, "4941000000.0": 53652410.9, "4942000000.0": 53652540.7, "4943000000.0": 53652670.6, "4944000000.0": 53652800.3, "4945000000.0": 53652930.0, "4946000000.0": 53653059.7, "4947000000.0": 53653189.3, "4948000000.0": 53653318.9, "4949000000.0": 53653448.4, "4950000000.0": 53653577.8, "4951000000.0": 53653707.2, "4952000000.0": 53653836.6, "4953000000.0": 53653965.9, "4954000000.0": 53654095.1, "4955000000.0": 53654224.3, "4956000000.0": 53654353.5, "4957000000.0": 53654482.5, "4958000000.0": 53654611.6, "4959000000.0": 53654740.6, "4960000000.0": 53654869.5, "4961000000.0": 53654998.4, "4962000000.0": 53655127.2, "4963000000.0": 53655256.0, "4964000000.0": 53655384.8, "4965000000.0": 53655513.4, "4966000000.0": 53655642.1, "4967000000.0": 53655770.6, "4968000000.0": 53655899.2, "4969000000.0": 53656027.6, "4970000000.0": 53656156.1, "4971000000.0": 53656284.4, "4972000000.0": 53656412.8, "4973000000.0": 53656541.0, "4974000000.0": 53656669.3, "4975000000.0": 53656797.4, "4976000000.0": 53656925.6, "4977000000.0": 53657053.6, "4978000000.0": 53657181.6, "4979000000.0": 53657309.6, "4980000000.0": 53657437.5, "4981000000.0": 53657565.4, "4982000000.0": 53657693.2, "4983000000.0": 53657821.0, "4984000000.0": 53657948.7, "4985000000.0": 53658076.4, "4986000000.0": 53658204.0, "4987000000.0": 53658331.5, "4988000000.0": 53658459.0, "4989000000.0": 53658586.5, "4990000000.0": 53658713.9, "4991000000.0": 53658841.3, "4992000000.0": 53658968.6, "4993000000.0": 53659095.8, "4994000000.0": 53659223.0, "4995000000.0": 53659350.2, "4996000000.0": 53659477.3, "4997000000.0": 53659604.4, "4998000000.0": 53659731.4, "4999000000.0": 53659858.3, "5000000000.0": 53659985.2, "5001000000.0": 53660112.1, "5002000000.0": 53660238.9, "5003000000.0": 53660365.7, "5004000000.0": 53660492.4, "5005000000.0": 53660619.0, "5006000000.0": 53660745.6, "5007000000.0": 53660872.2, "5008000000.0": 53660998.7, "5009000000.0": 53661125.2, "5010000000.0": 53661251.6, "5011000000.0": 53661377.9, "5012000000.0": 53661504.2, "5013000000.0": 53661630.5, "5014000000.0": 53661756.7, "5015000000.0": 53661882.9, "5016000000.0": 53662009.0, "5017000000.0": 53662135.0, "5018000000.0": 53662261.0, "5019000000.0": 53662387.0, "5020000000.0": 53662512.9, "5021000000.0": 53662638.8, "5022000000.0": 53662764.6, "5023000000.0": 53662890.3, "5024000000.0": 53663016.1, "5025000000.0": 53663141.7, "5026000000.0": 53663267.3, "5027000000.0": 53663392.9, "5028000000.0": 53663518.4, "5029000000.0": 53663643.9, "5030000000.0": 53663769.3, "5031000000.0": 53663894.7, "5032000000.0": 53664020.0, "5033000000.0": 53664145.2, "5034000000.0": 53664270.5, "5035000000.0": 53664395.6, "5036000000.0": 53664520.8, "5037000000.0": 53664645.8, "5038000000.0": 53664770.8, "5039000000.0": 53664895.8, "5040000000.0": 53665020.7, "5041000000.0": 53665145.6, "5042000000.0": 53665270.4, "5043000000.0": 53665395.2, "5044000000.0": 53665520.0, "5045000000.0": 53665644.6, "5046000000.0": 53665769.3, "5047000000.0": 53665893.8, "5048000000.0": 53666018.4, "5049000000.0": 53666142.9, "5050000000.0": 53666267.3, "5051000000.0": 53666391.7, "5052000000.0": 53666516.0, "5053000000.0": 53666640.3, "5054000000.0": 53666764.6, "5055000000.0": 53666888.8, "5056000000.0": 53667012.9, "5057000000.0": 53667137.0, "5058000000.0": 53667261.0, "5059000000.0": 53667385.0, "5060000000.0": 53667509.0, "5061000000.0": 53667632.9, "5062000000.0": 53667756.7, "5063000000.0": 53667880.6, "5064000000.0": 53668004.3, "5065000000.0": 53668128.0, "5066000000.0": 53668251.7, "5067000000.0": 53668375.3, "5068000000.0": 53668498.9, "5069000000.0": 53668622.4, "5070000000.0": 53668745.8, "5071000000.0": 53668869.3, "5072000000.0": 53668992.6, "5073000000.0": 53669116.0, "5074000000.0": 53669239.2, "5075000000.0": 53669362.5, "5076000000.0": 53669485.6, "5077000000.0": 53669608.8, "5078000000.0": 53669731.9, "5079000000.0": 53669854.9, "5080000000.0": 53669977.9, "5081000000.0": 53670100.8, "5082000000.0": 53670223.7, "5083000000.0": 53670346.6, "5084000000.0": 53670469.4, "5085000000.0": 53670592.1, "5086000000.0": 53670714.8, "5087000000.0": 53670837.5, "5088000000.0": 53670960.1, "5089000000.0": 53671082.6, "5090000000.0": 53671205.1, "5091000000.0": 53671327.6, "5092000000.0": 53671450.0, "5093000000.0": 53671572.4, "5094000000.0": 53671694.7, "5095000000.0": 53671817.0, "5096000000.0": 53671939.2, "5097000000.0": 53672061.4, "5098000000.0": 53672183.5, "5099000000.0": 53672305.6, "5100000000.0": 53672427.6, "5101000000.0": 53672549.6, "5102000000.0": 53672671.6, "5103000000.0": 53672793.5, "5104000000.0": 53672915.3, "5105000000.0": 53673037.1, "5106000000.0": 53673158.9, "5107000000.0": 53673280.6, "5108000000.0": 53673402.2, "5109000000.0": 53673523.8, "5110000000.0": 53673645.4, "5111000000.0": 53673766.9, "5112000000.0": 53673888.4, "5113000000.0": 53674009.8, "5114000000.0": 53674131.2, "5115000000.0": 53674252.5, "5116000000.0": 53674373.8, "5117000000.0": 53674495.0, "5118000000.0": 53674616.2, "5119000000.0": 53674737.4, "5120000000.0": 53674858.5, "5121000000.0": 53674979.5, "5122000000.0": 53675100.5, "5123000000.0": 53675221.5, "5124000000.0": 53675342.4, "5125000000.0": 53675463.2, "5126000000.0": 53675584.1, "5127000000.0": 53675704.8, "5128000000.0": 53675825.5, "5129000000.0": 53675946.2, "5130000000.0": 53676066.9, "5131000000.0": 53676187.4, "5132000000.0": 53676308.0, "5133000000.0": 53676428.5, "5134000000.0": 53676548.9, "5135000000.0": 53676669.3, "5136000000.0": 53676789.7, "5137000000.0": 53676910.0, "5138000000.0": 53677030.2, "5139000000.0": 53677150.4, "5140000000.0": 53677270.6, "5141000000.0": 53677390.7, "5142000000.0": 53677510.8, "5143000000.0": 53677630.8, "5144000000.0": 53677750.8, "5145000000.0": 53677870.7, "5146000000.0": 53677990.6, "5147000000.0": 53678110.5, "5148000000.0": 53678230.3, "5149000000.0": 53678350.0, "5150000000.0": 53678469.7, "5151000000.0": 53678589.4, "5152000000.0": 53678709.0, "5153000000.0": 53678828.6, "5154000000.0": 53678948.1, "5155000000.0": 53679067.6, "5156000000.0": 53679187.0, "5157000000.0": 53679306.4, "5158000000.0": 53679425.7, "5159000000.0": 53679545.0, "5160000000.0": 53679664.3, "5161000000.0": 53679783.5, "5162000000.0": 53679902.6, "5163000000.0": 53680021.7, "5164000000.0": 53680140.8, "5165000000.0": 53680259.8, "5166000000.0": 53680378.8, "5167000000.0": 53680497.7, "5168000000.0": 53680616.6, "5169000000.0": 53680735.4, "5170000000.0": 53680854.2, "5171000000.0": 53680973.0, "5172000000.0": 53681091.7, "5173000000.0": 53681210.3, "5174000000.0": 53681328.9, "5175000000.0": 53681447.5, "5176000000.0": 53681566.0, "5177000000.0": 53681684.5, "5178000000.0": 53681802.9, "5179000000.0": 53681921.3, "5180000000.0": 53682039.6, "5181000000.0": 53682157.9, "5182000000.0": 53682276.2, "5183000000.0": 53682394.4, "5184000000.0": 53682512.5, "5185000000.0": 53682630.7, "5186000000.0": 53682748.7, "5187000000.0": 53682866.7, "5188000000.0": 53682984.7, "5189000000.0": 53683102.7, "5190000000.0": 53683220.5, "5191000000.0": 53683338.4, "5192000000.0": 53683456.2, "5193000000.0": 53683573.9, "5194000000.0": 53683691.7, "5195000000.0": 53683809.3, "5196000000.0": 53683926.9, "5197000000.0": 53684044.5, "5198000000.0": 53684162.0, "5199000000.0": 53684279.5, "5200000000.0": 53684397.0, "5201000000.0": 53684514.4, "5202000000.0": 53684631.7, "5203000000.0": 53684749.0, "5204000000.0": 53684866.3, "5205000000.0": 53684983.5, "5206000000.0": 53685100.7, "5207000000.0": 53685217.8, "5208000000.0": 53685334.9, "5209000000.0": 53685451.9, "5210000000.0": 53685568.9, "5211000000.0": 53685685.9, "5212000000.0": 53685802.8, "5213000000.0": 53685919.6, "5214000000.0": 53686036.5, "5215000000.0": 53686153.2, "5216000000.0": 53686270.0, "5217000000.0": 53686386.6, "5218000000.0": 53686503.3, "5219000000.0": 53686619.9, "5220000000.0": 53686736.4, "5221000000.0": 53686852.9, "5222000000.0": 53686969.4, "5223000000.0": 53687085.8, "5224000000.0": 53687202.2, "5225000000.0": 53687318.5, "5226000000.0": 53687434.8, "5227000000.0": 53687551.1, "5228000000.0": 53687667.3, "5229000000.0": 53687783.4, "5230000000.0": 53687899.5, "5231000000.0": 53688015.6, "5232000000.0": 53688131.6, "5233000000.0": 53688247.6, "5234000000.0": 53688363.5, "5235000000.0": 53688479.4, "5236000000.0": 53688595.3, "5237000000.0": 53688711.1, "5238000000.0": 53688826.9, "5239000000.0": 53688942.6, "5240000000.0": 53689058.2, "5241000000.0": 53689173.9, "5242000000.0": 53689289.5, "5243000000.0": 53689405.0, "5244000000.0": 53689520.5, "5245000000.0": 53689636.0, "5246000000.0": 53689751.4, "5247000000.0": 53689866.7, "5248000000.0": 53689982.1, "5249000000.0": 53690097.4, "5250000000.0": 53690212.6, "5251000000.0": 53690327.8, "5252000000.0": 53690442.9, "5253000000.0": 53690558.1, "5254000000.0": 53690673.1, "5255000000.0": 53690788.1, "5256000000.0": 53690903.1, "5257000000.0": 53691018.1, "5258000000.0": 53691133.0, "5259000000.0": 53691247.8, "5260000000.0": 53691362.6, "5261000000.0": 53691477.4, "5262000000.0": 53691592.1, "5263000000.0": 53691706.8, "5264000000.0": 53691821.4, "5265000000.0": 53691936.0, "5266000000.0": 53692050.5, "5267000000.0": 53692165.0, "5268000000.0": 53692279.5, "5269000000.0": 53692393.9, "5270000000.0": 53692508.3, "5271000000.0": 53692622.6, "5272000000.0": 53692736.9, "5273000000.0": 53692851.2, "5274000000.0": 53692965.4, "5275000000.0": 53693079.5, "5276000000.0": 53693193.7, "5277000000.0": 53693307.7, "5278000000.0": 53693421.8, "5279000000.0": 53693535.8, "5280000000.0": 53693649.7, "5281000000.0": 53693763.6, "5282000000.0": 53693877.5, "5283000000.0": 53693991.3, "5284000000.0": 53694105.1, "5285000000.0": 53694218.8, "5286000000.0": 53694332.5, "5287000000.0": 53694446.1, "5288000000.0": 53694559.8, "5289000000.0": 53694673.3, "5290000000.0": 53694786.8, "5291000000.0": 53694900.3, "5292000000.0": 53695013.8, "5293000000.0": 53695127.2, "5294000000.0": 53695240.5, "5295000000.0": 53695353.8, "5296000000.0": 53695467.1, "5297000000.0": 53695580.3, "5298000000.0": 53695693.5, "5299000000.0": 53695806.6, "5300000000.0": 53695919.7, "5301000000.0": 53696032.8, "5302000000.0": 53696145.8, "5303000000.0": 53696258.8, "5304000000.0": 53696371.7, "5305000000.0": 53696484.6, "5306000000.0": 53696597.4, "5307000000.0": 53696710.3, "5308000000.0": 53696823.0, "5309000000.0": 53696935.7, "5310000000.0": 53697048.4, "5311000000.0": 53697161.1, "5312000000.0": 53697273.6, "5313000000.0": 53697386.2, "5314000000.0": 53697498.7, "5315000000.0": 53697611.2, "5316000000.0": 53697723.6, "5317000000.0": 53697836.0, "5318000000.0": 53697948.3, "5319000000.0": 53698060.6, "5320000000.0": 53698172.9, "5321000000.0": 53698285.1, "5322000000.0": 53698397.3, "5323000000.0": 53698509.4, "5324000000.0": 53698621.5, "5325000000.0": 53698733.6, "5326000000.0": 53698845.6, "5327000000.0": 53698957.5, "5328000000.0": 53699069.5, "5329000000.0": 53699181.4, "5330000000.0": 53699293.2, "5331000000.0": 53699405.0, "5332000000.0": 53699516.8, "5333000000.0": 53699628.5, "5334000000.0": 53699740.2, "5335000000.0": 53699851.8, "5336000000.0": 53699963.4, "5337000000.0": 53700075.0, "5338000000.0": 53700186.5, "5339000000.0": 53700297.9, "5340000000.0": 53700409.4, "5341000000.0": 53700520.8, "5342000000.0": 53700632.1, "5343000000.0": 53700743.4, "5344000000.0": 53700854.7, "5345000000.0": 53700965.9, "5346000000.0": 53701077.1, "5347000000.0": 53701188.2, "5348000000.0": 53701299.3, "5349000000.0": 53701410.4, "5350000000.0": 53701521.4, "5351000000.0": 53701632.4, "5352000000.0": 53701743.3, "5353000000.0": 53701854.2, "5354000000.0": 53701965.1, "5355000000.0": 53702075.9, "5356000000.0": 53702186.6, "5357000000.0": 53702297.4, "5358000000.0": 53702408.1, "5359000000.0": 53702518.7, "5360000000.0": 53702629.3, "5361000000.0": 53702739.9, "5362000000.0": 53702850.4, "5363000000.0": 53702960.9, "5364000000.0": 53703071.4, "5365000000.0": 53703181.8, "5366000000.0": 53703292.1, "5367000000.0": 53703402.5, "5368000000.0": 53703512.7, "5369000000.0": 53703623.0, "5370000000.0": 53703733.2, "5371000000.0": 53703843.3, "5372000000.0": 53703953.5, "5373000000.0": 53704063.5, "5374000000.0": 53704173.6, "5375000000.0": 53704283.6, "5376000000.0": 53704393.5, "5377000000.0": 53704503.5, "5378000000.0": 53704613.3, "5379000000.0": 53704723.2, "5380000000.0": 53704833.0, "5381000000.0": 53704942.7, "5382000000.0": 53705052.4, "5383000000.0": 53705162.1, "5384000000.0": 53705271.8, "5385000000.0": 53705381.4, "5386000000.0": 53705490.9, "5387000000.0": 53705600.4, "5388000000.0": 53705709.9, "5389000000.0": 53705819.3, "5390000000.0": 53705928.7, "5391000000.0": 53706038.1, "5392000000.0": 53706147.4, "5393000000.0": 53706256.7, "5394000000.0": 53706365.9, "5395000000.0": 53706475.1, "5396000000.0": 53706584.3, "5397000000.0": 53706693.4, "5398000000.0": 53706802.4, "5399000000.0": 53706911.5, "5400000000.0": 53707020.5, "5401000000.0": 53707129.4, "5402000000.0": 53707238.3, "5403000000.0": 53707347.2, "5404000000.0": 53707456.1, "5405000000.0": 53707564.9, "5406000000.0": 53707673.6, "5407000000.0": 53707782.3, "5408000000.0": 53707891.0, "5409000000.0": 53707999.6, "5410000000.0": 53708108.2, "5411000000.0": 53708216.8, "5412000000.0": 53708325.3, "5413000000.0": 53708433.8, "5414000000.0": 53708542.2, "5415000000.0": 53708650.6, "5416000000.0": 53708759.0, "5417000000.0": 53708867.3, "5418000000.0": 53708975.6, "5419000000.0": 53709083.8, "5420000000.0": 53709192.0, "5421000000.0": 53709300.2, "5422000000.0": 53709408.3, "5423000000.0": 53709516.4, "5424000000.0": 53709624.4, "5425000000.0": 53709732.4, "5426000000.0": 53709840.4, "5427000000.0": 53709948.3, "5428000000.0": 53710056.2, "5429000000.0": 53710164.0, "5430000000.0": 53710271.9, "5431000000.0": 53710379.6, "5432000000.0": 53710487.3, "5433000000.0": 53710595.0, "5434000000.0": 53710702.7, "5435000000.0": 53710810.3, "5436000000.0": 53710917.9, "5437000000.0": 53711025.4, "5438000000.0": 53711132.9, "5439000000.0": 53711240.3, "5440000000.0": 53711347.8, "5441000000.0": 53711455.1, "5442000000.0": 53711562.5, "5443000000.0": 53711669.8, "5444000000.0": 53711777.0, "5445000000.0": 53711884.2, "5446000000.0": 53711991.4, "5447000000.0": 53712098.6, "5448000000.0": 53712205.7, "5449000000.0": 53712312.7, "5450000000.0": 53712419.8, "5451000000.0": 53712526.8, "5452000000.0": 53712633.7, "5453000000.0": 53712740.6, "5454000000.0": 53712847.5, "5455000000.0": 53712954.3, "5456000000.0": 53713061.1, "5457000000.0": 53713167.9, "5458000000.0": 53713274.6, "5459000000.0": 53713381.2, "5460000000.0": 53713487.9, "5461000000.0": 53713594.5, "5462000000.0": 53713701.0, "5463000000.0": 53713807.6, "5464000000.0": 53713914.1, "5465000000.0": 53714020.5, "5466000000.0": 53714126.9, "5467000000.0": 53714233.3, "5468000000.0": 53714339.6, "5469000000.0": 53714445.9, "5470000000.0": 53714552.1, "5471000000.0": 53714658.4, "5472000000.0": 53714764.5, "5473000000.0": 53714870.7, "5474000000.0": 53714976.8, "5475000000.0": 53715082.8, "5476000000.0": 53715188.9, "5477000000.0": 53715294.8, "5478000000.0": 53715400.8, "5479000000.0": 53715506.7, "5480000000.0": 53715612.6, "5481000000.0": 53715718.4, "5482000000.0": 53715824.2, "5483000000.0": 53715929.9, "5484000000.0": 53716035.7, "5485000000.0": 53716141.3, "5486000000.0": 53716247.0, "5487000000.0": 53716352.6, "5488000000.0": 53716458.1, "5489000000.0": 53716563.7, "5490000000.0": 53716669.2, "5491000000.0": 53716774.6, "5492000000.0": 53716880.0, "5493000000.0": 53716985.4, "5494000000.0": 53717090.7, "5495000000.0": 53717196.0, "5496000000.0": 53717301.3, "5497000000.0": 53717406.5, "5498000000.0": 53717511.7, "5499000000.0": 53717616.8, "5500000000.0": 53717722.0, "5501000000.0": 53717827.0, "5502000000.0": 53717932.1, "5503000000.0": 53718037.1, "5504000000.0": 53718142.0, "5505000000.0": 53718246.9, "5506000000.0": 53718351.8, "5507000000.0": 53718456.7, "5508000000.0": 53718561.5, "5509000000.0": 53718666.2, "5510000000.0": 53718771.0, "5511000000.0": 53718875.7, "5512000000.0": 53718980.3, "5513000000.0": 53719084.9, "5514000000.0": 53719189.5, "5515000000.0": 53719294.1, "5516000000.0": 53719398.6, "5517000000.0": 53719503.0, "5518000000.0": 53719607.5, "5519000000.0": 53719711.9, "5520000000.0": 53719816.2, "5521000000.0": 53719920.5, "5522000000.0": 53720024.8, "5523000000.0": 53720129.1, "5524000000.0": 53720233.3, "5525000000.0": 53720337.4, "5526000000.0": 53720441.6, "5527000000.0": 53720545.7, "5528000000.0": 53720649.7, "5529000000.0": 53720753.8, "5530000000.0": 53720857.7, "5531000000.0": 53720961.7, "5532000000.0": 53721065.6, "5533000000.0": 53721169.5, "5534000000.0": 53721273.3, "5535000000.0": 53721377.1, "5536000000.0": 53721480.9, "5537000000.0": 53721584.6, "5538000000.0": 53721688.3, "5539000000.0": 53721791.9, "5540000000.0": 53721895.5, "5541000000.0": 53721999.1, "5542000000.0": 53722102.7, "5543000000.0": 53722206.2, "5544000000.0": 53722309.6, "5545000000.0": 53722413.1, "5546000000.0": 53722516.4, "5547000000.0": 53722619.8, "5548000000.0": 53722723.1, "5549000000.0": 53722826.4, "5550000000.0": 53722929.6, "5551000000.0": 53723032.8, "5552000000.0": 53723136.0, "5553000000.0": 53723239.1, "5554000000.0": 53723342.2, "5555000000.0": 53723445.3, "5556000000.0": 53723548.3, "5557000000.0": 53723651.3, "5558000000.0": 53723754.3, "5559000000.0": 53723857.2, "5560000000.0": 53723960.1, "5561000000.0": 53724062.9, "5562000000.0": 53724165.7, "5563000000.0": 53724268.5, "5564000000.0": 53724371.2, "5565000000.0": 53724473.9, "5566000000.0": 53724576.5, "5567000000.0": 53724679.2, "5568000000.0": 53724781.8, "5569000000.0": 53724884.3, "5570000000.0": 53724986.8, "5571000000.0": 53725089.3, "5572000000.0": 53725191.7, "5573000000.0": 53725294.1, "5574000000.0": 53725396.5, "5575000000.0": 53725498.8, "5576000000.0": 53725601.1, "5577000000.0": 53725703.4, "5578000000.0": 53725805.6, "5579000000.0": 53725907.8, "5580000000.0": 53726009.9, "5581000000.0": 53726112.0, "5582000000.0": 53726214.1, "5583000000.0": 53726316.2, "5584000000.0": 53726418.2, "5585000000.0": 53726520.1, "5586000000.0": 53726622.1, "5587000000.0": 53726724.0, "5588000000.0": 53726825.8, "5589000000.0": 53726927.6, "5590000000.0": 53727029.4, "5591000000.0": 53727131.2, "5592000000.0": 53727232.9, "5593000000.0": 53727334.6, "5594000000.0": 53727436.2, "5595000000.0": 53727537.8, "5596000000.0": 53727639.4, "5597000000.0": 53727740.9, "5598000000.0": 53727842.4, "5599000000.0": 53727943.9, "5600000000.0": 53728045.3, "5601000000.0": 53728146.7, "5602000000.0": 53728248.1, "5603000000.0": 53728349.4, "5604000000.0": 53728450.7, "5605000000.0": 53728551.9, "5606000000.0": 53728653.1, "5607000000.0": 53728754.3, "5608000000.0": 53728855.5, "5609000000.0": 53728956.6, "5610000000.0": 53729057.6, "5611000000.0": 53729158.7, "5612000000.0": 53729259.7, "5613000000.0": 53729360.6, "5614000000.0": 53729461.6, "5615000000.0": 53729562.5, "5616000000.0": 53729663.3, "5617000000.0": 53729764.1, "5618000000.0": 53729864.9, "5619000000.0": 53729965.7, "5620000000.0": 53730066.4, "5621000000.0": 53730167.1, "5622000000.0": 53730267.7, "5623000000.0": 53730368.3, "5624000000.0": 53730468.9, "5625000000.0": 53730569.4, "5626000000.0": 53730669.9, "5627000000.0": 53730770.4, "5628000000.0": 53730870.8, "5629000000.0": 53730971.2, "5630000000.0": 53731071.6, "5631000000.0": 53731171.9, "5632000000.0": 53731272.2, "5633000000.0": 53731372.5, "5634000000.0": 53731472.7, "5635000000.0": 53731572.9, "5636000000.0": 53731673.0, "5637000000.0": 53731773.1, "5638000000.0": 53731873.2, "5639000000.0": 53731973.3, "5640000000.0": 53732073.3, "5641000000.0": 53732173.2, "5642000000.0": 53732273.2, "5643000000.0": 53732373.1, "5644000000.0": 53732472.9, "5645000000.0": 53732572.8, "5646000000.0": 53732672.6, "5647000000.0": 53732772.3, "5648000000.0": 53732872.1, "5649000000.0": 53732971.8, "5650000000.0": 53733071.4, "5651000000.0": 53733171.1, "5652000000.0": 53733270.6, "5653000000.0": 53733370.2, "5654000000.0": 53733469.7, "5655000000.0": 53733569.2, "5656000000.0": 53733668.7, "5657000000.0": 53733768.1, "5658000000.0": 53733867.4, "5659000000.0": 53733966.8, "5660000000.0": 53734066.1, "5661000000.0": 53734165.4, "5662000000.0": 53734264.6, "5663000000.0": 53734363.8, "5664000000.0": 53734463.0, "5665000000.0": 53734562.1, "5666000000.0": 53734661.2, "5667000000.0": 53734760.3, "5668000000.0": 53734859.3, "5669000000.0": 53734958.3, "5670000000.0": 53735057.3, "5671000000.0": 53735156.2, "5672000000.0": 53735255.1, "5673000000.0": 53735354.0, "5674000000.0": 53735452.8, "5675000000.0": 53735551.6, "5676000000.0": 53735650.4, "5677000000.0": 53735749.1, "5678000000.0": 53735847.8, "5679000000.0": 53735946.4, "5680000000.0": 53736045.1, "5681000000.0": 53736143.7, "5682000000.0": 53736242.2, "5683000000.0": 53736340.7, "5684000000.0": 53736439.2, "5685000000.0": 53736537.7, "5686000000.0": 53736636.1, "5687000000.0": 53736734.4, "5688000000.0": 53736832.8, "5689000000.0": 53736931.1, "5690000000.0": 53737029.4, "5691000000.0": 53737127.6, "5692000000.0": 53737225.8, "5693000000.0": 53737324.0, "5694000000.0": 53737422.2, "5695000000.0": 53737520.3, "5696000000.0": 53737618.3, "5697000000.0": 53737716.4, "5698000000.0": 53737814.4, "5699000000.0": 53737912.3, "5700000000.0": 53738010.3, "5701000000.0": 53738108.2, "5702000000.0": 53738206.1, "5703000000.0": 53738303.9, "5704000000.0": 53738401.7, "5705000000.0": 53738499.5, "5706000000.0": 53738597.2, "5707000000.0": 53738694.9, "5708000000.0": 53738792.6, "5709000000.0": 53738890.2, "5710000000.0": 53738987.8, "5711000000.0": 53739085.3, "5712000000.0": 53739182.9, "5713000000.0": 53739280.4, "5714000000.0": 53739377.8, "5715000000.0": 53739475.3, "5716000000.0": 53739572.7, "5717000000.0": 53739670.0, "5718000000.0": 53739767.3, "5719000000.0": 53739864.6, "5720000000.0": 53739961.9, "5721000000.0": 53740059.1, "5722000000.0": 53740156.3, "5723000000.0": 53740253.5, "5724000000.0": 53740350.6, "5725000000.0": 53740447.7, "5726000000.0": 53740544.8, "5727000000.0": 53740641.8, "5728000000.0": 53740738.8, "5729000000.0": 53740835.7, "5730000000.0": 53740932.7, "5731000000.0": 53741029.5, "5732000000.0": 53741126.4, "5733000000.0": 53741223.2, "5734000000.0": 53741320.0, "5735000000.0": 53741416.8, "5736000000.0": 53741513.5, "5737000000.0": 53741610.2, "5738000000.0": 53741706.8, "5739000000.0": 53741803.5, "5740000000.0": 53741900.1, "5741000000.0": 53741996.6, "5742000000.0": 53742093.1, "5743000000.0": 53742189.6, "5744000000.0": 53742286.1, "5745000000.0": 53742382.5, "5746000000.0": 53742478.9, "5747000000.0": 53742575.3, "5748000000.0": 53742671.6, "5749000000.0": 53742767.9, "5750000000.0": 53742864.1, "5751000000.0": 53742960.4, "5752000000.0": 53743056.6, "5753000000.0": 53743152.7, "5754000000.0": 53743248.8, "5755000000.0": 53743344.9, "5756000000.0": 53743441.0, "5757000000.0": 53743537.0, "5758000000.0": 53743633.0, "5759000000.0": 53743729.0, "5760000000.0": 53743824.9, "5761000000.0": 53743920.8, "5762000000.0": 53744016.7, "5763000000.0": 53744112.5, "5764000000.0": 53744208.3, "5765000000.0": 53744304.0, "5766000000.0": 53744399.8, "5767000000.0": 53744495.5, "5768000000.0": 53744591.1, "5769000000.0": 53744686.8, "5770000000.0": 53744782.4, "5771000000.0": 53744877.9, "5772000000.0": 53744973.5, "5773000000.0": 53745069.0, "5774000000.0": 53745164.4, "5775000000.0": 53745259.9, "5776000000.0": 53745355.3, "5777000000.0": 53745450.6, "5778000000.0": 53745546.0, "5779000000.0": 53745641.3, "5780000000.0": 53745736.6, "5781000000.0": 53745831.8, "5782000000.0": 53745927.0, "5783000000.0": 53746022.2, "5784000000.0": 53746117.3, "5785000000.0": 53746212.4, "5786000000.0": 53746307.5, "5787000000.0": 53746402.6, "5788000000.0": 53746497.6, "5789000000.0": 53746592.5, "5790000000.0": 53746687.5, "5791000000.0": 53746782.4, "5792000000.0": 53746877.3, "5793000000.0": 53746972.1, "5794000000.0": 53747067.0, "5795000000.0": 53747161.7, "5796000000.0": 53747256.5, "5797000000.0": 53747351.2, "5798000000.0": 53747445.9, "5799000000.0": 53747540.6, "5800000000.0": 53747635.2, "5801000000.0": 53747729.8, "5802000000.0": 53747824.3, "5803000000.0": 53747918.8, "5804000000.0": 53748013.3, "5805000000.0": 53748107.8, "5806000000.0": 53748202.2, "5807000000.0": 53748296.6, "5808000000.0": 53748391.0, "5809000000.0": 53748485.3, "5810000000.0": 53748579.6, "5811000000.0": 53748673.9, "5812000000.0": 53748768.1, "5813000000.0": 53748862.3, "5814000000.0": 53748956.5, "5815000000.0": 53749050.7, "5816000000.0": 53749144.8, "5817000000.0": 53749238.8, "5818000000.0": 53749332.9, "5819000000.0": 53749426.9, "5820000000.0": 53749520.9, "5821000000.0": 53749614.8, "5822000000.0": 53749708.7, "5823000000.0": 53749802.6, "5824000000.0": 53749896.5, "5825000000.0": 53749990.3, "5826000000.0": 53750084.1, "5827000000.0": 53750177.8, "5828000000.0": 53750271.6, "5829000000.0": 53750365.3, "5830000000.0": 53750458.9, "5831000000.0": 53750552.5, "5832000000.0": 53750646.1, "5833000000.0": 53750739.7, "5834000000.0": 53750833.2, "5835000000.0": 53750926.7, "5836000000.0": 53751020.2, "5837000000.0": 53751113.7, "5838000000.0": 53751207.1, "5839000000.0": 53751300.4, "5840000000.0": 53751393.8, "5841000000.0": 53751487.1, "5842000000.0": 53751580.4, "5843000000.0": 53751673.6, "5844000000.0": 53751766.8, "5845000000.0": 53751860.0, "5846000000.0": 53751953.2, "5847000000.0": 53752046.3, "5848000000.0": 53752139.4, "5849000000.0": 53752232.5, "5850000000.0": 53752325.5, "5851000000.0": 53752418.5, "5852000000.0": 53752511.5, "5853000000.0": 53752604.4, "5854000000.0": 53752697.3, "5855000000.0": 53752790.2, "5856000000.0": 53752883.0, "5857000000.0": 53752975.8, "5858000000.0": 53753068.6, "5859000000.0": 53753161.3, "5860000000.0": 53753254.0, "5861000000.0": 53753346.7, "5862000000.0": 53753439.4, "5863000000.0": 53753532.0, "5864000000.0": 53753624.6, "5865000000.0": 53753717.2, "5866000000.0": 53753809.7, "5867000000.0": 53753902.2, "5868000000.0": 53753994.6, "5869000000.0": 53754087.1, "5870000000.0": 53754179.5, "5871000000.0": 53754271.8, "5872000000.0": 53754364.2, "5873000000.0": 53754456.5, "5874000000.0": 53754548.8, "5875000000.0": 53754641.0, "5876000000.0": 53754733.2, "5877000000.0": 53754825.4, "5878000000.0": 53754917.6, "5879000000.0": 53755009.7, "5880000000.0": 53755101.8, "5881000000.0": 53755193.8, "5882000000.0": 53755285.9, "5883000000.0": 53755377.9, "5884000000.0": 53755469.8, "5885000000.0": 53755561.8, "5886000000.0": 53755653.7, "5887000000.0": 53755745.6, "5888000000.0": 53755837.4, "5889000000.0": 53755929.2, "5890000000.0": 53756021.0, "5891000000.0": 53756112.7, "5892000000.0": 53756204.5, "5893000000.0": 53756296.2, "5894000000.0": 53756387.8, "5895000000.0": 53756479.4, "5896000000.0": 53756571.0, "5897000000.0": 53756662.6, "5898000000.0": 53756754.1, "5899000000.0": 53756845.6, "5900000000.0": 53756937.1, "5901000000.0": 53757028.6, "5902000000.0": 53757120.0, "5903000000.0": 53757211.4, "5904000000.0": 53757302.7, "5905000000.0": 53757394.0, "5906000000.0": 53757485.3, "5907000000.0": 53757576.6, "5908000000.0": 53757667.8, "5909000000.0": 53757759.0, "5910000000.0": 53757850.2, "5911000000.0": 53757941.3, "5912000000.0": 53758032.4, "5913000000.0": 53758123.5, "5914000000.0": 53758214.5, "5915000000.0": 53758305.6, "5916000000.0": 53758396.5, "5917000000.0": 53758487.5, "5918000000.0": 53758578.4, "5919000000.0": 53758669.3, "5920000000.0": 53758760.2, "5921000000.0": 53758851.0, "5922000000.0": 53758941.8, "5923000000.0": 53759032.6, "5924000000.0": 53759123.3, "5925000000.0": 53759214.0, "5926000000.0": 53759304.7, "5927000000.0": 53759395.4, "5928000000.0": 53759486.0, "5929000000.0": 53759576.6, "5930000000.0": 53759667.1, "5931000000.0": 53759757.7, "5932000000.0": 53759848.2, "5933000000.0": 53759938.6, "5934000000.0": 53760029.1, "5935000000.0": 53760119.5, "5936000000.0": 53760209.9, "5937000000.0": 53760300.2, "5938000000.0": 53760390.5, "5939000000.0": 53760480.8, "5940000000.0": 53760571.1, "5941000000.0": 53760661.3, "5942000000.0": 53760751.5, "5943000000.0": 53760841.7, "5944000000.0": 53760931.8, "5945000000.0": 53761021.9, "5946000000.0": 53761112.0, "5947000000.0": 53761202.1, "5948000000.0": 53761292.1, "5949000000.0": 53761382.1, "5950000000.0": 53761472.0, "5951000000.0": 53761561.9, "5952000000.0": 53761651.8, "5953000000.0": 53761741.7, "5954000000.0": 53761831.6, "5955000000.0": 53761921.4, "5956000000.0": 53762011.1, "5957000000.0": 53762100.9, "5958000000.0": 53762190.6, "5959000000.0": 53762280.3, "5960000000.0": 53762370.0, "5961000000.0": 53762459.6, "5962000000.0": 53762549.2, "5963000000.0": 53762638.8, "5964000000.0": 53762728.3, "5965000000.0": 53762817.8, "5966000000.0": 53762907.3, "5967000000.0": 53762996.7, "5968000000.0": 53763086.2, "5969000000.0": 53763175.6, "5970000000.0": 53763264.9, "5971000000.0": 53763354.3, "5972000000.0": 53763443.6, "5973000000.0": 53763532.8, "5974000000.0": 53763622.1, "5975000000.0": 53763711.3, "5976000000.0": 53763800.5, "5977000000.0": 53763889.6, "5978000000.0": 53763978.8, "5979000000.0": 53764067.9, "5980000000.0": 53764156.9, "5981000000.0": 53764246.0, "5982000000.0": 53764335.0, "5983000000.0": 53764423.9, "5984000000.0": 53764512.9, "5985000000.0": 53764601.8, "5986000000.0": 53764690.7, "5987000000.0": 53764779.6, "5988000000.0": 53764868.4, "5989000000.0": 53764957.2, "5990000000.0": 53765046.0, "5991000000.0": 53765134.7, "5992000000.0": 53765223.4, "5993000000.0": 53765312.1, "5994000000.0": 53765400.8, "5995000000.0": 53765489.4, "5996000000.0": 53765578.0, "5997000000.0": 53765666.6, "5998000000.0": 53765755.1, "5999000000.0": 53765843.6, "6000000000.0": 53765932.1, "6001000000.0": 53766020.5, "6002000000.0": 53766109.0, "6003000000.0": 53766197.4, "6004000000.0": 53766285.7, "6005000000.0": 53766374.1, "6006000000.0": 53766462.4, "6007000000.0": 53766550.6, "6008000000.0": 53766638.9, "6009000000.0": 53766727.1, "6010000000.0": 53766815.3, "6011000000.0": 53766903.5, "6012000000.0": 53766991.6, "6013000000.0": 53767079.7, "6014000000.0": 53767167.8, "6015000000.0": 53767255.8, "6016000000.0": 53767343.8, "6017000000.0": 53767431.8, "6018000000.0": 53767519.8, "6019000000.0": 53767607.7, "6020000000.0": 53767695.6, "6021000000.0": 53767783.5, "6022000000.0": 53767871.3, "6023000000.0": 53767959.1, "6024000000.0": 53768046.9, "6025000000.0": 53768134.6, "6026000000.0": 53768222.4, "6027000000.0": 53768310.1, "6028000000.0": 53768397.7, "6029000000.0": 53768485.4, "6030000000.0": 53768573.0, "6031000000.0": 53768660.6, "6032000000.0": 53768748.1, "6033000000.0": 53768835.6, "6034000000.0": 53768923.1, "6035000000.0": 53769010.6, "6036000000.0": 53769098.1, "6037000000.0": 53769185.5, "6038000000.0": 53769272.8, "6039000000.0": 53769360.2, "6040000000.0": 53769447.5, "6041000000.0": 53769534.8, "6042000000.0": 53769622.1, "6043000000.0": 53769709.3, "6044000000.0": 53769796.5, "6045000000.0": 53769883.7, "6046000000.0": 53769970.9, "6047000000.0": 53770058.0, "6048000000.0": 53770145.1, "6049000000.0": 53770232.1, "6050000000.0": 53770319.2, "6051000000.0": 53770406.2, "6052000000.0": 53770493.2, "6053000000.0": 53770580.1, "6054000000.0": 53770667.0, "6055000000.0": 53770753.9, "6056000000.0": 53770840.8, "6057000000.0": 53770927.7, "6058000000.0": 53771014.5, "6059000000.0": 53771101.2, "6060000000.0": 53771188.0, "6061000000.0": 53771274.7, "6062000000.0": 53771361.4, "6063000000.0": 53771448.1, "6064000000.0": 53771534.7, "6065000000.0": 53771621.3, "6066000000.0": 53771707.9, "6067000000.0": 53771794.5, "6068000000.0": 53771881.0, "6069000000.0": 53771967.5, "6070000000.0": 53772054.0, "6071000000.0": 53772140.4, "6072000000.0": 53772226.8, "6073000000.0": 53772313.2, "6074000000.0": 53772399.6, "6075000000.0": 53772485.9, "6076000000.0": 53772572.2, "6077000000.0": 53772658.5, "6078000000.0": 53772744.7, "6079000000.0": 53772831.0, "6080000000.0": 53772917.1, "6081000000.0": 53773003.3, "6082000000.0": 53773089.4, "6083000000.0": 53773175.5, "6084000000.0": 53773261.6, "6085000000.0": 53773347.7, "6086000000.0": 53773433.7, "6087000000.0": 53773519.7, "6088000000.0": 53773605.6, "6089000000.0": 53773691.6, "6090000000.0": 53773777.5, "6091000000.0": 53773863.4, "6092000000.0": 53773949.2, "6093000000.0": 53774035.1, "6094000000.0": 53774120.9, "6095000000.0": 53774206.6, "6096000000.0": 53774292.4, "6097000000.0": 53774378.1, "6098000000.0": 53774463.8, "6099000000.0": 53774549.4, "6100000000.0": 53774635.1, "6101000000.0": 53774720.7, "6102000000.0": 53774806.2, "6103000000.0": 53774891.8, "6104000000.0": 53774977.3, "6105000000.0": 53775062.8, "6106000000.0": 53775148.3, "6107000000.0": 53775233.7, "6108000000.0": 53775319.1, "6109000000.0": 53775404.5, "6110000000.0": 53775489.8, "6111000000.0": 53775575.2, "6112000000.0": 53775660.5, "6113000000.0": 53775745.7, "6114000000.0": 53775831.0, "6115000000.0": 53775916.2, "6116000000.0": 53776001.4, "6117000000.0": 53776086.5, "6118000000.0": 53776171.7, "6119000000.0": 53776256.8, "6120000000.0": 53776341.9, "6121000000.0": 53776426.9, "6122000000.0": 53776511.9, "6123000000.0": 53776596.9, "6124000000.0": 53776681.9, "6125000000.0": 53776766.8, "6126000000.0": 53776851.7, "6127000000.0": 53776936.6, "6128000000.0": 53777021.5, "6129000000.0": 53777106.3, "6130000000.0": 53777191.1, "6131000000.0": 53777275.9, "6132000000.0": 53777360.6, "6133000000.0": 53777445.4, "6134000000.0": 53777530.1, "6135000000.0": 53777614.7, "6136000000.0": 53777699.4, "6137000000.0": 53777784.0, "6138000000.0": 53777868.6, "6139000000.0": 53777953.1, "6140000000.0": 53778037.6, "6141000000.0": 53778122.1, "6142000000.0": 53778206.6, "6143000000.0": 53778291.1, "6144000000.0": 53778375.5, "6145000000.0": 53778459.9, "6146000000.0": 53778544.2, "6147000000.0": 53778628.6, "6148000000.0": 53778712.9, "6149000000.0": 53778797.2, "6150000000.0": 53778881.4, "6151000000.0": 53778965.7, "6152000000.0": 53779049.9, "6153000000.0": 53779134.0, "6154000000.0": 53779218.2, "6155000000.0": 53779302.3, "6156000000.0": 53779386.4, "6157000000.0": 53779470.5, "6158000000.0": 53779554.5, "6159000000.0": 53779638.5, "6160000000.0": 53779722.5, "6161000000.0": 53779806.5, "6162000000.0": 53779890.4, "6163000000.0": 53779974.3, "6164000000.0": 53780058.2, "6165000000.0": 53780142.1, "6166000000.0": 53780225.9, "6167000000.0": 53780309.7, "6168000000.0": 53780393.4, "6169000000.0": 53780477.2, "6170000000.0": 53780560.9, "6171000000.0": 53780644.6, "6172000000.0": 53780728.3, "6173000000.0": 53780811.9, "6174000000.0": 53780895.5, "6175000000.0": 53780979.1, "6176000000.0": 53781062.6, "6177000000.0": 53781146.2, "6178000000.0": 53781229.7, "6179000000.0": 53781313.2, "6180000000.0": 53781396.6, "6181000000.0": 53781480.0, "6182000000.0": 53781563.4, "6183000000.0": 53781646.8, "6184000000.0": 53781730.1, "6185000000.0": 53781813.5, "6186000000.0": 53781896.7, "6187000000.0": 53781980.0, "6188000000.0": 53782063.2, "6189000000.0": 53782146.4, "6190000000.0": 53782229.6, "6191000000.0": 53782312.8, "6192000000.0": 53782395.9, "6193000000.0": 53782479.0, "6194000000.0": 53782562.1, "6195000000.0": 53782645.1, "6196000000.0": 53782728.2, "6197000000.0": 53782811.2, "6198000000.0": 53782894.1, "6199000000.0": 53782977.1, "6200000000.0": 53783060.0, "6201000000.0": 53783142.9, "6202000000.0": 53783225.7, "6203000000.0": 53783308.6, "6204000000.0": 53783391.4, "6205000000.0": 53783474.2, "6206000000.0": 53783556.9, "6207000000.0": 53783639.7, "6208000000.0": 53783722.4, "6209000000.0": 53783805.1, "6210000000.0": 53783887.7, "6211000000.0": 53783970.3, "6212000000.0": 53784052.9, "6213000000.0": 53784135.5, "6214000000.0": 53784218.1, "6215000000.0": 53784300.6, "6216000000.0": 53784383.1, "6217000000.0": 53784465.5, "6218000000.0": 53784548.0, "6219000000.0": 53784630.4, "6220000000.0": 53784712.8, "6221000000.0": 53784795.2, "6222000000.0": 53784877.5, "6223000000.0": 53784959.8, "6224000000.0": 53785042.1, "6225000000.0": 53785124.3, "6226000000.0": 53785206.6, "6227000000.0": 53785288.8, "6228000000.0": 53785371.0, "6229000000.0": 53785453.1, "6230000000.0": 53785535.2, "6231000000.0": 53785617.3, "6232000000.0": 53785699.4, "6233000000.0": 53785781.5, "6234000000.0": 53785863.5, "6235000000.0": 53785945.5, "6236000000.0": 53786027.5, "6237000000.0": 53786109.4, "6238000000.0": 53786191.3, "6239000000.0": 53786273.2, "6240000000.0": 53786355.1, "6241000000.0": 53786436.9, "6242000000.0": 53786518.7, "6243000000.0": 53786600.5, "6244000000.0": 53786682.3, "6245000000.0": 53786764.0, "6246000000.0": 53786845.7, "6247000000.0": 53786927.4, "6248000000.0": 53787009.1, "6249000000.0": 53787090.7, "6250000000.0": 53787172.3, "6251000000.0": 53787253.9, "6252000000.0": 53787335.5, "6253000000.0": 53787417.0, "6254000000.0": 53787498.5, "6255000000.0": 53787580.0, "6256000000.0": 53787661.4, "6257000000.0": 53787742.9, "6258000000.0": 53787824.3, "6259000000.0": 53787905.6, "6260000000.0": 53787987.0, "6261000000.0": 53788068.3, "6262000000.0": 53788149.6, "6263000000.0": 53788230.9, "6264000000.0": 53788312.1, "6265000000.0": 53788393.4, "6266000000.0": 53788474.6, "6267000000.0": 53788555.7, "6268000000.0": 53788636.9, "6269000000.0": 53788718.0, "6270000000.0": 53788799.1, "6271000000.0": 53788880.2, "6272000000.0": 53788961.2, "6273000000.0": 53789042.2, "6274000000.0": 53789123.2, "6275000000.0": 53789204.2, "6276000000.0": 53789285.1, "6277000000.0": 53789366.0, "6278000000.0": 53789446.9, "6279000000.0": 53789527.8, "6280000000.0": 53789608.6, "6281000000.0": 53789689.4, "6282000000.0": 53789770.2, "6283000000.0": 53789851.0, "6284000000.0": 53789931.7, "6285000000.0": 53790012.4, "6286000000.0": 53790093.1, "6287000000.0": 53790173.8, "6288000000.0": 53790254.4, "6289000000.0": 53790335.0, "6290000000.0": 53790415.6, "6291000000.0": 53790496.1, "6292000000.0": 53790576.7, "6293000000.0": 53790657.2, "6294000000.0": 53790737.7, "6295000000.0": 53790818.1, "6296000000.0": 53790898.6, "6297000000.0": 53790979.0, "6298000000.0": 53791059.3, "6299000000.0": 53791139.7, "6300000000.0": 53791220.0, "6301000000.0": 53791300.3, "6302000000.0": 53791380.6, "6303000000.0": 53791460.9, "6304000000.0": 53791541.1, "6305000000.0": 53791621.3, "6306000000.0": 53791701.5, "6307000000.0": 53791781.6, "6308000000.0": 53791861.8, "6309000000.0": 53791941.9, "6310000000.0": 53792021.9, "6311000000.0": 53792102.0, "6312000000.0": 53792182.0, "6313000000.0": 53792262.0, "6314000000.0": 53792342.0, "6315000000.0": 53792421.9, "6316000000.0": 53792501.9, "6317000000.0": 53792581.8, "6318000000.0": 53792661.7, "6319000000.0": 53792741.5, "6320000000.0": 53792821.3, "6321000000.0": 53792901.1, "6322000000.0": 53792980.9, "6323000000.0": 53793060.7, "6324000000.0": 53793140.4, "6325000000.0": 53793220.1, "6326000000.0": 53793299.8, "6327000000.0": 53793379.4, "6328000000.0": 53793459.1, "6329000000.0": 53793538.7, "6330000000.0": 53793618.2, "6331000000.0": 53793697.8, "6332000000.0": 53793777.3, "6333000000.0": 53793856.8, "6334000000.0": 53793936.3, "6335000000.0": 53794015.7, "6336000000.0": 53794095.2, "6337000000.0": 53794174.6, "6338000000.0": 53794254.0, "6339000000.0": 53794333.3, "6340000000.0": 53794412.6, "6341000000.0": 53794491.9, "6342000000.0": 53794571.2, "6343000000.0": 53794650.5, "6344000000.0": 53794729.7, "6345000000.0": 53794808.9, "6346000000.0": 53794888.1, "6347000000.0": 53794967.3, "6348000000.0": 53795046.4, "6349000000.0": 53795125.5, "6350000000.0": 53795204.6, "6351000000.0": 53795283.6, "6352000000.0": 53795362.7, "6353000000.0": 53795441.7, "6354000000.0": 53795520.7, "6355000000.0": 53795599.6, "6356000000.0": 53795678.5, "6357000000.0": 53795757.5, "6358000000.0": 53795836.3, "6359000000.0": 53795915.2, "6360000000.0": 53795994.0, "6361000000.0": 53796072.8, "6362000000.0": 53796151.6, "6363000000.0": 53796230.4, "6364000000.0": 53796309.1, "6365000000.0": 53796387.8, "6366000000.0": 53796466.5, "6367000000.0": 53796545.2, "6368000000.0": 53796623.8, "6369000000.0": 53796702.4, "6370000000.0": 53796781.0, "6371000000.0": 53796859.6, "6372000000.0": 53796938.1, "6373000000.0": 53797016.7, "6374000000.0": 53797095.2, "6375000000.0": 53797173.6, "6376000000.0": 53797252.1, "6377000000.0": 53797330.5, "6378000000.0": 53797408.9, "6379000000.0": 53797487.3, "6380000000.0": 53797565.6, "6381000000.0": 53797643.9, "6382000000.0": 53797722.2, "6383000000.0": 53797800.5, "6384000000.0": 53797878.7, "6385000000.0": 53797957.0, "6386000000.0": 53798035.2, "6387000000.0": 53798113.3, "6388000000.0": 53798191.5, "6389000000.0": 53798269.6, "6390000000.0": 53798347.7, "6391000000.0": 53798425.8, "6392000000.0": 53798503.9, "6393000000.0": 53798581.9, "6394000000.0": 53798659.9, "6395000000.0": 53798737.9, "6396000000.0": 53798815.8, "6397000000.0": 53798893.8, "6398000000.0": 53798971.7, "6399000000.0": 53799049.6, "6400000000.0": 53799127.4, "6401000000.0": 53799205.3, "6402000000.0": 53799283.1, "6403000000.0": 53799360.9, "6404000000.0": 53799438.7, "6405000000.0": 53799516.4, "6406000000.0": 53799594.1, "6407000000.0": 53799671.8, "6408000000.0": 53799749.5, "6409000000.0": 53799827.1, "6410000000.0": 53799904.7, "6411000000.0": 53799982.3, "6412000000.0": 53800059.9, "6413000000.0": 53800137.5, "6414000000.0": 53800215.0, "6415000000.0": 53800292.5, "6416000000.0": 53800370.0, "6417000000.0": 53800447.4, "6418000000.0": 53800524.9, "6419000000.0": 53800602.3, "6420000000.0": 53800679.6, "6421000000.0": 53800757.0, "6422000000.0": 53800834.3, "6423000000.0": 53800911.6, "6424000000.0": 53800988.9, "6425000000.0": 53801066.2, "6426000000.0": 53801143.4, "6427000000.0": 53801220.7, "6428000000.0": 53801297.8, "6429000000.0": 53801375.0, "6430000000.0": 53801452.2, "6431000000.0": 53801529.3, "6432000000.0": 53801606.4, "6433000000.0": 53801683.4, "6434000000.0": 53801760.5, "6435000000.0": 53801837.5, "6436000000.0": 53801914.5, "6437000000.0": 53801991.5, "6438000000.0": 53802068.5, "6439000000.0": 53802145.4, "6440000000.0": 53802222.3, "6441000000.0": 53802299.2, "6442000000.0": 53802376.0, "6443000000.0": 53802452.9, "6444000000.0": 53802529.7, "6445000000.0": 53802606.5, "6446000000.0": 53802683.2, "6447000000.0": 53802760.0, "6448000000.0": 53802836.7, "6449000000.0": 53802913.4, "6450000000.0": 53802990.1, "6451000000.0": 53803066.7, "6452000000.0": 53803143.3, "6453000000.0": 53803219.9, "6454000000.0": 53803296.5, "6455000000.0": 53803373.1, "6456000000.0": 53803449.6, "6457000000.0": 53803526.1, "6458000000.0": 53803602.6, "6459000000.0": 53803679.0, "6460000000.0": 53803755.5, "6461000000.0": 53803831.9, "6462000000.0": 53803908.3, "6463000000.0": 53803984.6, "6464000000.0": 53804061.0, "6465000000.0": 53804137.3, "6466000000.0": 53804213.6, "6467000000.0": 53804289.9, "6468000000.0": 53804366.1, "6469000000.0": 53804442.3, "6470000000.0": 53804518.5, "6471000000.0": 53804594.7, "6472000000.0": 53804670.9, "6473000000.0": 53804747.0, "6474000000.0": 53804823.1, "6475000000.0": 53804899.2, "6476000000.0": 53804975.3, "6477000000.0": 53805051.3, "6478000000.0": 53805127.3, "6479000000.0": 53805203.3, "6480000000.0": 53805279.3, "6481000000.0": 53805355.2, "6482000000.0": 53805431.2, "6483000000.0": 53805507.1, "6484000000.0": 53805582.9, "6485000000.0": 53805658.8, "6486000000.0": 53805734.6, "6487000000.0": 53805810.4, "6488000000.0": 53805886.2, "6489000000.0": 53805962.0, "6490000000.0": 53806037.7, "6491000000.0": 53806113.4, "6492000000.0": 53806189.1, "6493000000.0": 53806264.8, "6494000000.0": 53806340.4, "6495000000.0": 53806416.0, "6496000000.0": 53806491.6, "6497000000.0": 53806567.2, "6498000000.0": 53806642.8, "6499000000.0": 53806718.3, "6500000000.0": 53806793.8, "6501000000.0": 53806869.3, "6502000000.0": 53806944.7, "6503000000.0": 53807020.2, "6504000000.0": 53807095.6, "6505000000.0": 53807171.0, "6506000000.0": 53807246.4, "6507000000.0": 53807321.7, "6508000000.0": 53807397.0, "6509000000.0": 53807472.3, "6510000000.0": 53807547.6, "6511000000.0": 53807622.9, "6512000000.0": 53807698.1, "6513000000.0": 53807773.3, "6514000000.0": 53807848.5, "6515000000.0": 53807923.6, "6516000000.0": 53807998.8, "6517000000.0": 53808073.9, "6518000000.0": 53808149.0, "6519000000.0": 53808224.1, "6520000000.0": 53808299.1, "6521000000.0": 53808374.1, "6522000000.0": 53808449.1, "6523000000.0": 53808524.1, "6524000000.0": 53808599.1, "6525000000.0": 53808674.0, "6526000000.0": 53808748.9, "6527000000.0": 53808823.8, "6528000000.0": 53808898.7, "6529000000.0": 53808973.5, "6530000000.0": 53809048.3, "6531000000.0": 53809123.1, "6532000000.0": 53809197.9, "6533000000.0": 53809272.7, "6534000000.0": 53809347.4, "6535000000.0": 53809422.1, "6536000000.0": 53809496.8, "6537000000.0": 53809571.5, "6538000000.0": 53809646.1, "6539000000.0": 53809720.7, "6540000000.0": 53809795.3, "6541000000.0": 53809869.9, "6542000000.0": 53809944.4, "6543000000.0": 53810019.0, "6544000000.0": 53810093.5, "6545000000.0": 53810167.9, "6546000000.0": 53810242.4, "6547000000.0": 53810316.8, "6548000000.0": 53810391.2, "6549000000.0": 53810465.6, "6550000000.0": 53810540.0, "6551000000.0": 53810614.4, "6552000000.0": 53810688.7, "6553000000.0": 53810763.0, "6554000000.0": 53810837.3, "6555000000.0": 53810911.5, "6556000000.0": 53810985.7, "6557000000.0": 53811060.0, "6558000000.0": 53811134.1, "6559000000.0": 53811208.3, "6560000000.0": 53811282.5, "6561000000.0": 53811356.6, "6562000000.0": 53811430.7, "6563000000.0": 53811504.8, "6564000000.0": 53811578.8, "6565000000.0": 53811652.8, "6566000000.0": 53811726.9, "6567000000.0": 53811800.8, "6568000000.0": 53811874.8, "6569000000.0": 53811948.7, "6570000000.0": 53812022.7, "6571000000.0": 53812096.6, "6572000000.0": 53812170.4, "6573000000.0": 53812244.3, "6574000000.0": 53812318.1, "6575000000.0": 53812391.9, "6576000000.0": 53812465.7, "6577000000.0": 53812539.5, "6578000000.0": 53812613.2, "6579000000.0": 53812687.0, "6580000000.0": 53812760.7, "6581000000.0": 53812834.3, "6582000000.0": 53812908.0, "6583000000.0": 53812981.6, "6584000000.0": 53813055.2, "6585000000.0": 53813128.8, "6586000000.0": 53813202.4, "6587000000.0": 53813275.9, "6588000000.0": 53813349.4, "6589000000.0": 53813422.9, "6590000000.0": 53813496.4, "6591000000.0": 53813569.9, "6592000000.0": 53813643.3, "6593000000.0": 53813716.7, "6594000000.0": 53813790.1, "6595000000.0": 53813863.5, "6596000000.0": 53813936.8, "6597000000.0": 53814010.1, "6598000000.0": 53814083.4, "6599000000.0": 53814156.7, "6600000000.0": 53814230.0, "6601000000.0": 53814303.2, "6602000000.0": 53814376.4, "6603000000.0": 53814449.6, "6604000000.0": 53814522.8, "6605000000.0": 53814595.9, "6606000000.0": 53814669.0, "6607000000.0": 53814742.1, "6608000000.0": 53814815.2, "6609000000.0": 53814888.3, "6610000000.0": 53814961.3, "6611000000.0": 53815034.3, "6612000000.0": 53815107.3, "6613000000.0": 53815180.3, "6614000000.0": 53815253.2, "6615000000.0": 53815326.2, "6616000000.0": 53815399.1, "6617000000.0": 53815472.0, "6618000000.0": 53815544.8, "6619000000.0": 53815617.7, "6620000000.0": 53815690.5, "6621000000.0": 53815763.3, "6622000000.0": 53815836.1, "6623000000.0": 53815908.8, "6624000000.0": 53815981.5, "6625000000.0": 53816054.2, "6626000000.0": 53816126.9, "6627000000.0": 53816199.6, "6628000000.0": 53816272.2, "6629000000.0": 53816344.9, "6630000000.0": 53816417.5, "6631000000.0": 53816490.0, "6632000000.0": 53816562.6, "6633000000.0": 53816635.1, "6634000000.0": 53816707.7, "6635000000.0": 53816780.1, "6636000000.0": 53816852.6, "6637000000.0": 53816925.1, "6638000000.0": 53816997.5, "6639000000.0": 53817069.9, "6640000000.0": 53817142.3, "6641000000.0": 53817214.6, "6642000000.0": 53817287.0, "6643000000.0": 53817359.3, "6644000000.0": 53817431.6, "6645000000.0": 53817503.9, "6646000000.0": 53817576.1, "6647000000.0": 53817648.4, "6648000000.0": 53817720.6, "6649000000.0": 53817792.8, "6650000000.0": 53817864.9, "6651000000.0": 53817937.1, "6652000000.0": 53818009.2, "6653000000.0": 53818081.3, "6654000000.0": 53818153.4, "6655000000.0": 53818225.5, "6656000000.0": 53818297.5, "6657000000.0": 53818369.5, "6658000000.0": 53818441.5, "6659000000.0": 53818513.5, "6660000000.0": 53818585.4, "6661000000.0": 53818657.4, "6662000000.0": 53818729.3, "6663000000.0": 53818801.2, "6664000000.0": 53818873.0, "6665000000.0": 53818944.9, "6666000000.0": 53819016.7, "6667000000.0": 53819088.5, "6668000000.0": 53819160.3, "6669000000.0": 53819232.1, "6670000000.0": 53819303.8, "6671000000.0": 53819375.5, "6672000000.0": 53819447.2, "6673000000.0": 53819518.9, "6674000000.0": 53819590.6, "6675000000.0": 53819662.2, "6676000000.0": 53819733.8, "6677000000.0": 53819805.4, "6678000000.0": 53819877.0, "6679000000.0": 53819948.5, "6680000000.0": 53820020.0, "6681000000.0": 53820091.5, "6682000000.0": 53820163.0, "6683000000.0": 53820234.5, "6684000000.0": 53820305.9, "6685000000.0": 53820377.4, "6686000000.0": 53820448.8, "6687000000.0": 53820520.1, "6688000000.0": 53820591.5, "6689000000.0": 53820662.8, "6690000000.0": 53820734.1, "6691000000.0": 53820805.4, "6692000000.0": 53820876.7, "6693000000.0": 53820948.0, "6694000000.0": 53821019.2, "6695000000.0": 53821090.4, "6696000000.0": 53821161.6, "6697000000.0": 53821232.8, "6698000000.0": 53821303.9, "6699000000.0": 53821375.0, "6700000000.0": 53821446.1, "6701000000.0": 53821517.2, "6702000000.0": 53821588.3, "6703000000.0": 53821659.3, "6704000000.0": 53821730.4, "6705000000.0": 53821801.4, "6706000000.0": 53821872.3, "6707000000.0": 53821943.3, "6708000000.0": 53822014.2, "6709000000.0": 53822085.1, "6710000000.0": 53822156.0, "6711000000.0": 53822226.9, "6712000000.0": 53822297.8, "6713000000.0": 53822368.6, "6714000000.0": 53822439.4, "6715000000.0": 53822510.2, "6716000000.0": 53822581.0, "6717000000.0": 53822651.7, "6718000000.0": 53822722.4, "6719000000.0": 53822793.2, "6720000000.0": 53822863.8, "6721000000.0": 53822934.5, "6722000000.0": 53823005.1, "6723000000.0": 53823075.8, "6724000000.0": 53823146.4, "6725000000.0": 53823217.0, "6726000000.0": 53823287.5, "6727000000.0": 53823358.1, "6728000000.0": 53823428.6, "6729000000.0": 53823499.1, "6730000000.0": 53823569.6, "6731000000.0": 53823640.0, "6732000000.0": 53823710.4, "6733000000.0": 53823780.9, "6734000000.0": 53823851.3, "6735000000.0": 53823921.6, "6736000000.0": 53823992.0, "6737000000.0": 53824062.3, "6738000000.0": 53824132.6, "6739000000.0": 53824202.9, "6740000000.0": 53824273.2, "6741000000.0": 53824343.4, "6742000000.0": 53824413.7, "6743000000.0": 53824483.9, "6744000000.0": 53824554.1, "6745000000.0": 53824624.2, "6746000000.0": 53824694.4, "6747000000.0": 53824764.5, "6748000000.0": 53824834.6, "6749000000.0": 53824904.7, "6750000000.0": 53824974.8, "6751000000.0": 53825044.8, "6752000000.0": 53825114.8, "6753000000.0": 53825184.8, "6754000000.0": 53825254.8, "6755000000.0": 53825324.8, "6756000000.0": 53825394.7, "6757000000.0": 53825464.6, "6758000000.0": 53825534.5, "6759000000.0": 53825604.4, "6760000000.0": 53825674.3, "6761000000.0": 53825744.1, "6762000000.0": 53825813.9, "6763000000.0": 53825883.7, "6764000000.0": 53825953.5, "6765000000.0": 53826023.3, "6766000000.0": 53826093.0, "6767000000.0": 53826162.7, "6768000000.0": 53826232.4, "6769000000.0": 53826302.1, "6770000000.0": 53826371.7, "6771000000.0": 53826441.4, "6772000000.0": 53826511.0, "6773000000.0": 53826580.6, "6774000000.0": 53826650.2, "6775000000.0": 53826719.7, "6776000000.0": 53826789.3, "6777000000.0": 53826858.8, "6778000000.0": 53826928.3, "6779000000.0": 53826997.7, "6780000000.0": 53827067.2, "6781000000.0": 53827136.6, "6782000000.0": 53827206.0, "6783000000.0": 53827275.4, "6784000000.0": 53827344.8, "6785000000.0": 53827414.1, "6786000000.0": 53827483.5, "6787000000.0": 53827552.8, "6788000000.0": 53827622.1, "6789000000.0": 53827691.3, "6790000000.0": 53827760.6, "6791000000.0": 53827829.8, "6792000000.0": 53827899.0, "6793000000.0": 53827968.2, "6794000000.0": 53828037.4, "6795000000.0": 53828106.5, "6796000000.0": 53828175.6, "6797000000.0": 53828244.8, "6798000000.0": 53828313.8, "6799000000.0": 53828382.9, "6800000000.0": 53828452.0, "6801000000.0": 53828521.0, "6802000000.0": 53828590.0, "6803000000.0": 53828659.0, "6804000000.0": 53828727.9, "6805000000.0": 53828796.9, "6806000000.0": 53828865.8, "6807000000.0": 53828934.7, "6808000000.0": 53829003.6, "6809000000.0": 53829072.5, "6810000000.0": 53829141.3, "6811000000.0": 53829210.1, "6812000000.0": 53829279.0, "6813000000.0": 53829347.7, "6814000000.0": 53829416.5, "6815000000.0": 53829485.2, "6816000000.0": 53829554.0, "6817000000.0": 53829622.7, "6818000000.0": 53829691.4, "6819000000.0": 53829760.0, "6820000000.0": 53829828.7, "6821000000.0": 53829897.3, "6822000000.0": 53829965.9, "6823000000.0": 53830034.5, "6824000000.0": 53830103.1, "6825000000.0": 53830171.6, "6826000000.0": 53830240.1, "6827000000.0": 53830308.6, "6828000000.0": 53830377.1, "6829000000.0": 53830445.6, "6830000000.0": 53830514.0, "6831000000.0": 53830582.5, "6832000000.0": 53830650.9, "6833000000.0": 53830719.3, "6834000000.0": 53830787.6, "6835000000.0": 53830856.0, "6836000000.0": 53830924.3, "6837000000.0": 53830992.6, "6838000000.0": 53831060.9, "6839000000.0": 53831129.2, "6840000000.0": 53831197.4, "6841000000.0": 53831265.7, "6842000000.0": 53831333.9, "6843000000.0": 53831402.1, "6844000000.0": 53831470.2, "6845000000.0": 53831538.4, "6846000000.0": 53831606.5, "6847000000.0": 53831674.6, "6848000000.0": 53831742.7, "6849000000.0": 53831810.8, "6850000000.0": 53831878.8, "6851000000.0": 53831946.9, "6852000000.0": 53832014.9, "6853000000.0": 53832082.9, "6854000000.0": 53832150.8, "6855000000.0": 53832218.8, "6856000000.0": 53832286.7, "6857000000.0": 53832354.6, "6858000000.0": 53832422.5, "6859000000.0": 53832490.4, "6860000000.0": 53832558.3, "6861000000.0": 53832626.1, "6862000000.0": 53832693.9, "6863000000.0": 53832761.7, "6864000000.0": 53832829.5, "6865000000.0": 53832897.2, "6866000000.0": 53832965.0, "6867000000.0": 53833032.7, "6868000000.0": 53833100.4, "6869000000.0": 53833168.1, "6870000000.0": 53833235.7, "6871000000.0": 53833303.4, "6872000000.0": 53833371.0, "6873000000.0": 53833438.6, "6874000000.0": 53833506.2, "6875000000.0": 53833573.7, "6876000000.0": 53833641.3, "6877000000.0": 53833708.8, "6878000000.0": 53833776.3, "6879000000.0": 53833843.8, "6880000000.0": 53833911.2, "6881000000.0": 53833978.7, "6882000000.0": 53834046.1, "6883000000.0": 53834113.5, "6884000000.0": 53834180.9, "6885000000.0": 53834248.3, "6886000000.0": 53834315.6, "6887000000.0": 53834383.0, "6888000000.0": 53834450.3, "6889000000.0": 53834517.6, "6890000000.0": 53834584.8, "6891000000.0": 53834652.1, "6892000000.0": 53834719.3, "6893000000.0": 53834786.5, "6894000000.0": 53834853.7, "6895000000.0": 53834920.9, "6896000000.0": 53834988.0, "6897000000.0": 53835055.2, "6898000000.0": 53835122.3, "6899000000.0": 53835189.4, "6900000000.0": 53835256.5, "6901000000.0": 53835323.5, "6902000000.0": 53835390.6, "6903000000.0": 53835457.6, "6904000000.0": 53835524.6, "6905000000.0": 53835591.6, "6906000000.0": 53835658.5, "6907000000.0": 53835725.5, "6908000000.0": 53835792.4, "6909000000.0": 53835859.3, "6910000000.0": 53835926.2, "6911000000.0": 53835993.0, "6912000000.0": 53836059.9, "6913000000.0": 53836126.7, "6914000000.0": 53836193.5, "6915000000.0": 53836260.3, "6916000000.0": 53836327.1, "6917000000.0": 53836393.8, "6918000000.0": 53836460.6, "6919000000.0": 53836527.3, "6920000000.0": 53836594.0, "6921000000.0": 53836660.6, "6922000000.0": 53836727.3, "6923000000.0": 53836793.9, "6924000000.0": 53836860.6, "6925000000.0": 53836927.2, "6926000000.0": 53836993.7, "6927000000.0": 53837060.3, "6928000000.0": 53837126.8, "6929000000.0": 53837193.4, "6930000000.0": 53837259.9, "6931000000.0": 53837326.3, "6932000000.0": 53837392.8, "6933000000.0": 53837459.3, "6934000000.0": 53837525.7, "6935000000.0": 53837592.1, "6936000000.0": 53837658.5, "6937000000.0": 53837724.8, "6938000000.0": 53837791.2, "6939000000.0": 53837857.5, "6940000000.0": 53837923.8, "6941000000.0": 53837990.1, "6942000000.0": 53838056.4, "6943000000.0": 53838122.7, "6944000000.0": 53838188.9, "6945000000.0": 53838255.1, "6946000000.0": 53838321.3, "6947000000.0": 53838387.5, "6948000000.0": 53838453.7, "6949000000.0": 53838519.8, "6950000000.0": 53838585.9, "6951000000.0": 53838652.0, "6952000000.0": 53838718.1, "6953000000.0": 53838784.2, "6954000000.0": 53838850.2, "6955000000.0": 53838916.3, "6956000000.0": 53838982.3, "6957000000.0": 53839048.3, "6958000000.0": 53839114.2, "6959000000.0": 53839180.2, "6960000000.0": 53839246.1, "6961000000.0": 53839312.0, "6962000000.0": 53839377.9, "6963000000.0": 53839443.8, "6964000000.0": 53839509.7, "6965000000.0": 53839575.5, "6966000000.0": 53839641.3, "6967000000.0": 53839707.1, "6968000000.0": 53839772.9, "6969000000.0": 53839838.7, "6970000000.0": 53839904.5, "6971000000.0": 53839970.2, "6972000000.0": 53840035.9, "6973000000.0": 53840101.6, "6974000000.0": 53840167.3, "6975000000.0": 53840232.9, "6976000000.0": 53840298.5, "6977000000.0": 53840364.2, "6978000000.0": 53840429.8, "6979000000.0": 53840495.3, "6980000000.0": 53840560.9, "6981000000.0": 53840626.4, "6982000000.0": 53840692.0, "6983000000.0": 53840757.5, "6984000000.0": 53840823.0, "6985000000.0": 53840888.4, "6986000000.0": 53840953.9, "6987000000.0": 53841019.3, "6988000000.0": 53841084.7, "6989000000.0": 53841150.1, "6990000000.0": 53841215.5, "6991000000.0": 53841280.9, "6992000000.0": 53841346.2, "6993000000.0": 53841411.5, "6994000000.0": 53841476.8, "6995000000.0": 53841542.1, "6996000000.0": 53841607.4, "6997000000.0": 53841672.6, "6998000000.0": 53841737.8, "6999000000.0": 53841803.0, "7000000000.0": 53841868.2, "7001000000.0": 53841933.4, "7002000000.0": 53841998.6, "7003000000.0": 53842063.7, "7004000000.0": 53842128.8, "7005000000.0": 53842193.9, "7006000000.0": 53842259.0, "7007000000.0": 53842324.0, "7008000000.0": 53842389.1, "7009000000.0": 53842454.1, "7010000000.0": 53842519.1, "7011000000.0": 53842584.1, "7012000000.0": 53842649.1, "7013000000.0": 53842714.0, "7014000000.0": 53842779.0, "7015000000.0": 53842843.9, "7016000000.0": 53842908.8, "7017000000.0": 53842973.7, "7018000000.0": 53843038.5, "7019000000.0": 53843103.4, "7020000000.0": 53843168.2, "7021000000.0": 53843233.0, "7022000000.0": 53843297.8, "7023000000.0": 53843362.5, "7024000000.0": 53843427.3, "7025000000.0": 53843492.0, "7026000000.0": 53843556.7, "7027000000.0": 53843621.4, "7028000000.0": 53843686.1, "7029000000.0": 53843750.8, "7030000000.0": 53843815.4, "7031000000.0": 53843880.0, "7032000000.0": 53843944.6, "7033000000.0": 53844009.2, "7034000000.0": 53844073.8, "7035000000.0": 53844138.3, "7036000000.0": 53844202.9, "7037000000.0": 53844267.4, "7038000000.0": 53844331.9, "7039000000.0": 53844396.3, "7040000000.0": 53844460.8, "7041000000.0": 53844525.2, "7042000000.0": 53844589.7, "7043000000.0": 53844654.1, "7044000000.0": 53844718.4, "7045000000.0": 53844782.8, "7046000000.0": 53844847.2, "7047000000.0": 53844911.5, "7048000000.0": 53844975.8, "7049000000.0": 53845040.1, "7050000000.0": 53845104.4, "7051000000.0": 53845168.6, "7052000000.0": 53845232.9, "7053000000.0": 53845297.1, "7054000000.0": 53845361.3, "7055000000.0": 53845425.5, "7056000000.0": 53845489.7, "7057000000.0": 53845553.8, "7058000000.0": 53845617.9, "7059000000.0": 53845682.1, "7060000000.0": 53845746.2, "7061000000.0": 53845810.2, "7062000000.0": 53845874.3, "7063000000.0": 53845938.3, "7064000000.0": 53846002.4, "7065000000.0": 53846066.4, "7066000000.0": 53846130.4, "7067000000.0": 53846194.3, "7068000000.0": 53846258.3, "7069000000.0": 53846322.2, "7070000000.0": 53846386.1, "7071000000.0": 53846450.0, "7072000000.0": 53846513.9, "7073000000.0": 53846577.8, "7074000000.0": 53846641.6, "7075000000.0": 53846705.4, "7076000000.0": 53846769.2, "7077000000.0": 53846833.0, "7078000000.0": 53846896.8, "7079000000.0": 53846960.6, "7080000000.0": 53847024.3, "7081000000.0": 53847088.0, "7082000000.0": 53847151.7, "7083000000.0": 53847215.4, "7084000000.0": 53847279.1, "7085000000.0": 53847342.7, "7086000000.0": 53847406.4, "7087000000.0": 53847470.0, "7088000000.0": 53847533.6, "7089000000.0": 53847597.1, "7090000000.0": 53847660.7, "7091000000.0": 53847724.2, "7092000000.0": 53847787.8, "7093000000.0": 53847851.3, "7094000000.0": 53847914.8, "7095000000.0": 53847978.2, "7096000000.0": 53848041.7, "7097000000.0": 53848105.1, "7098000000.0": 53848168.5, "7099000000.0": 53848231.9, "7100000000.0": 53848295.3, "7101000000.0": 53848358.7, "7102000000.0": 53848422.0, "7103000000.0": 53848485.4, "7104000000.0": 53848548.7, "7105000000.0": 53848612.0, "7106000000.0": 53848675.2, "7107000000.0": 53848738.5, "7108000000.0": 53848801.7, "7109000000.0": 53848865.0, "7110000000.0": 53848928.2, "7111000000.0": 53848991.4, "7112000000.0": 53849054.5, "7113000000.0": 53849117.7, "7114000000.0": 53849180.8, "7115000000.0": 53849243.9, "7116000000.0": 53849307.0, "7117000000.0": 53849370.1, "7118000000.0": 53849433.2, "7119000000.0": 53849496.2, "7120000000.0": 53849559.3, "7121000000.0": 53849622.3, "7122000000.0": 53849685.3, "7123000000.0": 53849748.2, "7124000000.0": 53849811.2, "7125000000.0": 53849874.1, "7126000000.0": 53849937.1, "7127000000.0": 53850000.0, "7128000000.0": 53850062.9, "7129000000.0": 53850125.7, "7130000000.0": 53850188.6, "7131000000.0": 53850251.4, "7132000000.0": 53850314.3, "7133000000.0": 53850377.1, "7134000000.0": 53850439.8, "7135000000.0": 53850502.6, "7136000000.0": 53850565.4, "7137000000.0": 53850628.1, "7138000000.0": 53850690.8, "7139000000.0": 53850753.5, "7140000000.0": 53850816.2, "7141000000.0": 53850878.8, "7142000000.0": 53850941.5, "7143000000.0": 53851004.1, "7144000000.0": 53851066.7, "7145000000.0": 53851129.3, "7146000000.0": 53851191.9, "7147000000.0": 53851254.5, "7148000000.0": 53851317.0, "7149000000.0": 53851379.5, "7150000000.0": 53851442.0, "7151000000.0": 53851504.5, "7152000000.0": 53851567.0, "7153000000.0": 53851629.4, "7154000000.0": 53851691.9, "7155000000.0": 53851754.3, "7156000000.0": 53851816.7, "7157000000.0": 53851879.1, "7158000000.0": 53851941.4, "7159000000.0": 53852003.8, "7160000000.0": 53852066.1, "7161000000.0": 53852128.4, "7162000000.0": 53852190.7, "7163000000.0": 53852253.0, "7164000000.0": 53852315.3, "7165000000.0": 53852377.5, "7166000000.0": 53852439.8, "7167000000.0": 53852502.0, "7168000000.0": 53852564.2, "7169000000.0": 53852626.4, "7170000000.0": 53852688.5, "7171000000.0": 53852750.7, "7172000000.0": 53852812.8, "7173000000.0": 53852874.9, "7174000000.0": 53852937.0, "7175000000.0": 53852999.1, "7176000000.0": 53853061.1, "7177000000.0": 53853123.2, "7178000000.0": 53853185.2, "7179000000.0": 53853247.2, "7180000000.0": 53853309.2, "7181000000.0": 53853371.2, "7182000000.0": 53853433.1, "7183000000.0": 53853495.0, "7184000000.0": 53853557.0, "7185000000.0": 53853618.9, "7186000000.0": 53853680.8, "7187000000.0": 53853742.6, "7188000000.0": 53853804.5, "7189000000.0": 53853866.3, "7190000000.0": 53853928.1, "7191000000.0": 53853989.9, "7192000000.0": 53854051.7, "7193000000.0": 53854113.5, "7194000000.0": 53854175.2, "7195000000.0": 53854237.0, "7196000000.0": 53854298.7, "7197000000.0": 53854360.4, "7198000000.0": 53854422.1, "7199000000.0": 53854483.7, "7200000000.0": 53854545.4, "7201000000.0": 53854607.0, "7202000000.0": 53854668.6, "7203000000.0": 53854730.2, "7204000000.0": 53854791.8, "7205000000.0": 53854853.4, "7206000000.0": 53854914.9, "7207000000.0": 53854976.4, "7208000000.0": 53855038.0, "7209000000.0": 53855099.5, "7210000000.0": 53855160.9, "7211000000.0": 53855222.4, "7212000000.0": 53855283.8, "7213000000.0": 53855345.3, "7214000000.0": 53855406.7, "7215000000.0": 53855468.1, "7216000000.0": 53855529.4, "7217000000.0": 53855590.8, "7218000000.0": 53855652.2, "7219000000.0": 53855713.5, "7220000000.0": 53855774.8, "7221000000.0": 53855836.1, "7222000000.0": 53855897.4, "7223000000.0": 53855958.6, "7224000000.0": 53856019.9, "7225000000.0": 53856081.1, "7226000000.0": 53856142.3, "7227000000.0": 53856203.5, "7228000000.0": 53856264.7, "7229000000.0": 53856325.8, "7230000000.0": 53856387.0, "7231000000.0": 53856448.1, "7232000000.0": 53856509.2, "7233000000.0": 53856570.3, "7234000000.0": 53856631.4, "7235000000.0": 53856692.4, "7236000000.0": 53856753.5, "7237000000.0": 53856814.5, "7238000000.0": 53856875.5, "7239000000.0": 53856936.5, "7240000000.0": 53856997.5, "7241000000.0": 53857058.4, "7242000000.0": 53857119.4, "7243000000.0": 53857180.3, "7244000000.0": 53857241.2, "7245000000.0": 53857302.1, "7246000000.0": 53857363.0, "7247000000.0": 53857423.8, "7248000000.0": 53857484.7, "7249000000.0": 53857545.5, "7250000000.0": 53857606.3, "7251000000.0": 53857667.1, "7252000000.0": 53857727.9, "7253000000.0": 53857788.6, "7254000000.0": 53857849.4, "7255000000.0": 53857910.1, "7256000000.0": 53857970.8, "7257000000.0": 53858031.5, "7258000000.0": 53858092.2, "7259000000.0": 53858152.8, "7260000000.0": 53858213.5, "7261000000.0": 53858274.1, "7262000000.0": 53858334.7, "7263000000.0": 53858395.3, "7264000000.0": 53858455.9, "7265000000.0": 53858516.4, "7266000000.0": 53858577.0, "7267000000.0": 53858637.5, "7268000000.0": 53858698.0, "7269000000.0": 53858758.5, "7270000000.0": 53858819.0, "7271000000.0": 53858879.4, "7272000000.0": 53858939.9, "7273000000.0": 53859000.3, "7274000000.0": 53859060.7, "7275000000.0": 53859121.1, "7276000000.0": 53859181.5, "7277000000.0": 53859241.8, "7278000000.0": 53859302.2, "7279000000.0": 53859362.5, "7280000000.0": 53859422.8, "7281000000.0": 53859483.1, "7282000000.0": 53859543.4, "7283000000.0": 53859603.7, "7284000000.0": 53859663.9, "7285000000.0": 53859724.1, "7286000000.0": 53859784.3, "7287000000.0": 53859844.5, "7288000000.0": 53859904.7, "7289000000.0": 53859964.9, "7290000000.0": 53860025.0, "7291000000.0": 53860085.2, "7292000000.0": 53860145.3, "7293000000.0": 53860205.4, "7294000000.0": 53860265.5, "7295000000.0": 53860325.5, "7296000000.0": 53860385.6, "7297000000.0": 53860445.6, "7298000000.0": 53860505.6, "7299000000.0": 53860565.6, "7300000000.0": 53860625.6, "7301000000.0": 53860685.6, "7302000000.0": 53860745.5, "7303000000.0": 53860805.5, "7304000000.0": 53860865.4, "7305000000.0": 53860925.3, "7306000000.0": 53860985.2, "7307000000.0": 53861045.0, "7308000000.0": 53861104.9, "7309000000.0": 53861164.7, "7310000000.0": 53861224.6, "7311000000.0": 53861284.4, "7312000000.0": 53861344.2, "7313000000.0": 53861403.9, "7314000000.0": 53861463.7, "7315000000.0": 53861523.4, "7316000000.0": 53861583.1, "7317000000.0": 53861642.9, "7318000000.0": 53861702.6, "7319000000.0": 53861762.2, "7320000000.0": 53861821.9, "7321000000.0": 53861881.5, "7322000000.0": 53861941.2, "7323000000.0": 53862000.8, "7324000000.0": 53862060.4, "7325000000.0": 53862119.9, "7326000000.0": 53862179.5, "7327000000.0": 53862239.1, "7328000000.0": 53862298.6, "7329000000.0": 53862358.1, "7330000000.0": 53862417.6, "7331000000.0": 53862477.1, "7332000000.0": 53862536.5, "7333000000.0": 53862596.0, "7334000000.0": 53862655.4, "7335000000.0": 53862714.8, "7336000000.0": 53862774.2, "7337000000.0": 53862833.6, "7338000000.0": 53862893.0, "7339000000.0": 53862952.4, "7340000000.0": 53863011.7, "7341000000.0": 53863071.0, "7342000000.0": 53863130.3, "7343000000.0": 53863189.6, "7344000000.0": 53863248.9, "7345000000.0": 53863308.1, "7346000000.0": 53863367.4, "7347000000.0": 53863426.6, "7348000000.0": 53863485.8, "7349000000.0": 53863545.0, "7350000000.0": 53863604.2, "7351000000.0": 53863663.4, "7352000000.0": 53863722.5, "7353000000.0": 53863781.6, "7354000000.0": 53863840.7, "7355000000.0": 53863899.8, "7356000000.0": 53863958.9, "7357000000.0": 53864018.0, "7358000000.0": 53864077.0, "7359000000.0": 53864136.1, "7360000000.0": 53864195.1, "7361000000.0": 53864254.1, "7362000000.0": 53864313.1, "7363000000.0": 53864372.0, "7364000000.0": 53864431.0, "7365000000.0": 53864489.9, "7366000000.0": 53864548.9, "7367000000.0": 53864607.8, "7368000000.0": 53864666.7, "7369000000.0": 53864725.5, "7370000000.0": 53864784.4, "7371000000.0": 53864843.2, "7372000000.0": 53864902.1, "7373000000.0": 53864960.9, "7374000000.0": 53865019.7, "7375000000.0": 53865078.5, "7376000000.0": 53865137.2, "7377000000.0": 53865196.0, "7378000000.0": 53865254.7, "7379000000.0": 53865313.4, "7380000000.0": 53865372.1, "7381000000.0": 53865430.8, "7382000000.0": 53865489.5, "7383000000.0": 53865548.1, "7384000000.0": 53865606.8, "7385000000.0": 53865665.4, "7386000000.0": 53865724.0, "7387000000.0": 53865782.6, "7388000000.0": 53865841.2, "7389000000.0": 53865899.7, "7390000000.0": 53865958.3, "7391000000.0": 53866016.8, "7392000000.0": 53866075.3, "7393000000.0": 53866133.8, "7394000000.0": 53866192.3, "7395000000.0": 53866250.8, "7396000000.0": 53866309.2, "7397000000.0": 53866367.6, "7398000000.0": 53866426.1, "7399000000.0": 53866484.5, "7400000000.0": 53866542.8, "7401000000.0": 53866601.2, "7402000000.0": 53866659.6, "7403000000.0": 53866717.9, "7404000000.0": 53866776.2, "7405000000.0": 53866834.5, "7406000000.0": 53866892.8, "7407000000.0": 53866951.1, "7408000000.0": 53867009.4, "7409000000.0": 53867067.6, "7410000000.0": 53867125.9, "7411000000.0": 53867184.1, "7412000000.0": 53867242.3, "7413000000.0": 53867300.5, "7414000000.0": 53867358.6, "7415000000.0": 53867416.8, "7416000000.0": 53867474.9, "7417000000.0": 53867533.0, "7418000000.0": 53867591.1, "7419000000.0": 53867649.2, "7420000000.0": 53867707.3, "7421000000.0": 53867765.4, "7422000000.0": 53867823.4, "7423000000.0": 53867881.4, "7424000000.0": 53867939.5, "7425000000.0": 53867997.5, "7426000000.0": 53868055.4, "7427000000.0": 53868113.4, "7428000000.0": 53868171.4, "7429000000.0": 53868229.3, "7430000000.0": 53868287.2, "7431000000.0": 53868345.1, "7432000000.0": 53868403.0, "7433000000.0": 53868460.9, "7434000000.0": 53868518.7, "7435000000.0": 53868576.6, "7436000000.0": 53868634.4, "7437000000.0": 53868692.2, "7438000000.0": 53868750.0, "7439000000.0": 53868807.8, "7440000000.0": 53868865.6, "7441000000.0": 53868923.3, "7442000000.0": 53868981.0, "7443000000.0": 53869038.8, "7444000000.0": 53869096.5, "7445000000.0": 53869154.2, "7446000000.0": 53869211.8, "7447000000.0": 53869269.5, "7448000000.0": 53869327.1, "7449000000.0": 53869384.8, "7450000000.0": 53869442.4, "7451000000.0": 53869500.0, "7452000000.0": 53869557.6, "7453000000.0": 53869615.1, "7454000000.0": 53869672.7, "7455000000.0": 53869730.2, "7456000000.0": 53869787.7, "7457000000.0": 53869845.2, "7458000000.0": 53869902.7, "7459000000.0": 53869960.2, "7460000000.0": 53870017.7, "7461000000.0": 53870075.1, "7462000000.0": 53870132.5, "7463000000.0": 53870189.9, "7464000000.0": 53870247.3, "7465000000.0": 53870304.7, "7466000000.0": 53870362.1, "7467000000.0": 53870419.4, "7468000000.0": 53870476.8, "7469000000.0": 53870534.1, "7470000000.0": 53870591.4, "7471000000.0": 53870648.7, "7472000000.0": 53870706.0, "7473000000.0": 53870763.2, "7474000000.0": 53870820.5, "7475000000.0": 53870877.7, "7476000000.0": 53870934.9, "7477000000.0": 53870992.1, "7478000000.0": 53871049.3, "7479000000.0": 53871106.5, "7480000000.0": 53871163.6, "7481000000.0": 53871220.8, "7482000000.0": 53871277.9, "7483000000.0": 53871335.0, "7484000000.0": 53871392.1, "7485000000.0": 53871449.2, "7486000000.0": 53871506.2, "7487000000.0": 53871563.3, "7488000000.0": 53871620.3, "7489000000.0": 53871677.3, "7490000000.0": 53871734.3, "7491000000.0": 53871791.3, "7492000000.0": 53871848.3, "7493000000.0": 53871905.3, "7494000000.0": 53871962.2, "7495000000.0": 53872019.1, "7496000000.0": 53872076.1, "7497000000.0": 53872132.9, "7498000000.0": 53872189.8, "7499000000.0": 53872246.7, "7500000000.0": 53872303.6, "7501000000.0": 53872360.4, "7502000000.0": 53872417.2, "7503000000.0": 53872474.0, "7504000000.0": 53872530.8, "7505000000.0": 53872587.6, "7506000000.0": 53872644.4, "7507000000.0": 53872701.1, "7508000000.0": 53872757.8, "7509000000.0": 53872814.6, "7510000000.0": 53872871.3, "7511000000.0": 53872927.9, "7512000000.0": 53872984.6, "7513000000.0": 53873041.3, "7514000000.0": 53873097.9, "7515000000.0": 53873154.5, "7516000000.0": 53873211.2, "7517000000.0": 53873267.8, "7518000000.0": 53873324.3, "7519000000.0": 53873380.9, "7520000000.0": 53873437.5, "7521000000.0": 53873494.0, "7522000000.0": 53873550.5, "7523000000.0": 53873607.0, "7524000000.0": 53873663.5, "7525000000.0": 53873720.0, "7526000000.0": 53873776.5, "7527000000.0": 53873832.9, "7528000000.0": 53873889.3, "7529000000.0": 53873945.8, "7530000000.0": 53874002.2, "7531000000.0": 53874058.6, "7532000000.0": 53874114.9, "7533000000.0": 53874171.3, "7534000000.0": 53874227.6, "7535000000.0": 53874284.0, "7536000000.0": 53874340.3, "7537000000.0": 53874396.6, "7538000000.0": 53874452.9, "7539000000.0": 53874509.1, "7540000000.0": 53874565.4, "7541000000.0": 53874621.6, "7542000000.0": 53874677.9, "7543000000.0": 53874734.1, "7544000000.0": 53874790.3, "7545000000.0": 53874846.4, "7546000000.0": 53874902.6, "7547000000.0": 53874958.8, "7548000000.0": 53875014.9, "7549000000.0": 53875071.0, "7550000000.0": 53875127.1, "7551000000.0": 53875183.2, "7552000000.0": 53875239.3, "7553000000.0": 53875295.4, "7554000000.0": 53875351.4, "7555000000.0": 53875407.5, "7556000000.0": 53875463.5, "7557000000.0": 53875519.5, "7558000000.0": 53875575.5, "7559000000.0": 53875631.4, "7560000000.0": 53875687.4, "7561000000.0": 53875743.4, "7562000000.0": 53875799.3, "7563000000.0": 53875855.2, "7564000000.0": 53875911.1, "7565000000.0": 53875967.0, "7566000000.0": 53876022.9, "7567000000.0": 53876078.7, "7568000000.0": 53876134.6, "7569000000.0": 53876190.4, "7570000000.0": 53876246.2, "7571000000.0": 53876302.0, "7572000000.0": 53876357.8, "7573000000.0": 53876413.6, "7574000000.0": 53876469.3, "7575000000.0": 53876525.1, "7576000000.0": 53876580.8, "7577000000.0": 53876636.5, "7578000000.0": 53876692.2, "7579000000.0": 53876747.9, "7580000000.0": 53876803.5, "7581000000.0": 53876859.2, "7582000000.0": 53876914.8, "7583000000.0": 53876970.5, "7584000000.0": 53877026.1, "7585000000.0": 53877081.7, "7586000000.0": 53877137.3, "7587000000.0": 53877192.8, "7588000000.0": 53877248.4, "7589000000.0": 53877303.9, "7590000000.0": 53877359.4, "7591000000.0": 53877414.9, "7592000000.0": 53877470.4, "7593000000.0": 53877525.9, "7594000000.0": 53877581.4, "7595000000.0": 53877636.8, "7596000000.0": 53877692.3, "7597000000.0": 53877747.7, "7598000000.0": 53877803.1, "7599000000.0": 53877858.5, "7600000000.0": 53877913.9, "7601000000.0": 53877969.2, "7602000000.0": 53878024.6, "7603000000.0": 53878079.9, "7604000000.0": 53878135.2, "7605000000.0": 53878190.5, "7606000000.0": 53878245.8, "7607000000.0": 53878301.1, "7608000000.0": 53878356.4, "7609000000.0": 53878411.6, "7610000000.0": 53878466.8, "7611000000.0": 53878522.1, "7612000000.0": 53878577.3, "7613000000.0": 53878632.5, "7614000000.0": 53878687.6, "7615000000.0": 53878742.8, "7616000000.0": 53878797.9, "7617000000.0": 53878853.1, "7618000000.0": 53878908.2, "7619000000.0": 53878963.3, "7620000000.0": 53879018.4, "7621000000.0": 53879073.5, "7622000000.0": 53879128.5, "7623000000.0": 53879183.6, "7624000000.0": 53879238.6, "7625000000.0": 53879293.6, "7626000000.0": 53879348.6, "7627000000.0": 53879403.6, "7628000000.0": 53879458.6, "7629000000.0": 53879513.6, "7630000000.0": 53879568.5, "7631000000.0": 53879623.4, "7632000000.0": 53879678.4, "7633000000.0": 53879733.3, "7634000000.0": 53879788.1, "7635000000.0": 53879843.0, "7636000000.0": 53879897.9, "7637000000.0": 53879952.7, "7638000000.0": 53880007.6, "7639000000.0": 53880062.4, "7640000000.0": 53880117.2, "7641000000.0": 53880172.0, "7642000000.0": 53880226.8, "7643000000.0": 53880281.5, "7644000000.0": 53880336.3, "7645000000.0": 53880391.0, "7646000000.0": 53880445.7, "7647000000.0": 53880500.4, "7648000000.0": 53880555.1, "7649000000.0": 53880609.8, "7650000000.0": 53880664.4, "7651000000.0": 53880719.1, "7652000000.0": 53880773.7, "7653000000.0": 53880828.3, "7654000000.0": 53880883.0, "7655000000.0": 53880937.5, "7656000000.0": 53880992.1, "7657000000.0": 53881046.7, "7658000000.0": 53881101.2, "7659000000.0": 53881155.8, "7660000000.0": 53881210.3, "7661000000.0": 53881264.8, "7662000000.0": 53881319.3, "7663000000.0": 53881373.8, "7664000000.0": 53881428.2, "7665000000.0": 53881482.7, "7666000000.0": 53881537.1, "7667000000.0": 53881591.5, "7668000000.0": 53881645.9, "7669000000.0": 53881700.3, "7670000000.0": 53881754.7, "7671000000.0": 53881809.1, "7672000000.0": 53881863.4, "7673000000.0": 53881917.8, "7674000000.0": 53881972.1, "7675000000.0": 53882026.4, "7676000000.0": 53882080.7, "7677000000.0": 53882135.0, "7678000000.0": 53882189.2, "7679000000.0": 53882243.5, "7680000000.0": 53882297.7, "7681000000.0": 53882352.0, "7682000000.0": 53882406.2, "7683000000.0": 53882460.4, "7684000000.0": 53882514.6, "7685000000.0": 53882568.7, "7686000000.0": 53882622.9, "7687000000.0": 53882677.0, "7688000000.0": 53882731.1, "7689000000.0": 53882785.3, "7690000000.0": 53882839.4, "7691000000.0": 53882893.4, "7692000000.0": 53882947.5, "7693000000.0": 53883001.6, "7694000000.0": 53883055.6, "7695000000.0": 53883109.6, "7696000000.0": 53883163.7, "7697000000.0": 53883217.7, "7698000000.0": 53883271.7, "7699000000.0": 53883325.6, "7700000000.0": 53883379.6, "7701000000.0": 53883433.5, "7702000000.0": 53883487.5, "7703000000.0": 53883541.4, "7704000000.0": 53883595.3, "7705000000.0": 53883649.2, "7706000000.0": 53883703.1, "7707000000.0": 53883756.9, "7708000000.0": 53883810.8, "7709000000.0": 53883864.6, "7710000000.0": 53883918.4, "7711000000.0": 53883972.2, "7712000000.0": 53884026.0, "7713000000.0": 53884079.8, "7714000000.0": 53884133.6, "7715000000.0": 53884187.3, "7716000000.0": 53884241.1, "7717000000.0": 53884294.8, "7718000000.0": 53884348.5, "7719000000.0": 53884402.2, "7720000000.0": 53884455.9, "7721000000.0": 53884509.5, "7722000000.0": 53884563.2, "7723000000.0": 53884616.8, "7724000000.0": 53884670.5, "7725000000.0": 53884724.1, "7726000000.0": 53884777.7, "7727000000.0": 53884831.3, "7728000000.0": 53884884.8, "7729000000.0": 53884938.4, "7730000000.0": 53884991.9, "7731000000.0": 53885045.5, "7732000000.0": 53885099.0, "7733000000.0": 53885152.5, "7734000000.0": 53885206.0, "7735000000.0": 53885259.5, "7736000000.0": 53885312.9, "7737000000.0": 53885366.4, "7738000000.0": 53885419.8, "7739000000.0": 53885473.2, "7740000000.0": 53885526.6, "7741000000.0": 53885580.0, "7742000000.0": 53885633.4, "7743000000.0": 53885686.8, "7744000000.0": 53885740.1, "7745000000.0": 53885793.5, "7746000000.0": 53885846.8, "7747000000.0": 53885900.1, "7748000000.0": 53885953.4, "7749000000.0": 53886006.7, "7750000000.0": 53886060.0, "7751000000.0": 53886113.2, "7752000000.0": 53886166.5, "7753000000.0": 53886219.7, "7754000000.0": 53886272.9, "7755000000.0": 53886326.1, "7756000000.0": 53886379.3, "7757000000.0": 53886432.5, "7758000000.0": 53886485.6, "7759000000.0": 53886538.8, "7760000000.0": 53886591.9, "7761000000.0": 53886645.0, "7762000000.0": 53886698.2, "7763000000.0": 53886751.2, "7764000000.0": 53886804.3, "7765000000.0": 53886857.4, "7766000000.0": 53886910.5, "7767000000.0": 53886963.5, "7768000000.0": 53887016.5, "7769000000.0": 53887069.5, "7770000000.0": 53887122.5, "7771000000.0": 53887175.5, "7772000000.0": 53887228.5, "7773000000.0": 53887281.4, "7774000000.0": 53887334.4, "7775000000.0": 53887387.3, "7776000000.0": 53887440.2, "7777000000.0": 53887493.1, "7778000000.0": 53887546.0, "7779000000.0": 53887598.9, "7780000000.0": 53887651.8, "7781000000.0": 53887704.6, "7782000000.0": 53887757.5, "7783000000.0": 53887810.3, "7784000000.0": 53887863.1, "7785000000.0": 53887915.9, "7786000000.0": 53887968.7, "7787000000.0": 53888021.5, "7788000000.0": 53888074.2, "7789000000.0": 53888127.0, "7790000000.0": 53888179.7, "7791000000.0": 53888232.4, "7792000000.0": 53888285.1, "7793000000.0": 53888337.8, "7794000000.0": 53888390.5, "7795000000.0": 53888443.1, "7796000000.0": 53888495.8, "7797000000.0": 53888548.4, "7798000000.0": 53888601.0, "7799000000.0": 53888653.6, "7800000000.0": 53888706.2, "7801000000.0": 53888758.8, "7802000000.0": 53888811.4, "7803000000.0": 53888863.9, "7804000000.0": 53888916.5, "7805000000.0": 53888969.0, "7806000000.0": 53889021.5, "7807000000.0": 53889074.0, "7808000000.0": 53889126.5, "7809000000.0": 53889179.0, "7810000000.0": 53889231.5, "7811000000.0": 53889283.9, "7812000000.0": 53889336.3, "7813000000.0": 53889388.8, "7814000000.0": 53889441.2, "7815000000.0": 53889493.6, "7816000000.0": 53889546.0, "7817000000.0": 53889598.3, "7818000000.0": 53889650.7, "7819000000.0": 53889703.0, "7820000000.0": 53889755.4, "7821000000.0": 53889807.7, "7822000000.0": 53889860.0, "7823000000.0": 53889912.3, "7824000000.0": 53889964.5, "7825000000.0": 53890016.8, "7826000000.0": 53890069.0, "7827000000.0": 53890121.3, "7828000000.0": 53890173.5, "7829000000.0": 53890225.7, "7830000000.0": 53890277.9, "7831000000.0": 53890330.1, "7832000000.0": 53890382.3, "7833000000.0": 53890434.4, "7834000000.0": 53890486.6, "7835000000.0": 53890538.7, "7836000000.0": 53890590.8, "7837000000.0": 53890642.9, "7838000000.0": 53890695.0, "7839000000.0": 53890747.1, "7840000000.0": 53890799.2, "7841000000.0": 53890851.2, "7842000000.0": 53890903.2, "7843000000.0": 53890955.3, "7844000000.0": 53891007.3, "7845000000.0": 53891059.3, "7846000000.0": 53891111.3, "7847000000.0": 53891163.2, "7848000000.0": 53891215.2, "7849000000.0": 53891267.1, "7850000000.0": 53891319.1, "7851000000.0": 53891371.0, "7852000000.0": 53891422.9, "7853000000.0": 53891474.8, "7854000000.0": 53891526.7, "7855000000.0": 53891578.5, "7856000000.0": 53891630.4, "7857000000.0": 53891682.2, "7858000000.0": 53891734.1, "7859000000.0": 53891785.9, "7860000000.0": 53891837.7, "7861000000.0": 53891889.5, "7862000000.0": 53891941.2, "7863000000.0": 53891993.0, "7864000000.0": 53892044.8, "7865000000.0": 53892096.5, "7866000000.0": 53892148.2, "7867000000.0": 53892199.9, "7868000000.0": 53892251.6, "7869000000.0": 53892303.3, "7870000000.0": 53892355.0, "7871000000.0": 53892406.6, "7872000000.0": 53892458.3, "7873000000.0": 53892509.9, "7874000000.0": 53892561.5, "7875000000.0": 53892613.1, "7876000000.0": 53892664.7, "7877000000.0": 53892716.3, "7878000000.0": 53892767.9, "7879000000.0": 53892819.4, "7880000000.0": 53892871.0, "7881000000.0": 53892922.5, "7882000000.0": 53892974.0, "7883000000.0": 53893025.5, "7884000000.0": 53893077.0, "7885000000.0": 53893128.5, "7886000000.0": 53893179.9, "7887000000.0": 53893231.4, "7888000000.0": 53893282.8, "7889000000.0": 53893334.3, "7890000000.0": 53893385.7, "7891000000.0": 53893437.1, "7892000000.0": 53893488.5, "7893000000.0": 53893539.8, "7894000000.0": 53893591.2, "7895000000.0": 53893642.5, "7896000000.0": 53893693.9, "7897000000.0": 53893745.2, "7898000000.0": 53893796.5, "7899000000.0": 53893847.8, "7900000000.0": 53893899.1, "7901000000.0": 53893950.3, "7902000000.0": 53894001.6, "7903000000.0": 53894052.8, "7904000000.0": 53894104.1, "7905000000.0": 53894155.3, "7906000000.0": 53894206.5, "7907000000.0": 53894257.7, "7908000000.0": 53894308.9, "7909000000.0": 53894360.0, "7910000000.0": 53894411.2, "7911000000.0": 53894462.3, "7912000000.0": 53894513.5, "7913000000.0": 53894564.6, "7914000000.0": 53894615.7, "7915000000.0": 53894666.8, "7916000000.0": 53894717.8, "7917000000.0": 53894768.9, "7918000000.0": 53894820.0, "7919000000.0": 53894871.0, "7920000000.0": 53894922.0, "7921000000.0": 53894973.0, "7922000000.0": 53895024.0, "7923000000.0": 53895075.0, "7924000000.0": 53895126.0, "7925000000.0": 53895177.0, "7926000000.0": 53895227.9, "7927000000.0": 53895278.8, "7928000000.0": 53895329.8, "7929000000.0": 53895380.7, "7930000000.0": 53895431.6, "7931000000.0": 53895482.5, "7932000000.0": 53895533.3, "7933000000.0": 53895584.2, "7934000000.0": 53895635.0, "7935000000.0": 53895685.9, "7936000000.0": 53895736.7, "7937000000.0": 53895787.5, "7938000000.0": 53895838.3, "7939000000.0": 53895889.1, "7940000000.0": 53895939.9, "7941000000.0": 53895990.6, "7942000000.0": 53896041.4, "7943000000.0": 53896092.1, "7944000000.0": 53896142.8, "7945000000.0": 53896193.5, "7946000000.0": 53896244.2, "7947000000.0": 53896294.9, "7948000000.0": 53896345.6, "7949000000.0": 53896396.2, "7950000000.0": 53896446.9, "7951000000.0": 53896497.5, "7952000000.0": 53896548.1, "7953000000.0": 53896598.7, "7954000000.0": 53896649.3, "7955000000.0": 53896699.9, "7956000000.0": 53896750.5, "7957000000.0": 53896801.0, "7958000000.0": 53896851.6, "7959000000.0": 53896902.1, "7960000000.0": 53896952.6, "7961000000.0": 53897003.1, "7962000000.0": 53897053.6, "7963000000.0": 53897104.1, "7964000000.0": 53897154.6, "7965000000.0": 53897205.0, "7966000000.0": 53897255.5, "7967000000.0": 53897305.9, "7968000000.0": 53897356.3, "7969000000.0": 53897406.7, "7970000000.0": 53897457.1, "7971000000.0": 53897507.5, "7972000000.0": 53897557.9, "7973000000.0": 53897608.2, "7974000000.0": 53897658.6, "7975000000.0": 53897708.9, "7976000000.0": 53897759.2, "7977000000.0": 53897809.5, "7978000000.0": 53897859.8, "7979000000.0": 53897910.1, "7980000000.0": 53897960.3, "7981000000.0": 53898010.6, "7982000000.0": 53898060.8, "7983000000.0": 53898111.1, "7984000000.0": 53898161.3, "7985000000.0": 53898211.5, "7986000000.0": 53898261.7, "7987000000.0": 53898311.9, "7988000000.0": 53898362.0, "7989000000.0": 53898412.2, "7990000000.0": 53898462.3, "7991000000.0": 53898512.5, "7992000000.0": 53898562.6, "7993000000.0": 53898612.7, "7994000000.0": 53898662.8, "7995000000.0": 53898712.8, "7996000000.0": 53898762.9, "7997000000.0": 53898813.0, "7998000000.0": 53898863.0, "7999000000.0": 53898913.0, "8000000000.0": 53898963.1, "8001000000.0": 53899013.1, "8002000000.0": 53899063.1, "8003000000.0": 53899113.0, "8004000000.0": 53899163.0, "8005000000.0": 53899213.0, "8006000000.0": 53899262.9, "8007000000.0": 53899312.8, "8008000000.0": 53899362.8, "8009000000.0": 53899412.7, "8010000000.0": 53899462.6, "8011000000.0": 53899512.4, "8012000000.0": 53899562.3, "8013000000.0": 53899612.2, "8014000000.0": 53899662.0, "8015000000.0": 53899711.8, "8016000000.0": 53899761.7, "8017000000.0": 53899811.5, "8018000000.0": 53899861.3, "8019000000.0": 53899911.0, "8020000000.0": 53899960.8, "8021000000.0": 53900010.6, "8022000000.0": 53900060.3, "8023000000.0": 53900110.1, "8024000000.0": 53900159.8, "8025000000.0": 53900209.5, "8026000000.0": 53900259.2, "8027000000.0": 53900308.9, "8028000000.0": 53900358.5, "8029000000.0": 53900408.2, "8030000000.0": 53900457.8, "8031000000.0": 53900507.5, "8032000000.0": 53900557.1, "8033000000.0": 53900606.7, "8034000000.0": 53900656.3, "8035000000.0": 53900705.9, "8036000000.0": 53900755.5, "8037000000.0": 53900805.0, "8038000000.0": 53900854.6, "8039000000.0": 53900904.1, "8040000000.0": 53900953.6, "8041000000.0": 53901003.2, "8042000000.0": 53901052.7, "8043000000.0": 53901102.2, "8044000000.0": 53901151.6, "8045000000.0": 53901201.1, "8046000000.0": 53901250.5, "8047000000.0": 53901300.0, "8048000000.0": 53901349.4, "8049000000.0": 53901398.8, "8050000000.0": 53901448.2, "8051000000.0": 53901497.6, "8052000000.0": 53901547.0, "8053000000.0": 53901596.4, "8054000000.0": 53901645.7, "8055000000.0": 53901695.1, "8056000000.0": 53901744.4, "8057000000.0": 53901793.7, "8058000000.0": 53901843.0, "8059000000.0": 53901892.3, "8060000000.0": 53901941.6, "8061000000.0": 53901990.9, "8062000000.0": 53902040.1, "8063000000.0": 53902089.4, "8064000000.0": 53902138.6, "8065000000.0": 53902187.8, "8066000000.0": 53902237.0, "8067000000.0": 53902286.2, "8068000000.0": 53902335.4, "8069000000.0": 53902384.6, "8070000000.0": 53902433.7, "8071000000.0": 53902482.9, "8072000000.0": 53902532.0, "8073000000.0": 53902581.1, "8074000000.0": 53902630.3, "8075000000.0": 53902679.4, "8076000000.0": 53902728.4, "8077000000.0": 53902777.5, "8078000000.0": 53902826.6, "8079000000.0": 53902875.6, "8080000000.0": 53902924.7, "8081000000.0": 53902973.7, "8082000000.0": 53903022.7, "8083000000.0": 53903071.7, "8084000000.0": 53903120.7, "8085000000.0": 53903169.7, "8086000000.0": 53903218.7, "8087000000.0": 53903267.6, "8088000000.0": 53903316.6, "8089000000.0": 53903365.5, "8090000000.0": 53903414.4, "8091000000.0": 53903463.3, "8092000000.0": 53903512.2, "8093000000.0": 53903561.1, "8094000000.0": 53903610.0, "8095000000.0": 53903658.8, "8096000000.0": 53903707.7, "8097000000.0": 53903756.5, "8098000000.0": 53903805.3, "8099000000.0": 53903854.1, "8100000000.0": 53903902.9, "8101000000.0": 53903951.7, "8102000000.0": 53904000.5, "8103000000.0": 53904049.3, "8104000000.0": 53904098.0, "8105000000.0": 53904146.8, "8106000000.0": 53904195.5, "8107000000.0": 53904244.2, "8108000000.0": 53904292.9, "8109000000.0": 53904341.6, "8110000000.0": 53904390.3, "8111000000.0": 53904438.9, "8112000000.0": 53904487.6, "8113000000.0": 53904536.2, "8114000000.0": 53904584.9, "8115000000.0": 53904633.5, "8116000000.0": 53904682.1, "8117000000.0": 53904730.7, "8118000000.0": 53904779.3, "8119000000.0": 53904827.9, "8120000000.0": 53904876.4, "8121000000.0": 53904925.0, "8122000000.0": 53904973.5, "8123000000.0": 53905022.0, "8124000000.0": 53905070.6, "8125000000.0": 53905119.1, "8126000000.0": 53905167.5, "8127000000.0": 53905216.0, "8128000000.0": 53905264.5, "8129000000.0": 53905312.9, "8130000000.0": 53905361.4, "8131000000.0": 53905409.8, "8132000000.0": 53905458.2, "8133000000.0": 53905506.6, "8134000000.0": 53905555.0, "8135000000.0": 53905603.4, "8136000000.0": 53905651.8, "8137000000.0": 53905700.2, "8138000000.0": 53905748.5, "8139000000.0": 53905796.8, "8140000000.0": 53905845.2, "8141000000.0": 53905893.5, "8142000000.0": 53905941.8, "8143000000.0": 53905990.1, "8144000000.0": 53906038.3, "8145000000.0": 53906086.6, "8146000000.0": 53906134.9, "8147000000.0": 53906183.1, "8148000000.0": 53906231.3, "8149000000.0": 53906279.6, "8150000000.0": 53906327.8, "8151000000.0": 53906376.0, "8152000000.0": 53906424.1, "8153000000.0": 53906472.3, "8154000000.0": 53906520.5, "8155000000.0": 53906568.6, "8156000000.0": 53906616.8, "8157000000.0": 53906664.9, "8158000000.0": 53906713.0, "8159000000.0": 53906761.1, "8160000000.0": 53906809.2, "8161000000.0": 53906857.3, "8162000000.0": 53906905.3, "8163000000.0": 53906953.4, "8164000000.0": 53907001.4, "8165000000.0": 53907049.5, "8166000000.0": 53907097.5, "8167000000.0": 53907145.5, "8168000000.0": 53907193.5, "8169000000.0": 53907241.5, "8170000000.0": 53907289.4, "8171000000.0": 53907337.4, "8172000000.0": 53907385.3, "8173000000.0": 53907433.3, "8174000000.0": 53907481.2, "8175000000.0": 53907529.1, "8176000000.0": 53907577.0, "8177000000.0": 53907624.9, "8178000000.0": 53907672.8, "8179000000.0": 53907720.7, "8180000000.0": 53907768.5, "8181000000.0": 53907816.4, "8182000000.0": 53907864.2, "8183000000.0": 53907912.0, "8184000000.0": 53907959.8, "8185000000.0": 53908007.6, "8186000000.0": 53908055.4, "8187000000.0": 53908103.2, "8188000000.0": 53908151.0, "8189000000.0": 53908198.7, "8190000000.0": 53908246.5, "8191000000.0": 53908294.2, "8192000000.0": 53908341.9, "8193000000.0": 53908389.6, "8194000000.0": 53908437.3, "8195000000.0": 53908485.0, "8196000000.0": 53908532.7, "8197000000.0": 53908580.3, "8198000000.0": 53908628.0, "8199000000.0": 53908675.6, "8200000000.0": 53908723.2, "8201000000.0": 53908770.8, "8202000000.0": 53908818.4, "8203000000.0": 53908866.0, "8204000000.0": 53908913.6, "8205000000.0": 53908961.2, "8206000000.0": 53909008.7, "8207000000.0": 53909056.3, "8208000000.0": 53909103.8, "8209000000.0": 53909151.3, "8210000000.0": 53909198.8, "8211000000.0": 53909246.3, "8212000000.0": 53909293.8, "8213000000.0": 53909341.3, "8214000000.0": 53909388.8, "8215000000.0": 53909436.2, "8216000000.0": 53909483.7, "8217000000.0": 53909531.1, "8218000000.0": 53909578.5, "8219000000.0": 53909625.9, "8220000000.0": 53909673.3, "8221000000.0": 53909720.7, "8222000000.0": 53909768.1, "8223000000.0": 53909815.4, "8224000000.0": 53909862.8, "8225000000.0": 53909910.1, "8226000000.0": 53909957.4, "8227000000.0": 53910004.8, "8228000000.0": 53910052.1, "8229000000.0": 53910099.3, "8230000000.0": 53910146.6, "8231000000.0": 53910193.9, "8232000000.0": 53910241.2, "8233000000.0": 53910288.4, "8234000000.0": 53910335.6, "8235000000.0": 53910382.9, "8236000000.0": 53910430.1, "8237000000.0": 53910477.3, "8238000000.0": 53910524.5, "8239000000.0": 53910571.6, "8240000000.0": 53910618.8, "8241000000.0": 53910666.0, "8242000000.0": 53910713.1, "8243000000.0": 53910760.2, "8244000000.0": 53910807.4, "8245000000.0": 53910854.5, "8246000000.0": 53910901.6, "8247000000.0": 53910948.7, "8248000000.0": 53910995.7, "8249000000.0": 53911042.8, "8250000000.0": 53911089.9, "8251000000.0": 53911136.9, "8252000000.0": 53911183.9, "8253000000.0": 53911231.0, "8254000000.0": 53911278.0, "8255000000.0": 53911325.0, "8256000000.0": 53911371.9, "8257000000.0": 53911418.9, "8258000000.0": 53911465.9, "8259000000.0": 53911512.8, "8260000000.0": 53911559.8, "8261000000.0": 53911606.7, "8262000000.0": 53911653.6, "8263000000.0": 53911700.5, "8264000000.0": 53911747.4, "8265000000.0": 53911794.3, "8266000000.0": 53911841.2, "8267000000.0": 53911888.0, "8268000000.0": 53911934.9, "8269000000.0": 53911981.7, "8270000000.0": 53912028.6, "8271000000.0": 53912075.4, "8272000000.0": 53912122.2, "8273000000.0": 53912169.0, "8274000000.0": 53912215.8, "8275000000.0": 53912262.5, "8276000000.0": 53912309.3, "8277000000.0": 53912356.0, "8278000000.0": 53912402.8, "8279000000.0": 53912449.5, "8280000000.0": 53912496.2, "8281000000.0": 53912542.9, "8282000000.0": 53912589.6, "8283000000.0": 53912636.3, "8284000000.0": 53912683.0, "8285000000.0": 53912729.6, "8286000000.0": 53912776.3, "8287000000.0": 53912822.9, "8288000000.0": 53912869.5, "8289000000.0": 53912916.2, "8290000000.0": 53912962.8, "8291000000.0": 53913009.4, "8292000000.0": 53913055.9, "8293000000.0": 53913102.5, "8294000000.0": 53913149.1, "8295000000.0": 53913195.6, "8296000000.0": 53913242.2, "8297000000.0": 53913288.7, "8298000000.0": 53913335.2, "8299000000.0": 53913381.7, "8300000000.0": 53913428.2, "8301000000.0": 53913474.7, "8302000000.0": 53913521.1, "8303000000.0": 53913567.6, "8304000000.0": 53913614.0, "8305000000.0": 53913660.5, "8306000000.0": 53913706.9, "8307000000.0": 53913753.3, "8308000000.0": 53913799.7, "8309000000.0": 53913846.1, "8310000000.0": 53913892.5, "8311000000.0": 53913938.9, "8312000000.0": 53913985.2, "8313000000.0": 53914031.6, "8314000000.0": 53914077.9, "8315000000.0": 53914124.2, "8316000000.0": 53914170.6, "8317000000.0": 53914216.9, "8318000000.0": 53914263.2, "8319000000.0": 53914309.4, "8320000000.0": 53914355.7, "8321000000.0": 53914402.0, "8322000000.0": 53914448.2, "8323000000.0": 53914494.5, "8324000000.0": 53914540.7, "8325000000.0": 53914586.9, "8326000000.0": 53914633.1, "8327000000.0": 53914679.3, "8328000000.0": 53914725.5, "8329000000.0": 53914771.7, "8330000000.0": 53914817.8, "8331000000.0": 53914864.0, "8332000000.0": 53914910.1, "8333000000.0": 53914956.2, "8334000000.0": 53915002.3, "8335000000.0": 53915048.4, "8336000000.0": 53915094.5, "8337000000.0": 53915140.6, "8338000000.0": 53915186.7, "8339000000.0": 53915232.8, "8340000000.0": 53915278.8, "8341000000.0": 53915324.9, "8342000000.0": 53915370.9, "8343000000.0": 53915416.9, "8344000000.0": 53915462.9, "8345000000.0": 53915508.9, "8346000000.0": 53915554.9, "8347000000.0": 53915600.9, "8348000000.0": 53915646.8, "8349000000.0": 53915692.8, "8350000000.0": 53915738.7, "8351000000.0": 53915784.6, "8352000000.0": 53915830.6, "8353000000.0": 53915876.5, "8354000000.0": 53915922.4, "8355000000.0": 53915968.3, "8356000000.0": 53916014.1, "8357000000.0": 53916060.0, "8358000000.0": 53916105.9, "8359000000.0": 53916151.7, "8360000000.0": 53916197.5, "8361000000.0": 53916243.4, "8362000000.0": 53916289.2, "8363000000.0": 53916335.0, "8364000000.0": 53916380.8, "8365000000.0": 53916426.5, "8366000000.0": 53916472.3, "8367000000.0": 53916518.1, "8368000000.0": 53916563.8, "8369000000.0": 53916609.5, "8370000000.0": 53916655.3, "8371000000.0": 53916701.0, "8372000000.0": 53916746.7, "8373000000.0": 53916792.4, "8374000000.0": 53916838.0, "8375000000.0": 53916883.7, "8376000000.0": 53916929.4, "8377000000.0": 53916975.0, "8378000000.0": 53917020.7, "8379000000.0": 53917066.3, "8380000000.0": 53917111.9, "8381000000.0": 53917157.5, "8382000000.0": 53917203.1, "8383000000.0": 53917248.7, "8384000000.0": 53917294.2, "8385000000.0": 53917339.8, "8386000000.0": 53917385.4, "8387000000.0": 53917430.9, "8388000000.0": 53917476.4, "8389000000.0": 53917521.9, "8390000000.0": 53917567.5, "8391000000.0": 53917613.0, "8392000000.0": 53917658.4, "8393000000.0": 53917703.9, "8394000000.0": 53917749.4, "8395000000.0": 53917794.8, "8396000000.0": 53917840.3, "8397000000.0": 53917885.7, "8398000000.0": 53917931.1, "8399000000.0": 53917976.5, "8400000000.0": 53918021.9, "8401000000.0": 53918067.3, "8402000000.0": 53918112.7, "8403000000.0": 53918158.1, "8404000000.0": 53918203.4, "8405000000.0": 53918248.8, "8406000000.0": 53918294.1, "8407000000.0": 53918339.4, "8408000000.0": 53918384.8, "8409000000.0": 53918430.1, "8410000000.0": 53918475.3, "8411000000.0": 53918520.6, "8412000000.0": 53918565.9, "8413000000.0": 53918611.2, "8414000000.0": 53918656.4, "8415000000.0": 53918701.7, "8416000000.0": 53918746.9, "8417000000.0": 53918792.1, "8418000000.0": 53918837.3, "8419000000.0": 53918882.5, "8420000000.0": 53918927.7, "8421000000.0": 53918972.9, "8422000000.0": 53919018.0, "8423000000.0": 53919063.2, "8424000000.0": 53919108.3, "8425000000.0": 53919153.5, "8426000000.0": 53919198.6, "8427000000.0": 53919243.7, "8428000000.0": 53919288.8, "8429000000.0": 53919333.9, "8430000000.0": 53919379.0, "8431000000.0": 53919424.0, "8432000000.0": 53919469.1, "8433000000.0": 53919514.1, "8434000000.0": 53919559.2, "8435000000.0": 53919604.2, "8436000000.0": 53919649.2, "8437000000.0": 53919694.2, "8438000000.0": 53919739.2, "8439000000.0": 53919784.2, "8440000000.0": 53919829.2, "8441000000.0": 53919874.1, "8442000000.0": 53919919.1, "8443000000.0": 53919964.0, "8444000000.0": 53920009.0, "8445000000.0": 53920053.9, "8446000000.0": 53920098.8, "8447000000.0": 53920143.7, "8448000000.0": 53920188.6, "8449000000.0": 53920233.5, "8450000000.0": 53920278.3, "8451000000.0": 53920323.2, "8452000000.0": 53920368.0, "8453000000.0": 53920412.9, "8454000000.0": 53920457.7, "8455000000.0": 53920502.5, "8456000000.0": 53920547.3, "8457000000.0": 53920592.1, "8458000000.0": 53920636.9, "8459000000.0": 53920681.7, "8460000000.0": 53920726.4, "8461000000.0": 53920771.2, "8462000000.0": 53920815.9, "8463000000.0": 53920860.7, "8464000000.0": 53920905.4, "8465000000.0": 53920950.1, "8466000000.0": 53920994.8, "8467000000.0": 53921039.5, "8468000000.0": 53921084.2, "8469000000.0": 53921128.8, "8470000000.0": 53921173.5, "8471000000.0": 53921218.1, "8472000000.0": 53921262.8, "8473000000.0": 53921307.4, "8474000000.0": 53921352.0, "8475000000.0": 53921396.6, "8476000000.0": 53921441.2, "8477000000.0": 53921485.8, "8478000000.0": 53921530.4, "8479000000.0": 53921574.9, "8480000000.0": 53921619.5, "8481000000.0": 53921664.0, "8482000000.0": 53921708.6, "8483000000.0": 53921753.1, "8484000000.0": 53921797.6, "8485000000.0": 53921842.1, "8486000000.0": 53921886.6, "8487000000.0": 53921931.1, "8488000000.0": 53921975.5, "8489000000.0": 53922020.0, "8490000000.0": 53922064.4, "8491000000.0": 53922108.9, "8492000000.0": 53922153.3, "8493000000.0": 53922197.7, "8494000000.0": 53922242.1, "8495000000.0": 53922286.5, "8496000000.0": 53922330.9, "8497000000.0": 53922375.3, "8498000000.0": 53922419.7, "8499000000.0": 53922464.0, "8500000000.0": 53922508.4, "8501000000.0": 53922552.7, "8502000000.0": 53922597.0, "8503000000.0": 53922641.3, "8504000000.0": 53922685.6, "8505000000.0": 53922729.9, "8506000000.0": 53922774.2, "8507000000.0": 53922818.5, "8508000000.0": 53922862.8, "8509000000.0": 53922907.0, "8510000000.0": 53922951.2, "8511000000.0": 53922995.5, "8512000000.0": 53923039.7, "8513000000.0": 53923083.9, "8514000000.0": 53923128.1, "8515000000.0": 53923172.3, "8516000000.0": 53923216.5, "8517000000.0": 53923260.7, "8518000000.0": 53923304.8, "8519000000.0": 53923349.0, "8520000000.0": 53923393.1, "8521000000.0": 53923437.2, "8522000000.0": 53923481.3, "8523000000.0": 53923525.5, "8524000000.0": 53923569.6, "8525000000.0": 53923613.6, "8526000000.0": 53923657.7, "8527000000.0": 53923701.8, "8528000000.0": 53923745.8, "8529000000.0": 53923789.9, "8530000000.0": 53923833.9, "8531000000.0": 53923877.9, "8532000000.0": 53923922.0, "8533000000.0": 53923966.0, "8534000000.0": 53924010.0, "8535000000.0": 53924054.0, "8536000000.0": 53924097.9, "8537000000.0": 53924141.9, "8538000000.0": 53924185.8, "8539000000.0": 53924229.8, "8540000000.0": 53924273.7, "8541000000.0": 53924317.6, "8542000000.0": 53924361.6, "8543000000.0": 53924405.5, "8544000000.0": 53924449.4, "8545000000.0": 53924493.2, "8546000000.0": 53924537.1, "8547000000.0": 53924581.0, "8548000000.0": 53924624.8, "8549000000.0": 53924668.7, "8550000000.0": 53924712.5, "8551000000.0": 53924756.3, "8552000000.0": 53924800.1, "8553000000.0": 53924843.9, "8554000000.0": 53924887.7, "8555000000.0": 53924931.5, "8556000000.0": 53924975.3, "8557000000.0": 53925019.0, "8558000000.0": 53925062.8, "8559000000.0": 53925106.5, "8560000000.0": 53925150.3, "8561000000.0": 53925194.0, "8562000000.0": 53925237.7, "8563000000.0": 53925281.4, "8564000000.0": 53925325.1, "8565000000.0": 53925368.8, "8566000000.0": 53925412.4, "8567000000.0": 53925456.1, "8568000000.0": 53925499.7, "8569000000.0": 53925543.4, "8570000000.0": 53925587.0, "8571000000.0": 53925630.6, "8572000000.0": 53925674.2, "8573000000.0": 53925717.8, "8574000000.0": 53925761.4, "8575000000.0": 53925805.0, "8576000000.0": 53925848.6, "8577000000.0": 53925892.1, "8578000000.0": 53925935.7, "8579000000.0": 53925979.2, "8580000000.0": 53926022.7, "8581000000.0": 53926066.3, "8582000000.0": 53926109.8, "8583000000.0": 53926153.3, "8584000000.0": 53926196.7, "8585000000.0": 53926240.2, "8586000000.0": 53926283.7, "8587000000.0": 53926327.1, "8588000000.0": 53926370.6, "8589000000.0": 53926414.0, "8590000000.0": 53926457.5, "8591000000.0": 53926500.9, "8592000000.0": 53926544.3, "8593000000.0": 53926587.7, "8594000000.0": 53926631.1, "8595000000.0": 53926674.4, "8596000000.0": 53926717.8, "8597000000.0": 53926761.2, "8598000000.0": 53926804.5, "8599000000.0": 53926847.9, "8600000000.0": 53926891.2, "8601000000.0": 53926934.5, "8602000000.0": 53926977.8, "8603000000.0": 53927021.1, "8604000000.0": 53927064.4, "8605000000.0": 53927107.7, "8606000000.0": 53927150.9, "8607000000.0": 53927194.2, "8608000000.0": 53927237.4, "8609000000.0": 53927280.7, "8610000000.0": 53927323.9, "8611000000.0": 53927367.1, "8612000000.0": 53927410.3, "8613000000.0": 53927453.5, "8614000000.0": 53927496.7, "8615000000.0": 53927539.9, "8616000000.0": 53927583.1, "8617000000.0": 53927626.2, "8618000000.0": 53927669.4, "8619000000.0": 53927712.5, "8620000000.0": 53927755.6, "8621000000.0": 53927798.7, "8622000000.0": 53927841.9, "8623000000.0": 53927885.0, "8624000000.0": 53927928.0, "8625000000.0": 53927971.1, "8626000000.0": 53928014.2, "8627000000.0": 53928057.2, "8628000000.0": 53928100.3, "8629000000.0": 53928143.3, "8630000000.0": 53928186.4, "8631000000.0": 53928229.4, "8632000000.0": 53928272.4, "8633000000.0": 53928315.4, "8634000000.0": 53928358.4, "8635000000.0": 53928401.4, "8636000000.0": 53928444.3, "8637000000.0": 53928487.3, "8638000000.0": 53928530.2, "8639000000.0": 53928573.2, "8640000000.0": 53928616.1, "8641000000.0": 53928659.0, "8642000000.0": 53928701.9, "8643000000.0": 53928744.8, "8644000000.0": 53928787.7, "8645000000.0": 53928830.6, "8646000000.0": 53928873.5, "8647000000.0": 53928916.3, "8648000000.0": 53928959.2, "8649000000.0": 53929002.0, "8650000000.0": 53929044.9, "8651000000.0": 53929087.7, "8652000000.0": 53929130.5, "8653000000.0": 53929173.3, "8654000000.0": 53929216.1, "8655000000.0": 53929258.9, "8656000000.0": 53929301.6, "8657000000.0": 53929344.4, "8658000000.0": 53929387.2, "8659000000.0": 53929429.9, "8660000000.0": 53929472.6, "8661000000.0": 53929515.4, "8662000000.0": 53929558.1, "8663000000.0": 53929600.8, "8664000000.0": 53929643.5, "8665000000.0": 53929686.1, "8666000000.0": 53929728.8, "8667000000.0": 53929771.5, "8668000000.0": 53929814.1, "8669000000.0": 53929856.8, "8670000000.0": 53929899.4, "8671000000.0": 53929942.0, "8672000000.0": 53929984.7, "8673000000.0": 53930027.3, "8674000000.0": 53930069.9, "8675000000.0": 53930112.4, "8676000000.0": 53930155.0, "8677000000.0": 53930197.6, "8678000000.0": 53930240.1, "8679000000.0": 53930282.7, "8680000000.0": 53930325.2, "8681000000.0": 53930367.8, "8682000000.0": 53930410.3, "8683000000.0": 53930452.8, "8684000000.0": 53930495.3, "8685000000.0": 53930537.8, "8686000000.0": 53930580.3, "8687000000.0": 53930622.7, "8688000000.0": 53930665.2, "8689000000.0": 53930707.6, "8690000000.0": 53930750.1, "8691000000.0": 53930792.5, "8692000000.0": 53930834.9, "8693000000.0": 53930877.3, "8694000000.0": 53930919.7, "8695000000.0": 53930962.1, "8696000000.0": 53931004.5, "8697000000.0": 53931046.9, "8698000000.0": 53931089.2, "8699000000.0": 53931131.6, "8700000000.0": 53931173.9, "8701000000.0": 53931216.3, "8702000000.0": 53931258.6, "8703000000.0": 53931300.9, "8704000000.0": 53931343.2, "8705000000.0": 53931385.5, "8706000000.0": 53931427.8, "8707000000.0": 53931470.1, "8708000000.0": 53931512.3, "8709000000.0": 53931554.6, "8710000000.0": 53931596.9, "8711000000.0": 53931639.1, "8712000000.0": 53931681.3, "8713000000.0": 53931723.5, "8714000000.0": 53931765.7, "8715000000.0": 53931807.9, "8716000000.0": 53931850.1, "8717000000.0": 53931892.3, "8718000000.0": 53931934.5, "8719000000.0": 53931976.6, "8720000000.0": 53932018.8, "8721000000.0": 53932060.9, "8722000000.0": 53932103.1, "8723000000.0": 53932145.2, "8724000000.0": 53932187.3, "8725000000.0": 53932229.4, "8726000000.0": 53932271.5, "8727000000.0": 53932313.6, "8728000000.0": 53932355.7, "8729000000.0": 53932397.7, "8730000000.0": 53932439.8, "8731000000.0": 53932481.8, "8732000000.0": 53932523.9, "8733000000.0": 53932565.9, "8734000000.0": 53932607.9, "8735000000.0": 53932649.9, "8736000000.0": 53932691.9, "8737000000.0": 53932733.9, "8738000000.0": 53932775.9, "8739000000.0": 53932817.8, "8740000000.0": 53932859.8, "8741000000.0": 53932901.7, "8742000000.0": 53932943.7, "8743000000.0": 53932985.6, "8744000000.0": 53933027.5, "8745000000.0": 53933069.5, "8746000000.0": 53933111.4, "8747000000.0": 53933153.2, "8748000000.0": 53933195.1, "8749000000.0": 53933237.0, "8750000000.0": 53933278.9, "8751000000.0": 53933320.7, "8752000000.0": 53933362.6, "8753000000.0": 53933404.4, "8754000000.0": 53933446.2, "8755000000.0": 53933488.0, "8756000000.0": 53933529.9, "8757000000.0": 53933571.7, "8758000000.0": 53933613.4, "8759000000.0": 53933655.2, "8760000000.0": 53933697.0, "8761000000.0": 53933738.8, "8762000000.0": 53933780.5, "8763000000.0": 53933822.2, "8764000000.0": 53933864.0, "8765000000.0": 53933905.7, "8766000000.0": 53933947.4, "8767000000.0": 53933989.1, "8768000000.0": 53934030.8, "8769000000.0": 53934072.5, "8770000000.0": 53934114.2, "8771000000.0": 53934155.8, "8772000000.0": 53934197.5, "8773000000.0": 53934239.1, "8774000000.0": 53934280.8, "8775000000.0": 53934322.4, "8776000000.0": 53934364.0, "8777000000.0": 53934405.6, "8778000000.0": 53934447.2, "8779000000.0": 53934488.8, "8780000000.0": 53934530.4, "8781000000.0": 53934572.0, "8782000000.0": 53934613.5, "8783000000.0": 53934655.1, "8784000000.0": 53934696.6, "8785000000.0": 53934738.2, "8786000000.0": 53934779.7, "8787000000.0": 53934821.2, "8788000000.0": 53934862.7, "8789000000.0": 53934904.2, "8790000000.0": 53934945.7, "8791000000.0": 53934987.2, "8792000000.0": 53935028.6, "8793000000.0": 53935070.1, "8794000000.0": 53935111.5, "8795000000.0": 53935153.0, "8796000000.0": 53935194.4, "8797000000.0": 53935235.8, "8798000000.0": 53935277.2, "8799000000.0": 53935318.6, "8800000000.0": 53935360.0, "8801000000.0": 53935401.4, "8802000000.0": 53935442.8, "8803000000.0": 53935484.2, "8804000000.0": 53935525.5, "8805000000.0": 53935566.9, "8806000000.0": 53935608.2, "8807000000.0": 53935649.5, "8808000000.0": 53935690.8, "8809000000.0": 53935732.2, "8810000000.0": 53935773.5, "8811000000.0": 53935814.7, "8812000000.0": 53935856.0, "8813000000.0": 53935897.3, "8814000000.0": 53935938.6, "8815000000.0": 53935979.8, "8816000000.0": 53936021.1, "8817000000.0": 53936062.3, "8818000000.0": 53936103.5, "8819000000.0": 53936144.7, "8820000000.0": 53936185.9, "8821000000.0": 53936227.1, "8822000000.0": 53936268.3, "8823000000.0": 53936309.5, "8824000000.0": 53936350.7, "8825000000.0": 53936391.8, "8826000000.0": 53936433.0, "8827000000.0": 53936474.1, "8828000000.0": 53936515.3, "8829000000.0": 53936556.4, "8830000000.0": 53936597.5, "8831000000.0": 53936638.6, "8832000000.0": 53936679.7, "8833000000.0": 53936720.8, "8834000000.0": 53936761.9, "8835000000.0": 53936802.9, "8836000000.0": 53936844.0, "8837000000.0": 53936885.0, "8838000000.0": 53936926.1, "8839000000.0": 53936967.1, "8840000000.0": 53937008.1, "8841000000.0": 53937049.2, "8842000000.0": 53937090.2, "8843000000.0": 53937131.1, "8844000000.0": 53937172.1, "8845000000.0": 53937213.1, "8846000000.0": 53937254.1, "8847000000.0": 53937295.0, "8848000000.0": 53937336.0, "8849000000.0": 53937376.9, "8850000000.0": 53937417.9, "8851000000.0": 53937458.8, "8852000000.0": 53937499.7, "8853000000.0": 53937540.6, "8854000000.0": 53937581.5, "8855000000.0": 53937622.4, "8856000000.0": 53937663.2, "8857000000.0": 53937704.1, "8858000000.0": 53937745.0, "8859000000.0": 53937785.8, "8860000000.0": 53937826.6, "8861000000.0": 53937867.5, "8862000000.0": 53937908.3, "8863000000.0": 53937949.1, "8864000000.0": 53937989.9, "8865000000.0": 53938030.7, "8866000000.0": 53938071.5, "8867000000.0": 53938112.3, "8868000000.0": 53938153.0, "8869000000.0": 53938193.8, "8870000000.0": 53938234.5, "8871000000.0": 53938275.3, "8872000000.0": 53938316.0, "8873000000.0": 53938356.7, "8874000000.0": 53938397.4, "8875000000.0": 53938438.1, "8876000000.0": 53938478.8, "8877000000.0": 53938519.5, "8878000000.0": 53938560.2, "8879000000.0": 53938600.8, "8880000000.0": 53938641.5, "8881000000.0": 53938682.1, "8882000000.0": 53938722.8, "8883000000.0": 53938763.4, "8884000000.0": 53938804.0, "8885000000.0": 53938844.6, "8886000000.0": 53938885.2, "8887000000.0": 53938925.8, "8888000000.0": 53938966.4, "8889000000.0": 53939007.0, "8890000000.0": 53939047.5, "8891000000.0": 53939088.1, "8892000000.0": 53939128.6, "8893000000.0": 53939169.2, "8894000000.0": 53939209.7, "8895000000.0": 53939250.2, "8896000000.0": 53939290.7, "8897000000.0": 53939331.2, "8898000000.0": 53939371.7, "8899000000.0": 53939412.2, "8900000000.0": 53939452.7, "8901000000.0": 53939493.2, "8902000000.0": 53939533.6, "8903000000.0": 53939574.1, "8904000000.0": 53939614.5, "8905000000.0": 53939654.9, "8906000000.0": 53939695.4, "8907000000.0": 53939735.8, "8908000000.0": 53939776.2, "8909000000.0": 53939816.6, "8910000000.0": 53939856.9, "8911000000.0": 53939897.3, "8912000000.0": 53939937.7, "8913000000.0": 53939978.0, "8914000000.0": 53940018.4, "8915000000.0": 53940058.7, "8916000000.0": 53940099.1, "8917000000.0": 53940139.4, "8918000000.0": 53940179.7, "8919000000.0": 53940220.0, "8920000000.0": 53940260.3, "8921000000.0": 53940300.6, "8922000000.0": 53940340.9, "8923000000.0": 53940381.1, "8924000000.0": 53940421.4, "8925000000.0": 53940461.6, "8926000000.0": 53940501.9, "8927000000.0": 53940542.1, "8928000000.0": 53940582.3, "8929000000.0": 53940622.5, "8930000000.0": 53940662.7, "8931000000.0": 53940702.9, "8932000000.0": 53940743.1, "8933000000.0": 53940783.3, "8934000000.0": 53940823.5, "8935000000.0": 53940863.6, "8936000000.0": 53940903.8, "8937000000.0": 53940943.9, "8938000000.0": 53940984.1, "8939000000.0": 53941024.2, "8940000000.0": 53941064.3, "8941000000.0": 53941104.4, "8942000000.0": 53941144.5, "8943000000.0": 53941184.6, "8944000000.0": 53941224.7, "8945000000.0": 53941264.7, "8946000000.0": 53941304.8, "8947000000.0": 53941344.9, "8948000000.0": 53941384.9, "8949000000.0": 53941424.9, "8950000000.0": 53941465.0, "8951000000.0": 53941505.0, "8952000000.0": 53941545.0, "8953000000.0": 53941585.0, "8954000000.0": 53941625.0, "8955000000.0": 53941665.0, "8956000000.0": 53941704.9, "8957000000.0": 53941744.9, "8958000000.0": 53941784.9, "8959000000.0": 53941824.8, "8960000000.0": 53941864.7, "8961000000.0": 53941904.7, "8962000000.0": 53941944.6, "8963000000.0": 53941984.5, "8964000000.0": 53942024.4, "8965000000.0": 53942064.3, "8966000000.0": 53942104.2, "8967000000.0": 53942144.1, "8968000000.0": 53942183.9, "8969000000.0": 53942223.8, "8970000000.0": 53942263.6, "8971000000.0": 53942303.5, "8972000000.0": 53942343.3, "8973000000.0": 53942383.1, "8974000000.0": 53942422.9, "8975000000.0": 53942462.7, "8976000000.0": 53942502.5, "8977000000.0": 53942542.3, "8978000000.0": 53942582.1, "8979000000.0": 53942621.9, "8980000000.0": 53942661.6, "8981000000.0": 53942701.4, "8982000000.0": 53942741.1, "8983000000.0": 53942780.9, "8984000000.0": 53942820.6, "8985000000.0": 53942860.3, "8986000000.0": 53942900.0, "8987000000.0": 53942939.7, "8988000000.0": 53942979.4, "8989000000.0": 53943019.1, "8990000000.0": 53943058.8, "8991000000.0": 53943098.4, "8992000000.0": 53943138.1, "8993000000.0": 53943177.7, "8994000000.0": 53943217.4, "8995000000.0": 53943257.0, "8996000000.0": 53943296.6, "8997000000.0": 53943336.2, "8998000000.0": 53943375.8, "8999000000.0": 53943415.4, "9000000000.0": 53943455.0, "9001000000.0": 53943494.6, "9002000000.0": 53943534.2, "9003000000.0": 53943573.7, "9004000000.0": 53943613.3, "9005000000.0": 53943652.8, "9006000000.0": 53943692.3, "9007000000.0": 53943731.9, "9008000000.0": 53943771.4, "9009000000.0": 53943810.9, "9010000000.0": 53943850.4, "9011000000.0": 53943889.9, "9012000000.0": 53943929.4, "9013000000.0": 53943968.8, "9014000000.0": 53944008.3, "9015000000.0": 53944047.8, "9016000000.0": 53944087.2, "9017000000.0": 53944126.6, "9018000000.0": 53944166.1, "9019000000.0": 53944205.5, "9020000000.0": 53944244.9, "9021000000.0": 53944284.3, "9022000000.0": 53944323.7, "9023000000.0": 53944363.1, "9024000000.0": 53944402.5, "9025000000.0": 53944441.8, "9026000000.0": 53944481.2, "9027000000.0": 53944520.5, "9028000000.0": 53944559.9, "9029000000.0": 53944599.2, "9030000000.0": 53944638.5, "9031000000.0": 53944677.9, "9032000000.0": 53944717.2, "9033000000.0": 53944756.5, "9034000000.0": 53944795.8, "9035000000.0": 53944835.0, "9036000000.0": 53944874.3, "9037000000.0": 53944913.6, "9038000000.0": 53944952.8, "9039000000.0": 53944992.1, "9040000000.0": 53945031.3, "9041000000.0": 53945070.5, "9042000000.0": 53945109.8, "9043000000.0": 53945149.0, "9044000000.0": 53945188.2, "9045000000.0": 53945227.4, "9046000000.0": 53945266.6, "9047000000.0": 53945305.7, "9048000000.0": 53945344.9, "9049000000.0": 53945384.1, "9050000000.0": 53945423.2, "9051000000.0": 53945462.4, "9052000000.0": 53945501.5, "9053000000.0": 53945540.6, "9054000000.0": 53945579.8, "9055000000.0": 53945618.9, "9056000000.0": 53945658.0, "9057000000.0": 53945697.1, "9058000000.0": 53945736.1, "9059000000.0": 53945775.2, "9060000000.0": 53945814.3, "9061000000.0": 53945853.3, "9062000000.0": 53945892.4, "9063000000.0": 53945931.4, "9064000000.0": 53945970.5, "9065000000.0": 53946009.5, "9066000000.0": 53946048.5, "9067000000.0": 53946087.5, "9068000000.0": 53946126.5, "9069000000.0": 53946165.5, "9070000000.0": 53946204.5, "9071000000.0": 53946243.5, "9072000000.0": 53946282.4, "9073000000.0": 53946321.4, "9074000000.0": 53946360.3, "9075000000.0": 53946399.3, "9076000000.0": 53946438.2, "9077000000.0": 53946477.1, "9078000000.0": 53946516.0, "9079000000.0": 53946554.9, "9080000000.0": 53946593.8, "9081000000.0": 53946632.7, "9082000000.0": 53946671.6, "9083000000.0": 53946710.5, "9084000000.0": 53946749.3, "9085000000.0": 53946788.2, "9086000000.0": 53946827.0, "9087000000.0": 53946865.9, "9088000000.0": 53946904.7, "9089000000.0": 53946943.5, "9090000000.0": 53946982.3, "9091000000.0": 53947021.1, "9092000000.0": 53947059.9, "9093000000.0": 53947098.7, "9094000000.0": 53947137.5, "9095000000.0": 53947176.2, "9096000000.0": 53947215.0, "9097000000.0": 53947253.8, "9098000000.0": 53947292.5, "9099000000.0": 53947331.2, "9100000000.0": 53947370.0, "9101000000.0": 53947408.7, "9102000000.0": 53947447.4, "9103000000.0": 53947486.1, "9104000000.0": 53947524.8, "9105000000.0": 53947563.5, "9106000000.0": 53947602.1, "9107000000.0": 53947640.8, "9108000000.0": 53947679.5, "9109000000.0": 53947718.1, "9110000000.0": 53947756.8, "9111000000.0": 53947795.4, "9112000000.0": 53947834.0, "9113000000.0": 53947872.6, "9114000000.0": 53947911.2, "9115000000.0": 53947949.8, "9116000000.0": 53947988.4, "9117000000.0": 53948027.0, "9118000000.0": 53948065.6, "9119000000.0": 53948104.2, "9120000000.0": 53948142.7, "9121000000.0": 53948181.3, "9122000000.0": 53948219.8, "9123000000.0": 53948258.3, "9124000000.0": 53948296.9, "9125000000.0": 53948335.4, "9126000000.0": 53948373.9, "9127000000.0": 53948412.4, "9128000000.0": 53948450.9, "9129000000.0": 53948489.4, "9130000000.0": 53948527.8, "9131000000.0": 53948566.3, "9132000000.0": 53948604.7, "9133000000.0": 53948643.2, "9134000000.0": 53948681.6, "9135000000.0": 53948720.1, "9136000000.0": 53948758.5, "9137000000.0": 53948796.9, "9138000000.0": 53948835.3, "9139000000.0": 53948873.7, "9140000000.0": 53948912.1, "9141000000.0": 53948950.5, "9142000000.0": 53948988.9, "9143000000.0": 53949027.2, "9144000000.0": 53949065.6, "9145000000.0": 53949103.9, "9146000000.0": 53949142.3, "9147000000.0": 53949180.6, "9148000000.0": 53949218.9, "9149000000.0": 53949257.2, "9150000000.0": 53949295.5, "9151000000.0": 53949333.8, "9152000000.0": 53949372.1, "9153000000.0": 53949410.4, "9154000000.0": 53949448.7, "9155000000.0": 53949487.0, "9156000000.0": 53949525.2, "9157000000.0": 53949563.5, "9158000000.0": 53949601.7, "9159000000.0": 53949639.9, "9160000000.0": 53949678.2, "9161000000.0": 53949716.4, "9162000000.0": 53949754.6, "9163000000.0": 53949792.8, "9164000000.0": 53949831.0, "9165000000.0": 53949869.2, "9166000000.0": 53949907.3, "9167000000.0": 53949945.5, "9168000000.0": 53949983.7, "9169000000.0": 53950021.8, "9170000000.0": 53950059.9, "9171000000.0": 53950098.1, "9172000000.0": 53950136.2, "9173000000.0": 53950174.3, "9174000000.0": 53950212.4, "9175000000.0": 53950250.5, "9176000000.0": 53950288.6, "9177000000.0": 53950326.7, "9178000000.0": 53950364.8, "9179000000.0": 53950402.8, "9180000000.0": 53950440.9, "9181000000.0": 53950478.9, "9182000000.0": 53950517.0, "9183000000.0": 53950555.0, "9184000000.0": 53950593.1, "9185000000.0": 53950631.1, "9186000000.0": 53950669.1, "9187000000.0": 53950707.1, "9188000000.0": 53950745.1, "9189000000.0": 53950783.1, "9190000000.0": 53950821.0, "9191000000.0": 53950859.0, "9192000000.0": 53950897.0, "9193000000.0": 53950934.9, "9194000000.0": 53950972.9, "9195000000.0": 53951010.8, "9196000000.0": 53951048.7, "9197000000.0": 53951086.6, "9198000000.0": 53951124.5, "9199000000.0": 53951162.5, "9200000000.0": 53951200.3, "9201000000.0": 53951238.2, "9202000000.0": 53951276.1, "9203000000.0": 53951314.0, "9204000000.0": 53951351.8, "9205000000.0": 53951389.7, "9206000000.0": 53951427.5, "9207000000.0": 53951465.4, "9208000000.0": 53951503.2, "9209000000.0": 53951541.0, "9210000000.0": 53951578.8, "9211000000.0": 53951616.6, "9212000000.0": 53951654.4, "9213000000.0": 53951692.2, "9214000000.0": 53951730.0, "9215000000.0": 53951767.8, "9216000000.0": 53951805.5, "9217000000.0": 53951843.3, "9218000000.0": 53951881.0, "9219000000.0": 53951918.8, "9220000000.0": 53951956.5, "9221000000.0": 53951994.2, "9222000000.0": 53952032.0, "9223000000.0": 53952069.7, "9224000000.0": 53952107.4, "9225000000.0": 53952145.1, "9226000000.0": 53952182.7, "9227000000.0": 53952220.4, "9228000000.0": 53952258.1, "9229000000.0": 53952295.7, "9230000000.0": 53952333.4, "9231000000.0": 53952371.0, "9232000000.0": 53952408.7, "9233000000.0": 53952446.3, "9234000000.0": 53952483.9, "9235000000.0": 53952521.5, "9236000000.0": 53952559.1, "9237000000.0": 53952596.7, "9238000000.0": 53952634.3, "9239000000.0": 53952671.9, "9240000000.0": 53952709.4, "9241000000.0": 53952747.0, "9242000000.0": 53952784.6, "9243000000.0": 53952822.1, "9244000000.0": 53952859.6, "9245000000.0": 53952897.2, "9246000000.0": 53952934.7, "9247000000.0": 53952972.2, "9248000000.0": 53953009.7, "9249000000.0": 53953047.2, "9250000000.0": 53953084.7, "9251000000.0": 53953122.2, "9252000000.0": 53953159.6, "9253000000.0": 53953197.1, "9254000000.0": 53953234.6, "9255000000.0": 53953272.0, "9256000000.0": 53953309.4, "9257000000.0": 53953346.9, "9258000000.0": 53953384.3, "9259000000.0": 53953421.7, "9260000000.0": 53953459.1, "9261000000.0": 53953496.5, "9262000000.0": 53953533.9, "9263000000.0": 53953571.3, "9264000000.0": 53953608.7, "9265000000.0": 53953646.0, "9266000000.0": 53953683.4, "9267000000.0": 53953720.8, "9268000000.0": 53953758.1, "9269000000.0": 53953795.4, "9270000000.0": 53953832.8, "9271000000.0": 53953870.1, "9272000000.0": 53953907.4, "9273000000.0": 53953944.7, "9274000000.0": 53953982.0, "9275000000.0": 53954019.3, "9276000000.0": 53954056.6, "9277000000.0": 53954093.8, "9278000000.0": 53954131.1, "9279000000.0": 53954168.4, "9280000000.0": 53954205.6, "9281000000.0": 53954242.8, "9282000000.0": 53954280.1, "9283000000.0": 53954317.3, "9284000000.0": 53954354.5, "9285000000.0": 53954391.7, "9286000000.0": 53954428.9, "9287000000.0": 53954466.1, "9288000000.0": 53954503.3, "9289000000.0": 53954540.5, "9290000000.0": 53954577.6, "9291000000.0": 53954614.8, "9292000000.0": 53954652.0, "9293000000.0": 53954689.1, "9294000000.0": 53954726.2, "9295000000.0": 53954763.4, "9296000000.0": 53954800.5, "9297000000.0": 53954837.6, "9298000000.0": 53954874.7, "9299000000.0": 53954911.8, "9300000000.0": 53954948.9, "9301000000.0": 53954986.0, "9302000000.0": 53955023.0, "9303000000.0": 53955060.1, "9304000000.0": 53955097.2, "9305000000.0": 53955134.2, "9306000000.0": 53955171.3, "9307000000.0": 53955208.3, "9308000000.0": 53955245.3, "9309000000.0": 53955282.3, "9310000000.0": 53955319.3, "9311000000.0": 53955356.3, "9312000000.0": 53955393.3, "9313000000.0": 53955430.3, "9314000000.0": 53955467.3, "9315000000.0": 53955504.3, "9316000000.0": 53955541.2, "9317000000.0": 53955578.2, "9318000000.0": 53955615.1, "9319000000.0": 53955652.1, "9320000000.0": 53955689.0, "9321000000.0": 53955725.9, "9322000000.0": 53955762.8, "9323000000.0": 53955799.8, "9324000000.0": 53955836.7, "9325000000.0": 53955873.5, "9326000000.0": 53955910.4, "9327000000.0": 53955947.3, "9328000000.0": 53955984.2, "9329000000.0": 53956021.0, "9330000000.0": 53956057.9, "9331000000.0": 53956094.7, "9332000000.0": 53956131.6, "9333000000.0": 53956168.4, "9334000000.0": 53956205.2, "9335000000.0": 53956242.0, "9336000000.0": 53956278.8, "9337000000.0": 53956315.6, "9338000000.0": 53956352.4, "9339000000.0": 53956389.2, "9340000000.0": 53956426.0, "9341000000.0": 53956462.7, "9342000000.0": 53956499.5, "9343000000.0": 53956536.3, "9344000000.0": 53956573.0, "9345000000.0": 53956609.7, "9346000000.0": 53956646.5, "9347000000.0": 53956683.2, "9348000000.0": 53956719.9, "9349000000.0": 53956756.6, "9350000000.0": 53956793.3, "9351000000.0": 53956830.0, "9352000000.0": 53956866.7, "9353000000.0": 53956903.3, "9354000000.0": 53956940.0, "9355000000.0": 53956976.7, "9356000000.0": 53957013.3, "9357000000.0": 53957049.9, "9358000000.0": 53957086.6, "9359000000.0": 53957123.2, "9360000000.0": 53957159.8, "9361000000.0": 53957196.4, "9362000000.0": 53957233.0, "9363000000.0": 53957269.6, "9364000000.0": 53957306.2, "9365000000.0": 53957342.8, "9366000000.0": 53957379.4, "9367000000.0": 53957415.9, "9368000000.0": 53957452.5, "9369000000.0": 53957489.0, "9370000000.0": 53957525.6, "9371000000.0": 53957562.1, "9372000000.0": 53957598.6, "9373000000.0": 53957635.1, "9374000000.0": 53957671.7, "9375000000.0": 53957708.2, "9376000000.0": 53957744.7, "9377000000.0": 53957781.1, "9378000000.0": 53957817.6, "9379000000.0": 53957854.1, "9380000000.0": 53957890.6, "9381000000.0": 53957927.0, "9382000000.0": 53957963.5, "9383000000.0": 53957999.9, "9384000000.0": 53958036.3, "9385000000.0": 53958072.8, "9386000000.0": 53958109.2, "9387000000.0": 53958145.6, "9388000000.0": 53958182.0, "9389000000.0": 53958218.4, "9390000000.0": 53958254.8, "9391000000.0": 53958291.1, "9392000000.0": 53958327.5, "9393000000.0": 53958363.9, "9394000000.0": 53958400.2, "9395000000.0": 53958436.6, "9396000000.0": 53958472.9, "9397000000.0": 53958509.2, "9398000000.0": 53958545.6, "9399000000.0": 53958581.9, "9400000000.0": 53958618.2, "9401000000.0": 53958654.5, "9402000000.0": 53958690.8, "9403000000.0": 53958727.1, "9404000000.0": 53958763.4, "9405000000.0": 53958799.6, "9406000000.0": 53958835.9, "9407000000.0": 53958872.1, "9408000000.0": 53958908.4, "9409000000.0": 53958944.6, "9410000000.0": 53958980.9, "9411000000.0": 53959017.1, "9412000000.0": 53959053.3, "9413000000.0": 53959089.5, "9414000000.0": 53959125.7, "9415000000.0": 53959161.9, "9416000000.0": 53959198.1, "9417000000.0": 53959234.3, "9418000000.0": 53959270.4, "9419000000.0": 53959306.6, "9420000000.0": 53959342.8, "9421000000.0": 53959378.9, "9422000000.0": 53959415.1, "9423000000.0": 53959451.2, "9424000000.0": 53959487.3, "9425000000.0": 53959523.4, "9426000000.0": 53959559.5, "9427000000.0": 53959595.6, "9428000000.0": 53959631.7, "9429000000.0": 53959667.8, "9430000000.0": 53959703.9, "9431000000.0": 53959740.0, "9432000000.0": 53959776.0, "9433000000.0": 53959812.1, "9434000000.0": 53959848.2, "9435000000.0": 53959884.2, "9436000000.0": 53959920.2, "9437000000.0": 53959956.3, "9438000000.0": 53959992.3, "9439000000.0": 53960028.3, "9440000000.0": 53960064.3, "9441000000.0": 53960100.3, "9442000000.0": 53960136.3, "9443000000.0": 53960172.3, "9444000000.0": 53960208.2, "9445000000.0": 53960244.2, "9446000000.0": 53960280.2, "9447000000.0": 53960316.1, "9448000000.0": 53960352.0, "9449000000.0": 53960388.0, "9450000000.0": 53960423.9, "9451000000.0": 53960459.8, "9452000000.0": 53960495.7, "9453000000.0": 53960531.6, "9454000000.0": 53960567.5, "9455000000.0": 53960603.4, "9456000000.0": 53960639.3, "9457000000.0": 53960675.2, "9458000000.0": 53960711.1, "9459000000.0": 53960746.9, "9460000000.0": 53960782.8, "9461000000.0": 53960818.6, "9462000000.0": 53960854.5, "9463000000.0": 53960890.3, "9464000000.0": 53960926.1, "9465000000.0": 53960961.9, "9466000000.0": 53960997.7, "9467000000.0": 53961033.5, "9468000000.0": 53961069.3, "9469000000.0": 53961105.1, "9470000000.0": 53961140.9, "9471000000.0": 53961176.7, "9472000000.0": 53961212.4, "9473000000.0": 53961248.2, "9474000000.0": 53961283.9, "9475000000.0": 53961319.7, "9476000000.0": 53961355.4, "9477000000.0": 53961391.1, "9478000000.0": 53961426.8, "9479000000.0": 53961462.6, "9480000000.0": 53961498.3, "9481000000.0": 53961533.9, "9482000000.0": 53961569.6, "9483000000.0": 53961605.3, "9484000000.0": 53961641.0, "9485000000.0": 53961676.7, "9486000000.0": 53961712.3, "9487000000.0": 53961748.0, "9488000000.0": 53961783.6, "9489000000.0": 53961819.2, "9490000000.0": 53961854.9, "9491000000.0": 53961890.5, "9492000000.0": 53961926.1, "9493000000.0": 53961961.7, "9494000000.0": 53961997.3, "9495000000.0": 53962032.9, "9496000000.0": 53962068.5, "9497000000.0": 53962104.1, "9498000000.0": 53962139.6, "9499000000.0": 53962175.2, "9500000000.0": 53962210.7, "9501000000.0": 53962246.3, "9502000000.0": 53962281.8, "9503000000.0": 53962317.4, "9504000000.0": 53962352.9, "9505000000.0": 53962388.4, "9506000000.0": 53962423.9, "9507000000.0": 53962459.4, "9508000000.0": 53962494.9, "9509000000.0": 53962530.4, "9510000000.0": 53962565.9, "9511000000.0": 53962601.3, "9512000000.0": 53962636.8, "9513000000.0": 53962672.3, "9514000000.0": 53962707.7, "9515000000.0": 53962743.1, "9516000000.0": 53962778.6, "9517000000.0": 53962814.0, "9518000000.0": 53962849.4, "9519000000.0": 53962884.8, "9520000000.0": 53962920.2, "9521000000.0": 53962955.6, "9522000000.0": 53962991.0, "9523000000.0": 53963026.4, "9524000000.0": 53963061.8, "9525000000.0": 53963097.2, "9526000000.0": 53963132.5, "9527000000.0": 53963167.9, "9528000000.0": 53963203.2, "9529000000.0": 53963238.6, "9530000000.0": 53963273.9, "9531000000.0": 53963309.2, "9532000000.0": 53963344.5, "9533000000.0": 53963379.8, "9534000000.0": 53963415.1, "9535000000.0": 53963450.4, "9536000000.0": 53963485.7, "9537000000.0": 53963521.0, "9538000000.0": 53963556.3, "9539000000.0": 53963591.5, "9540000000.0": 53963626.8, "9541000000.0": 53963662.1, "9542000000.0": 53963697.3, "9543000000.0": 53963732.5, "9544000000.0": 53963767.8, "9545000000.0": 53963803.0, "9546000000.0": 53963838.2, "9547000000.0": 53963873.4, "9548000000.0": 53963908.6, "9549000000.0": 53963943.8, "9550000000.0": 53963979.0, "9551000000.0": 53964014.2, "9552000000.0": 53964049.3, "9553000000.0": 53964084.5, "9554000000.0": 53964119.6, "9555000000.0": 53964154.8, "9556000000.0": 53964189.9, "9557000000.0": 53964225.1, "9558000000.0": 53964260.2, "9559000000.0": 53964295.3, "9560000000.0": 53964330.4, "9561000000.0": 53964365.5, "9562000000.0": 53964400.6, "9563000000.0": 53964435.7, "9564000000.0": 53964470.8, "9565000000.0": 53964505.9, "9566000000.0": 53964540.9, "9567000000.0": 53964576.0, "9568000000.0": 53964611.0, "9569000000.0": 53964646.1, "9570000000.0": 53964681.1, "9571000000.0": 53964716.2, "9572000000.0": 53964751.2, "9573000000.0": 53964786.2, "9574000000.0": 53964821.2, "9575000000.0": 53964856.2, "9576000000.0": 53964891.2, "9577000000.0": 53964926.2, "9578000000.0": 53964961.2, "9579000000.0": 53964996.1, "9580000000.0": 53965031.1, "9581000000.0": 53965066.1, "9582000000.0": 53965101.0, "9583000000.0": 53965136.0, "9584000000.0": 53965170.9, "9585000000.0": 53965205.8, "9586000000.0": 53965240.8, "9587000000.0": 53965275.7, "9588000000.0": 53965310.6, "9589000000.0": 53965345.5, "9590000000.0": 53965380.4, "9591000000.0": 53965415.3, "9592000000.0": 53965450.1, "9593000000.0": 53965485.0, "9594000000.0": 53965519.9, "9595000000.0": 53965554.7, "9596000000.0": 53965589.6, "9597000000.0": 53965624.4, "9598000000.0": 53965659.3, "9599000000.0": 53965694.1, "9600000000.0": 53965728.9, "9601000000.0": 53965763.7, "9602000000.0": 53965798.5, "9603000000.0": 53965833.3, "9604000000.0": 53965868.1, "9605000000.0": 53965902.9, "9606000000.0": 53965937.7, "9607000000.0": 53965972.5, "9608000000.0": 53966007.2, "9609000000.0": 53966042.0, "9610000000.0": 53966076.7, "9611000000.0": 53966111.5, "9612000000.0": 53966146.2, "9613000000.0": 53966180.9, "9614000000.0": 53966215.6, "9615000000.0": 53966250.4, "9616000000.0": 53966285.1, "9617000000.0": 53966319.8, "9618000000.0": 53966354.5, "9619000000.0": 53966389.1, "9620000000.0": 53966423.8, "9621000000.0": 53966458.5, "9622000000.0": 53966493.2, "9623000000.0": 53966527.8, "9624000000.0": 53966562.5, "9625000000.0": 53966597.1, "9626000000.0": 53966631.7, "9627000000.0": 53966666.4, "9628000000.0": 53966701.0, "9629000000.0": 53966735.6, "9630000000.0": 53966770.2, "9631000000.0": 53966804.8, "9632000000.0": 53966839.4, "9633000000.0": 53966874.0, "9634000000.0": 53966908.5, "9635000000.0": 53966943.1, "9636000000.0": 53966977.7, "9637000000.0": 53967012.2, "9638000000.0": 53967046.8, "9639000000.0": 53967081.3, "9640000000.0": 53967115.9, "9641000000.0": 53967150.4, "9642000000.0": 53967184.9, "9643000000.0": 53967219.4, "9644000000.0": 53967253.9, "9645000000.0": 53967288.4, "9646000000.0": 53967322.9, "9647000000.0": 53967357.4, "9648000000.0": 53967391.9, "9649000000.0": 53967426.4, "9650000000.0": 53967460.8, "9651000000.0": 53967495.3, "9652000000.0": 53967529.7, "9653000000.0": 53967564.2, "9654000000.0": 53967598.6, "9655000000.0": 53967633.0, "9656000000.0": 53967667.4, "9657000000.0": 53967701.9, "9658000000.0": 53967736.3, "9659000000.0": 53967770.7, "9660000000.0": 53967805.1, "9661000000.0": 53967839.4, "9662000000.0": 53967873.8, "9663000000.0": 53967908.2, "9664000000.0": 53967942.6, "9665000000.0": 53967976.9, "9666000000.0": 53968011.3, "9667000000.0": 53968045.6, "9668000000.0": 53968079.9, "9669000000.0": 53968114.3, "9670000000.0": 53968148.6, "9671000000.0": 53968182.9, "9672000000.0": 53968217.2, "9673000000.0": 53968251.5, "9674000000.0": 53968285.8, "9675000000.0": 53968320.1, "9676000000.0": 53968354.4, "9677000000.0": 53968388.7, "9678000000.0": 53968422.9, "9679000000.0": 53968457.2, "9680000000.0": 53968491.4, "9681000000.0": 53968525.7, "9682000000.0": 53968559.9, "9683000000.0": 53968594.1, "9684000000.0": 53968628.4, "9685000000.0": 53968662.6, "9686000000.0": 53968696.8, "9687000000.0": 53968731.0, "9688000000.0": 53968765.2, "9689000000.0": 53968799.4, "9690000000.0": 53968833.6, "9691000000.0": 53968867.7, "9692000000.0": 53968901.9, "9693000000.0": 53968936.1, "9694000000.0": 53968970.2, "9695000000.0": 53969004.4, "9696000000.0": 53969038.5, "9697000000.0": 53969072.6, "9698000000.0": 53969106.8, "9699000000.0": 53969140.9, "9700000000.0": 53969175.0, "9701000000.0": 53969209.1, "9702000000.0": 53969243.2, "9703000000.0": 53969277.3, "9704000000.0": 53969311.4, "9705000000.0": 53969345.4, "9706000000.0": 53969379.5, "9707000000.0": 53969413.6, "9708000000.0": 53969447.6, "9709000000.0": 53969481.7, "9710000000.0": 53969515.7, "9711000000.0": 53969549.7, "9712000000.0": 53969583.8, "9713000000.0": 53969617.8, "9714000000.0": 53969651.8, "9715000000.0": 53969685.8, "9716000000.0": 53969719.8, "9717000000.0": 53969753.8, "9718000000.0": 53969787.8, "9719000000.0": 53969821.8, "9720000000.0": 53969855.7, "9721000000.0": 53969889.7, "9722000000.0": 53969923.7, "9723000000.0": 53969957.6, "9724000000.0": 53969991.6, "9725000000.0": 53970025.5, "9726000000.0": 53970059.4, "9727000000.0": 53970093.4, "9728000000.0": 53970127.3, "9729000000.0": 53970161.2, "9730000000.0": 53970195.1, "9731000000.0": 53970229.0, "9732000000.0": 53970262.9, "9733000000.0": 53970296.7, "9734000000.0": 53970330.6, "9735000000.0": 53970364.5, "9736000000.0": 53970398.4, "9737000000.0": 53970432.2, "9738000000.0": 53970466.1, "9739000000.0": 53970499.9, "9740000000.0": 53970533.7, "9741000000.0": 53970567.6, "9742000000.0": 53970601.4, "9743000000.0": 53970635.2, "9744000000.0": 53970669.0, "9745000000.0": 53970702.8, "9746000000.0": 53970736.6, "9747000000.0": 53970770.4, "9748000000.0": 53970804.1, "9749000000.0": 53970837.9, "9750000000.0": 53970871.7, "9751000000.0": 53970905.4, "9752000000.0": 53970939.2, "9753000000.0": 53970972.9, "9754000000.0": 53971006.7, "9755000000.0": 53971040.4, "9756000000.0": 53971074.1, "9757000000.0": 53971107.8, "9758000000.0": 53971141.5, "9759000000.0": 53971175.3, "9760000000.0": 53971208.9, "9761000000.0": 53971242.6, "9762000000.0": 53971276.3, "9763000000.0": 53971310.0, "9764000000.0": 53971343.7, "9765000000.0": 53971377.3, "9766000000.0": 53971411.0, "9767000000.0": 53971444.6, "9768000000.0": 53971478.3, "9769000000.0": 53971511.9, "9770000000.0": 53971545.5, "9771000000.0": 53971579.1, "9772000000.0": 53971612.8, "9773000000.0": 53971646.4, "9774000000.0": 53971680.0, "9775000000.0": 53971713.6, "9776000000.0": 53971747.1, "9777000000.0": 53971780.7, "9778000000.0": 53971814.3, "9779000000.0": 53971847.9, "9780000000.0": 53971881.4, "9781000000.0": 53971915.0, "9782000000.0": 53971948.5, "9783000000.0": 53971982.1, "9784000000.0": 53972015.6, "9785000000.0": 53972049.1, "9786000000.0": 53972082.6, "9787000000.0": 53972116.1, "9788000000.0": 53972149.6, "9789000000.0": 53972183.1, "9790000000.0": 53972216.6, "9791000000.0": 53972250.1, "9792000000.0": 53972283.6, "9793000000.0": 53972317.1, "9794000000.0": 53972350.5, "9795000000.0": 53972384.0, "9796000000.0": 53972417.4, "9797000000.0": 53972450.9, "9798000000.0": 53972484.3, "9799000000.0": 53972517.7, "9800000000.0": 53972551.2, "9801000000.0": 53972584.6, "9802000000.0": 53972618.0, "9803000000.0": 53972651.4, "9804000000.0": 53972684.8, "9805000000.0": 53972718.2, "9806000000.0": 53972751.6, "9807000000.0": 53972784.9, "9808000000.0": 53972818.3, "9809000000.0": 53972851.7, "9810000000.0": 53972885.0, "9811000000.0": 53972918.4, "9812000000.0": 53972951.7, "9813000000.0": 53972985.0, "9814000000.0": 53973018.4, "9815000000.0": 53973051.7, "9816000000.0": 53973085.0, "9817000000.0": 53973118.3, "9818000000.0": 53973151.6, "9819000000.0": 53973184.9, "9820000000.0": 53973218.2, "9821000000.0": 53973251.5, "9822000000.0": 53973284.8, "9823000000.0": 53973318.0, "9824000000.0": 53973351.3, "9825000000.0": 53973384.5, "9826000000.0": 53973417.8, "9827000000.0": 53973451.0, "9828000000.0": 53973484.3, "9829000000.0": 53973517.5, "9830000000.0": 53973550.7, "9831000000.0": 53973583.9, "9832000000.0": 53973617.1, "9833000000.0": 53973650.3, "9834000000.0": 53973683.5, "9835000000.0": 53973716.7, "9836000000.0": 53973749.9, "9837000000.0": 53973783.1, "9838000000.0": 53973816.2, "9839000000.0": 53973849.4, "9840000000.0": 53973882.5, "9841000000.0": 53973915.7, "9842000000.0": 53973948.8, "9843000000.0": 53973982.0, "9844000000.0": 53974015.1, "9845000000.0": 53974048.2, "9846000000.0": 53974081.3, "9847000000.0": 53974114.4, "9848000000.0": 53974147.5, "9849000000.0": 53974180.6, "9850000000.0": 53974213.7, "9851000000.0": 53974246.8, "9852000000.0": 53974279.9, "9853000000.0": 53974312.9, "9854000000.0": 53974346.0, "9855000000.0": 53974379.0, "9856000000.0": 53974412.1, "9857000000.0": 53974445.1, "9858000000.0": 53974478.2, "9859000000.0": 53974511.2, "9860000000.0": 53974544.2, "9861000000.0": 53974577.2, "9862000000.0": 53974610.2, "9863000000.0": 53974643.2, "9864000000.0": 53974676.2, "9865000000.0": 53974709.2, "9866000000.0": 53974742.2, "9867000000.0": 53974775.2, "9868000000.0": 53974808.1, "9869000000.0": 53974841.1, "9870000000.0": 53974874.0, "9871000000.0": 53974907.0, "9872000000.0": 53974939.9, "9873000000.0": 53974972.9, "9874000000.0": 53975005.8, "9875000000.0": 53975038.7, "9876000000.0": 53975071.6, "9877000000.0": 53975104.5, "9878000000.0": 53975137.4, "9879000000.0": 53975170.3, "9880000000.0": 53975203.2, "9881000000.0": 53975236.1, "9882000000.0": 53975269.0, "9883000000.0": 53975301.8, "9884000000.0": 53975334.7, "9885000000.0": 53975367.5, "9886000000.0": 53975400.4, "9887000000.0": 53975433.2, "9888000000.0": 53975466.1, "9889000000.0": 53975498.9, "9890000000.0": 53975531.7, "9891000000.0": 53975564.5, "9892000000.0": 53975597.3, "9893000000.0": 53975630.1, "9894000000.0": 53975662.9, "9895000000.0": 53975695.7, "9896000000.0": 53975728.5, "9897000000.0": 53975761.3, "9898000000.0": 53975794.0, "9899000000.0": 53975826.8, "9900000000.0": 53975859.6, "9901000000.0": 53975892.3, "9902000000.0": 53975925.1, "9903000000.0": 53975957.8, "9904000000.0": 53975990.5, "9905000000.0": 53976023.2, "9906000000.0": 53976056.0, "9907000000.0": 53976088.7, "9908000000.0": 53976121.4, "9909000000.0": 53976154.1, "9910000000.0": 53976186.8, "9911000000.0": 53976219.4, "9912000000.0": 53976252.1, "9913000000.0": 53976284.8, "9914000000.0": 53976317.4, "9915000000.0": 53976350.1, "9916000000.0": 53976382.7, "9917000000.0": 53976415.4, "9918000000.0": 53976448.0, "9919000000.0": 53976480.7, "9920000000.0": 53976513.3, "9921000000.0": 53976545.9, "9922000000.0": 53976578.5, "9923000000.0": 53976611.1, "9924000000.0": 53976643.7, "9925000000.0": 53976676.3, "9926000000.0": 53976708.9, "9927000000.0": 53976741.5, "9928000000.0": 53976774.0, "9929000000.0": 53976806.6, "9930000000.0": 53976839.2, "9931000000.0": 53976871.7, "9932000000.0": 53976904.3, "9933000000.0": 53976936.8, "9934000000.0": 53976969.3, "9935000000.0": 53977001.9, "9936000000.0": 53977034.4, "9937000000.0": 53977066.9, "9938000000.0": 53977099.4, "9939000000.0": 53977131.9, "9940000000.0": 53977164.4, "9941000000.0": 53977196.9, "9942000000.0": 53977229.4, "9943000000.0": 53977261.8, "9944000000.0": 53977294.3, "9945000000.0": 53977326.8, "9946000000.0": 53977359.2, "9947000000.0": 53977391.7, "9948000000.0": 53977424.1, "9949000000.0": 53977456.5, "9950000000.0": 53977489.0, "9951000000.0": 53977521.4, "9952000000.0": 53977553.8, "9953000000.0": 53977586.2, "9954000000.0": 53977618.6, "9955000000.0": 53977651.0, "9956000000.0": 53977683.4, "9957000000.0": 53977715.8, "9958000000.0": 53977748.2, "9959000000.0": 53977780.5, "9960000000.0": 53977812.9, "9961000000.0": 53977845.3, "9962000000.0": 53977877.6, "9963000000.0": 53977910.0, "9964000000.0": 53977942.3, "9965000000.0": 53977974.6, "9966000000.0": 53978006.9, "9967000000.0": 53978039.3, "9968000000.0": 53978071.6, "9969000000.0": 53978103.9, "9970000000.0": 53978136.2, "9971000000.0": 53978168.5, "9972000000.0": 53978200.8, "9973000000.0": 53978233.0, "9974000000.0": 53978265.3, "9975000000.0": 53978297.6, "9976000000.0": 53978329.8, "9977000000.0": 53978362.1, "9978000000.0": 53978394.4, "9979000000.0": 53978426.6, "9980000000.0": 53978458.8, "9981000000.0": 53978491.1, "9982000000.0": 53978523.3, "9983000000.0": 53978555.5, "9984000000.0": 53978587.7, "9985000000.0": 53978619.9, "9986000000.0": 53978652.1, "9987000000.0": 53978684.3, "9988000000.0": 53978716.5, "9989000000.0": 53978748.7, "9990000000.0": 53978780.8, "9991000000.0": 53978813.0, "9992000000.0": 53978845.1, "9993000000.0": 53978877.3, "9994000000.0": 53978909.4, "9995000000.0": 53978941.6, "9996000000.0": 53978973.7, "9997000000.0": 53979005.8, "9998000000.0": 53979038.0, "9999000000.0": 53979070.1 }, "rna_s1221_S42.lc_extrap": { "0.0": 0.0, "1000000.0": 957614.5, "2000000.0": 1858605.0, "3000000.0": 2716403.0, "4000000.0": 3537326.5, "5000000.0": 4325606.5, "6000000.0": 5084357.5, "7000000.0": 5815918.5, "8000000.0": 6522341.5, "9000000.0": 7205397.5, "10000000.0": 7866719.0, "11000000.0": 8507426.8, "12000000.0": 9128721.5, "13000000.0": 9731650.5, "14000000.0": 10317162.6, "15000000.0": 10886043.9, "16000000.0": 11439034.8, "17000000.0": 11976863.6, "18000000.0": 12500635.5, "19000000.0": 13010669.0, "20000000.0": 13507441.7, "21000000.0": 13991622.9, "22000000.0": 14463758.1, "23000000.0": 14924381.6, "24000000.0": 15373693.1, "25000000.0": 15812476.9, "26000000.0": 16241008.5, "27000000.0": 16659106.4, "28000000.0": 17067784.4, "29000000.0": 17466833.7, "30000000.0": 17857449.8, "31000000.0": 18239630.9, "32000000.0": 18613191.5, "33000000.0": 18979094.0, "34000000.0": 19337020.0, "35000000.0": 19688131.3, "36000000.0": 20030907.9, "37000000.0": 20367136.5, "38000000.0": 20696841.9, "39000000.0": 21019999.9, "40000000.0": 21336370.6, "41000000.0": 21646521.4, "42000000.0": 21950581.7, "43000000.0": 22248758.6, "44000000.0": 22541466.1, "45000000.0": 22828172.3, "46000000.0": 23109641.7, "47000000.0": 23385900.4, "48000000.0": 23657094.3, "49000000.0": 23923234.9, "50000000.0": 24184843.1, "51000000.0": 24441663.2, "52000000.0": 24693928.3, "53000000.0": 24941782.5, "54000000.0": 25185395.6, "55000000.0": 25424785.1, "56000000.0": 25660536.7, "57000000.0": 25891889.8, "58000000.0": 26119955.1, "59000000.0": 26343824.7, "60000000.0": 26563941.3, "61000000.0": 26781055.1, "62000000.0": 26994490.4, "63000000.0": 27204087.3, "64000000.0": 27410350.1, "65000000.0": 27613358.5, "66000000.0": 27813189.3, "67000000.0": 28009917.4, "68000000.0": 28203614.9, "69000000.0": 28394326.3, "70000000.0": 28582429.9, "71000000.0": 28767752.9, "72000000.0": 28949990.0, "73000000.0": 29129637.6, "74000000.0": 29307440.5, "75000000.0": 29482408.9, "76000000.0": 29654678.6, "77000000.0": 29824300.6, "78000000.0": 29991347.6, "79000000.0": 30156026.8, "80000000.0": 30318353.1, "81000000.0": 30478396.8, "82000000.0": 30636219.0, "83000000.0": 30791865.8, "84000000.0": 30945382.0, "85000000.0": 31096811.2, "86000000.0": 31246196.1, "87000000.0": 31393577.7, "88000000.0": 31538996.4, "89000000.0": 31682491.2, "90000000.0": 31824103.1, "91000000.0": 31964019.5, "92000000.0": 32102124.6, "93000000.0": 32238453.5, "94000000.0": 32373040.3, "95000000.0": 32505918.4, "96000000.0": 32637120.2, "97000000.0": 32766677.4, "98000000.0": 32894620.8, "99000000.0": 33020980.5, "100000000.0": 33145785.9, "101000000.0": 33269065.4, "102000000.0": 33390847.1, "103000000.0": 33511158.2, "104000000.0": 33630025.2, "105000000.0": 33747474.0, "106000000.0": 33863530.1, "107000000.0": 33978217.9, "108000000.0": 34091561.8, "109000000.0": 34203585.2, "110000000.0": 34314311.2, "111000000.0": 34423762.2, "112000000.0": 34531956.1, "113000000.0": 34638721.5, "114000000.0": 34744276.1, "115000000.0": 34848640.5, "116000000.0": 34951834.7, "117000000.0": 35053878.3, "118000000.0": 35154790.6, "119000000.0": 35254590.2, "120000000.0": 35353295.5, "121000000.0": 35450924.5, "122000000.0": 35547494.6, "123000000.0": 35643023.1, "124000000.0": 35737526.7, "125000000.0": 35831021.9, "126000000.0": 35923524.8, "127000000.0": 36015051.0, "128000000.0": 36105616.1, "129000000.0": 36195235.0, "130000000.0": 36283922.7, "131000000.0": 36371693.4, "132000000.0": 36458561.5, "133000000.0": 36544540.8, "134000000.0": 36629644.8, "135000000.0": 36713887.0, "136000000.0": 36797280.2, "137000000.0": 36879837.4, "138000000.0": 36961571.1, "139000000.0": 37042493.5, "140000000.0": 37122616.6, "141000000.0": 37201952.3, "142000000.0": 37280512.2, "143000000.0": 37358307.5, "144000000.0": 37435349.4, "145000000.0": 37511740.5, "146000000.0": 37587426.1, "147000000.0": 37662390.5, "148000000.0": 37736643.8, "149000000.0": 37810196.1, "150000000.0": 37883057.4, "151000000.0": 37955237.3, "152000000.0": 38026745.3, "153000000.0": 38097590.9, "154000000.0": 38167783.1, "155000000.0": 38237331.0, "156000000.0": 38306243.5, "157000000.0": 38374529.2, "158000000.0": 38442196.7, "159000000.0": 38509254.2, "160000000.0": 38575710.1, "161000000.0": 38641572.4, "162000000.0": 38706844.1, "163000000.0": 38771522.1, "164000000.0": 38835629.9, "165000000.0": 38899175.0, "166000000.0": 38962164.9, "167000000.0": 39024606.8, "168000000.0": 39086507.8, "169000000.0": 39147875.0, "170000000.0": 39208715.2, "171000000.0": 39269035.1, "172000000.0": 39328841.6, "173000000.0": 39388140.9, "174000000.0": 39446939.7, "175000000.0": 39505244.2, "176000000.0": 39563060.7, "177000000.0": 39620395.2, "178000000.0": 39677253.7, "179000000.0": 39733642.2, "180000000.0": 39789566.4, "181000000.0": 39845032.2, "182000000.0": 39900045.0, "183000000.0": 39954610.5, "184000000.0": 40008884.5, "185000000.0": 40062732.2, "186000000.0": 40116147.9, "187000000.0": 40169136.9, "188000000.0": 40221704.1, "189000000.0": 40273854.7, "190000000.0": 40325593.6, "191000000.0": 40376925.6, "192000000.0": 40427855.5, "193000000.0": 40478388.0, "194000000.0": 40528527.8, "195000000.0": 40578279.5, "196000000.0": 40627647.4, "197000000.0": 40676634.7, "198000000.0": 40725073.3, "199000000.0": 40773141.8, "200000000.0": 40820844.5, "201000000.0": 40868185.7, "202000000.0": 40915169.4, "203000000.0": 40961799.6, "204000000.0": 41008080.3, "205000000.0": 41054015.4, "206000000.0": 41099608.9, "207000000.0": 41144864.4, "208000000.0": 41189785.7, "209000000.0": 41234376.6, "210000000.0": 41278640.6, "211000000.0": 41322581.4, "212000000.0": 41366202.4, "213000000.0": 41409507.2, "214000000.0": 41452499.2, "215000000.0": 41495181.7, "216000000.0": 41537558.2, "217000000.0": 41579631.8, "218000000.0": 41621405.8, "219000000.0": 41662883.4, "220000000.0": 41704067.7, "221000000.0": 41744961.9, "222000000.0": 41785569.0, "223000000.0": 41825892.0, "224000000.0": 41865933.9, "225000000.0": 41905697.7, "226000000.0": 41945186.1, "227000000.0": 41984402.1, "228000000.0": 42023348.5, "229000000.0": 42062028.0, "230000000.0": 42100443.4, "231000000.0": 42138597.4, "232000000.0": 42176492.6, "233000000.0": 42214131.6, "234000000.0": 42251517.2, "235000000.0": 42288651.7, "236000000.0": 42325571.3, "237000000.0": 42362249.1, "238000000.0": 42398683.3, "239000000.0": 42434876.3, "240000000.0": 42470830.4, "241000000.0": 42506548.1, "242000000.0": 42542031.7, "243000000.0": 42577283.4, "244000000.0": 42612305.5, "245000000.0": 42647100.3, "246000000.0": 42681670.0, "247000000.0": 42716016.7, "248000000.0": 42750142.7, "249000000.0": 42784049.9, "250000000.0": 42817740.6, "251000000.0": 42851216.7, "252000000.0": 42884480.4, "253000000.0": 42917533.6, "254000000.0": 42950378.4, "255000000.0": 42983016.6, "256000000.0": 43015450.4, "257000000.0": 43047681.5, "258000000.0": 43079711.8, "259000000.0": 43111543.3, "260000000.0": 43143177.8, "261000000.0": 43174617.0, "262000000.0": 43205862.9, "263000000.0": 43236917.1, "264000000.0": 43267781.5, "265000000.0": 43298457.8, "266000000.0": 43328947.7, "267000000.0": 43359252.8, "268000000.0": 43389375.0, "269000000.0": 43419315.7, "270000000.0": 43449076.7, "271000000.0": 43478659.5, "272000000.0": 43508065.8, "273000000.0": 43537297.2, "274000000.0": 43566355.1, "275000000.0": 43595241.2, "276000000.0": 43623957.0, "277000000.0": 43652503.8, "278000000.0": 43680883.4, "279000000.0": 43709097.0, "280000000.0": 43737146.2, "281000000.0": 43765032.4, "282000000.0": 43792757.0, "283000000.0": 43820321.5, "284000000.0": 43847727.1, "285000000.0": 43874975.3, "286000000.0": 43902067.4, "287000000.0": 43929004.7, "288000000.0": 43955788.7, "289000000.0": 43982420.5, "290000000.0": 44008901.5, "291000000.0": 44035233.0, "292000000.0": 44061416.2, "293000000.0": 44087452.4, "294000000.0": 44113342.8, "295000000.0": 44139088.6, "296000000.0": 44164691.0, "297000000.0": 44190151.3, "298000000.0": 44215470.6, "299000000.0": 44240650.0, "300000000.0": 44265690.8, "301000000.0": 44290594.1, "302000000.0": 44315361.0, "303000000.0": 44339992.6, "304000000.0": 44364490.0, "305000000.0": 44388854.4, "306000000.0": 44413086.8, "307000000.0": 44437188.2, "308000000.0": 44461159.8, "309000000.0": 44485002.6, "310000000.0": 44508717.6, "311000000.0": 44532305.8, "312000000.0": 44555768.3, "313000000.0": 44579106.0, "314000000.0": 44602320.0, "315000000.0": 44625411.3, "316000000.0": 44648380.7, "317000000.0": 44671229.3, "318000000.0": 44693958.1, "319000000.0": 44716567.9, "320000000.0": 44739059.6, "321000000.0": 44761434.3, "322000000.0": 44783692.9, "323000000.0": 44805836.1, "324000000.0": 44827865.0, "325000000.0": 44849780.3, "326000000.0": 44871583.1, "327000000.0": 44893274.1, "328000000.0": 44914854.2, "329000000.0": 44936324.3, "330000000.0": 44957685.1, "331000000.0": 44978937.6, "332000000.0": 45000082.5, "333000000.0": 45021120.7, "334000000.0": 45042053.0, "335000000.0": 45062880.1, "336000000.0": 45083602.8, "337000000.0": 45104222.1, "338000000.0": 45124738.5, "339000000.0": 45145152.9, "340000000.0": 45165466.0, "341000000.0": 45185678.7, "342000000.0": 45205791.5, "343000000.0": 45225805.4, "344000000.0": 45245720.9, "345000000.0": 45265538.9, "346000000.0": 45285260.0, "347000000.0": 45304885.0, "348000000.0": 45324414.5, "349000000.0": 45343849.2, "350000000.0": 45363189.9, "351000000.0": 45382437.2, "352000000.0": 45401591.8, "353000000.0": 45420654.3, "354000000.0": 45439625.5, "355000000.0": 45458506.0, "356000000.0": 45477296.3, "357000000.0": 45495997.3, "358000000.0": 45514609.4, "359000000.0": 45533133.4, "360000000.0": 45551569.8, "361000000.0": 45569919.4, "362000000.0": 45588182.6, "363000000.0": 45606360.1, "364000000.0": 45624452.5, "365000000.0": 45642460.4, "366000000.0": 45660384.4, "367000000.0": 45678225.1, "368000000.0": 45695983.1, "369000000.0": 45713658.8, "370000000.0": 45731253.0, "371000000.0": 45748766.1, "372000000.0": 45766198.8, "373000000.0": 45783551.5, "374000000.0": 45800824.9, "375000000.0": 45818019.4, "376000000.0": 45835135.6, "377000000.0": 45852174.1, "378000000.0": 45869135.3, "379000000.0": 45886019.8, "380000000.0": 45902828.2, "381000000.0": 45919560.9, "382000000.0": 45936218.4, "383000000.0": 45952801.2, "384000000.0": 45969309.9, "385000000.0": 45985744.9, "386000000.0": 46002106.8, "387000000.0": 46018395.9, "388000000.0": 46034612.9, "389000000.0": 46050758.2, "390000000.0": 46066832.2, "391000000.0": 46082835.4, "392000000.0": 46098768.3, "393000000.0": 46114631.4, "394000000.0": 46130425.1, "395000000.0": 46146149.9, "396000000.0": 46161806.2, "397000000.0": 46177394.4, "398000000.0": 46192915.1, "399000000.0": 46208368.6, "400000000.0": 46223755.4, "401000000.0": 46239075.9, "402000000.0": 46254330.5, "403000000.0": 46269519.7, "404000000.0": 46284643.9, "405000000.0": 46299703.5, "406000000.0": 46314698.9, "407000000.0": 46329630.5, "408000000.0": 46344498.7, "409000000.0": 46359304.0, "410000000.0": 46374046.7, "411000000.0": 46388727.3, "412000000.0": 46403346.0, "413000000.0": 46417903.4, "414000000.0": 46432399.8, "415000000.0": 46446835.5, "416000000.0": 46461211.0, "417000000.0": 46475526.6, "418000000.0": 46489782.8, "419000000.0": 46503979.8, "420000000.0": 46518118.0, "421000000.0": 46532197.9, "422000000.0": 46546219.7, "423000000.0": 46560183.9, "424000000.0": 46574090.7, "425000000.0": 46587940.6, "426000000.0": 46601733.9, "427000000.0": 46615470.9, "428000000.0": 46629151.9, "429000000.0": 46642777.4, "430000000.0": 46656347.6, "431000000.0": 46669863.0, "432000000.0": 46683323.7, "433000000.0": 46696730.2, "434000000.0": 46710082.8, "435000000.0": 46723381.7, "436000000.0": 46736627.4, "437000000.0": 46749820.2, "438000000.0": 46762960.3, "439000000.0": 46776048.1, "440000000.0": 46789083.8, "441000000.0": 46802067.9, "442000000.0": 46815000.6, "443000000.0": 46827882.1, "444000000.0": 46840712.9, "445000000.0": 46853493.2, "446000000.0": 46866223.3, "447000000.0": 46878903.6, "448000000.0": 46891534.2, "449000000.0": 46904115.5, "450000000.0": 46916647.7, "451000000.0": 46929131.3, "452000000.0": 46941566.4, "453000000.0": 46953953.3, "454000000.0": 46966292.3, "455000000.0": 46978583.7, "456000000.0": 46990827.7, "457000000.0": 47003024.7, "458000000.0": 47015174.9, "459000000.0": 47027278.6, "460000000.0": 47039336.0, "461000000.0": 47051347.4, "462000000.0": 47063313.0, "463000000.0": 47075233.2, "464000000.0": 47087108.2, "465000000.0": 47098938.2, "466000000.0": 47110723.6, "467000000.0": 47122464.4, "468000000.0": 47134161.1, "469000000.0": 47145813.8, "470000000.0": 47157422.8, "471000000.0": 47168988.4, "472000000.0": 47180510.7, "473000000.0": 47191990.1, "474000000.0": 47203426.8, "475000000.0": 47214820.9, "476000000.0": 47226172.8, "477000000.0": 47237482.7, "478000000.0": 47248750.7, "479000000.0": 47259977.3, "480000000.0": 47271162.4, "481000000.0": 47282306.5, "482000000.0": 47293409.8, "483000000.0": 47304472.3, "484000000.0": 47315494.5, "485000000.0": 47326476.4, "486000000.0": 47337418.3, "487000000.0": 47348320.5, "488000000.0": 47359183.1, "489000000.0": 47370006.4, "490000000.0": 47380790.6, "491000000.0": 47391535.8, "492000000.0": 47402242.4, "493000000.0": 47412910.4, "494000000.0": 47423540.2, "495000000.0": 47434131.9, "496000000.0": 47444685.7, "497000000.0": 47455201.8, "498000000.0": 47465680.5, "499000000.0": 47476121.9, "500000000.0": 47486526.2, "501000000.0": 47496893.6, "502000000.0": 47507224.4, "503000000.0": 47517518.7, "504000000.0": 47527776.7, "505000000.0": 47537998.5, "506000000.0": 47548184.5, "507000000.0": 47558334.8, "508000000.0": 47568449.5, "509000000.0": 47578528.8, "510000000.0": 47588573.0, "511000000.0": 47598582.3, "512000000.0": 47608556.7, "513000000.0": 47618496.5, "514000000.0": 47628401.9, "515000000.0": 47638273.0, "516000000.0": 47648110.0, "517000000.0": 47657913.1, "518000000.0": 47667682.5, "519000000.0": 47677418.4, "520000000.0": 47687120.8, "521000000.0": 47696790.1, "522000000.0": 47706426.3, "523000000.0": 47716029.6, "524000000.0": 47725600.3, "525000000.0": 47735138.4, "526000000.0": 47744644.1, "527000000.0": 47754117.6, "528000000.0": 47763559.1, "529000000.0": 47772968.7, "530000000.0": 47782346.6, "531000000.0": 47791692.9, "532000000.0": 47801007.8, "533000000.0": 47810291.5, "534000000.0": 47819544.0, "535000000.0": 47828765.7, "536000000.0": 47837956.6, "537000000.0": 47847116.8, "538000000.0": 47856246.6, "539000000.0": 47865346.1, "540000000.0": 47874415.4, "541000000.0": 47883454.7, "542000000.0": 47892464.1, "543000000.0": 47901443.8, "544000000.0": 47910394.0, "545000000.0": 47919314.7, "546000000.0": 47928206.1, "547000000.0": 47937068.4, "548000000.0": 47945901.7, "549000000.0": 47954706.1, "550000000.0": 47963481.8, "551000000.0": 47972229.0, "552000000.0": 47980947.7, "553000000.0": 47989638.1, "554000000.0": 47998300.4, "555000000.0": 48006934.7, "556000000.0": 48015541.0, "557000000.0": 48024119.6, "558000000.0": 48032670.6, "559000000.0": 48041194.2, "560000000.0": 48049690.3, "561000000.0": 48058159.3, "562000000.0": 48066601.1, "563000000.0": 48075016.1, "564000000.0": 48083404.1, "565000000.0": 48091765.5, "566000000.0": 48100100.3, "567000000.0": 48108408.7, "568000000.0": 48116690.7, "569000000.0": 48124946.5, "570000000.0": 48133176.3, "571000000.0": 48141380.1, "572000000.0": 48149558.1, "573000000.0": 48157710.4, "574000000.0": 48165837.1, "575000000.0": 48173938.4, "576000000.0": 48182014.2, "577000000.0": 48190064.9, "578000000.0": 48198090.5, "579000000.0": 48206091.1, "580000000.0": 48214066.8, "581000000.0": 48222017.7, "582000000.0": 48229944.0, "583000000.0": 48237845.8, "584000000.0": 48245723.1, "585000000.0": 48253576.2, "586000000.0": 48261405.0, "587000000.0": 48269209.8, "588000000.0": 48276990.7, "589000000.0": 48284747.6, "590000000.0": 48292480.8, "591000000.0": 48300190.4, "592000000.0": 48307876.5, "593000000.0": 48315539.1, "594000000.0": 48323178.4, "595000000.0": 48330794.5, "596000000.0": 48338387.5, "597000000.0": 48345957.5, "598000000.0": 48353504.6, "599000000.0": 48361029.0, "600000000.0": 48368530.6, "601000000.0": 48376009.6, "602000000.0": 48383466.2, "603000000.0": 48390900.4, "604000000.0": 48398312.3, "605000000.0": 48405702.0, "606000000.0": 48413069.7, "607000000.0": 48420415.3, "608000000.0": 48427739.1, "609000000.0": 48435041.1, "610000000.0": 48442321.4, "611000000.0": 48449580.1, "612000000.0": 48456817.3, "613000000.0": 48464033.1, "614000000.0": 48471227.6, "615000000.0": 48478400.9, "616000000.0": 48485553.0, "617000000.0": 48492684.2, "618000000.0": 48499794.4, "619000000.0": 48506883.7, "620000000.0": 48513952.3, "621000000.0": 48521000.3, "622000000.0": 48528027.7, "623000000.0": 48535034.6, "624000000.0": 48542021.1, "625000000.0": 48548987.3, "626000000.0": 48555933.3, "627000000.0": 48562859.2, "628000000.0": 48569765.0, "629000000.0": 48576650.9, "630000000.0": 48583517.0, "631000000.0": 48590363.2, "632000000.0": 48597189.8, "633000000.0": 48603996.7, "634000000.0": 48610784.2, "635000000.0": 48617552.1, "636000000.0": 48624300.8, "637000000.0": 48631030.1, "638000000.0": 48637740.3, "639000000.0": 48644431.4, "640000000.0": 48651103.4, "641000000.0": 48657756.5, "642000000.0": 48664390.7, "643000000.0": 48671006.1, "644000000.0": 48677602.9, "645000000.0": 48684181.0, "646000000.0": 48690740.5, "647000000.0": 48697281.6, "648000000.0": 48703804.3, "649000000.0": 48710308.7, "650000000.0": 48716794.8, "651000000.0": 48723262.8, "652000000.0": 48729712.7, "653000000.0": 48736144.6, "654000000.0": 48742558.6, "655000000.0": 48748954.7, "656000000.0": 48755333.0, "657000000.0": 48761693.6, "658000000.0": 48768036.6, "659000000.0": 48774362.0, "660000000.0": 48780669.9, "661000000.0": 48786960.4, "662000000.0": 48793233.6, "663000000.0": 48799489.4, "664000000.0": 48805728.1, "665000000.0": 48811949.7, "666000000.0": 48818154.2, "667000000.0": 48824341.7, "668000000.0": 48830512.2, "669000000.0": 48836666.0, "670000000.0": 48842802.9, "671000000.0": 48848923.1, "672000000.0": 48855026.7, "673000000.0": 48861113.7, "674000000.0": 48867184.2, "675000000.0": 48873238.2, "676000000.0": 48879275.9, "677000000.0": 48885297.2, "678000000.0": 48891302.4, "679000000.0": 48897291.3, "680000000.0": 48903264.1, "681000000.0": 48909220.9, "682000000.0": 48915161.7, "683000000.0": 48921086.5, "684000000.0": 48926995.5, "685000000.0": 48932888.8, "686000000.0": 48938766.2, "687000000.0": 48944628.1, "688000000.0": 48950474.3, "689000000.0": 48956305.0, "690000000.0": 48962120.1, "691000000.0": 48967919.9, "692000000.0": 48973704.3, "693000000.0": 48979473.5, "694000000.0": 48985227.4, "695000000.0": 48990966.1, "696000000.0": 48996689.7, "697000000.0": 49002398.2, "698000000.0": 49008091.7, "699000000.0": 49013770.4, "700000000.0": 49019434.1, "701000000.0": 49025083.0, "702000000.0": 49030717.1, "703000000.0": 49036336.6, "704000000.0": 49041941.4, "705000000.0": 49047531.6, "706000000.0": 49053107.3, "707000000.0": 49058668.5, "708000000.0": 49064215.2, "709000000.0": 49069747.7, "710000000.0": 49075265.8, "711000000.0": 49080769.6, "712000000.0": 49086259.3, "713000000.0": 49091734.8, "714000000.0": 49097196.2, "715000000.0": 49102643.6, "716000000.0": 49108077.0, "717000000.0": 49113496.5, "718000000.0": 49118902.1, "719000000.0": 49124293.9, "720000000.0": 49129671.9, "721000000.0": 49135036.3, "722000000.0": 49140386.9, "723000000.0": 49145723.9, "724000000.0": 49151047.4, "725000000.0": 49156357.4, "726000000.0": 49161653.9, "727000000.0": 49166937.1, "728000000.0": 49172206.8, "729000000.0": 49177463.3, "730000000.0": 49182706.5, "731000000.0": 49187936.5, "732000000.0": 49193153.4, "733000000.0": 49198357.2, "734000000.0": 49203547.9, "735000000.0": 49208725.6, "736000000.0": 49213890.3, "737000000.0": 49219042.2, "738000000.0": 49224181.2, "739000000.0": 49229307.3, "740000000.0": 49234420.7, "741000000.0": 49239521.4, "742000000.0": 49244609.5, "743000000.0": 49249684.9, "744000000.0": 49254746.2, "745000000.0": 49259785.8, "746000000.0": 49264813.1, "747000000.0": 49269827.9, "748000000.0": 49274830.3, "749000000.0": 49279820.4, "750000000.0": 49284798.2, "751000000.0": 49289763.8, "752000000.0": 49294717.3, "753000000.0": 49299658.5, "754000000.0": 49304587.7, "755000000.0": 49309504.9, "756000000.0": 49314410.0, "757000000.0": 49319303.2, "758000000.0": 49324184.4, "759000000.0": 49329053.8, "760000000.0": 49333911.3, "761000000.0": 49338757.1, "762000000.0": 49343591.1, "763000000.0": 49348413.4, "764000000.0": 49353224.0, "765000000.0": 49358023.0, "766000000.0": 49362810.5, "767000000.0": 49367586.4, "768000000.0": 49372350.8, "769000000.0": 49377103.7, "770000000.0": 49381845.3, "771000000.0": 49386575.5, "772000000.0": 49391294.3, "773000000.0": 49396001.9, "774000000.0": 49400698.2, "775000000.0": 49405383.3, "776000000.0": 49410057.2, "777000000.0": 49414720.1, "778000000.0": 49419371.8, "779000000.0": 49424012.5, "780000000.0": 49428642.1, "781000000.0": 49433260.8, "782000000.0": 49437868.6, "783000000.0": 49442465.5, "784000000.0": 49447051.5, "785000000.0": 49451626.7, "786000000.0": 49456191.1, "787000000.0": 49460744.8, "788000000.0": 49465287.8, "789000000.0": 49469820.1, "790000000.0": 49474341.8, "791000000.0": 49478852.9, "792000000.0": 49483353.5, "793000000.0": 49487843.5, "794000000.0": 49492323.1, "795000000.0": 49496792.2, "796000000.0": 49501250.9, "797000000.0": 49505699.2, "798000000.0": 49510137.3, "799000000.0": 49514565.0, "800000000.0": 49518982.4, "801000000.0": 49523389.7, "802000000.0": 49527786.7, "803000000.0": 49532173.6, "804000000.0": 49536550.4, "805000000.0": 49540917.1, "806000000.0": 49545273.7, "807000000.0": 49549620.3, "808000000.0": 49553957.0, "809000000.0": 49558283.7, "810000000.0": 49562600.5, "811000000.0": 49566907.4, "812000000.0": 49571204.4, "813000000.0": 49575491.7, "814000000.0": 49579769.2, "815000000.0": 49584036.9, "816000000.0": 49588294.9, "817000000.0": 49592543.3, "818000000.0": 49596782.0, "819000000.0": 49601011.1, "820000000.0": 49605230.6, "821000000.0": 49609440.6, "822000000.0": 49613641.0, "823000000.0": 49617832.0, "824000000.0": 49622013.5, "825000000.0": 49626185.6, "826000000.0": 49630348.4, "827000000.0": 49634501.7, "828000000.0": 49638645.8, "829000000.0": 49642780.5, "830000000.0": 49646906.0, "831000000.0": 49651022.3, "832000000.0": 49655129.4, "833000000.0": 49659227.3, "834000000.0": 49663316.1, "835000000.0": 49667395.7, "836000000.0": 49671466.3, "837000000.0": 49675527.8, "838000000.0": 49679580.4, "839000000.0": 49683623.9, "840000000.0": 49687658.5, "841000000.0": 49691684.2, "842000000.0": 49695700.9, "843000000.0": 49699708.8, "844000000.0": 49703707.9, "845000000.0": 49707698.1, "846000000.0": 49711679.6, "847000000.0": 49715652.3, "848000000.0": 49719616.3, "849000000.0": 49723571.7, "850000000.0": 49727518.3, "851000000.0": 49731456.3, "852000000.0": 49735385.7, "853000000.0": 49739306.5, "854000000.0": 49743218.8, "855000000.0": 49747122.6, "856000000.0": 49751017.8, "857000000.0": 49754904.6, "858000000.0": 49758783.0, "859000000.0": 49762652.9, "860000000.0": 49766514.5, "861000000.0": 49770367.7, "862000000.0": 49774212.5, "863000000.0": 49778049.1, "864000000.0": 49781877.4, "865000000.0": 49785697.4, "866000000.0": 49789509.2, "867000000.0": 49793312.8, "868000000.0": 49797108.3, "869000000.0": 49800895.6, "870000000.0": 49804674.8, "871000000.0": 49808445.8, "872000000.0": 49812208.9, "873000000.0": 49815963.8, "874000000.0": 49819710.8, "875000000.0": 49823449.8, "876000000.0": 49827180.8, "877000000.0": 49830903.9, "878000000.0": 49834619.1, "879000000.0": 49838326.3, "880000000.0": 49842025.8, "881000000.0": 49845717.3, "882000000.0": 49849401.1, "883000000.0": 49853077.1, "884000000.0": 49856745.3, "885000000.0": 49860405.8, "886000000.0": 49864058.5, "887000000.0": 49867703.6, "888000000.0": 49871341.0, "889000000.0": 49874970.8, "890000000.0": 49878593.0, "891000000.0": 49882207.5, "892000000.0": 49885814.5, "893000000.0": 49889413.9, "894000000.0": 49893005.9, "895000000.0": 49896590.3, "896000000.0": 49900167.2, "897000000.0": 49903736.7, "898000000.0": 49907298.8, "899000000.0": 49910853.5, "900000000.0": 49914400.8, "901000000.0": 49917940.7, "902000000.0": 49921473.3, "903000000.0": 49924998.5, "904000000.0": 49928516.5, "905000000.0": 49932027.2, "906000000.0": 49935530.7, "907000000.0": 49939027.0, "908000000.0": 49942516.0, "909000000.0": 49945997.9, "910000000.0": 49949472.6, "911000000.0": 49952940.2, "912000000.0": 49956400.6, "913000000.0": 49959854.0, "914000000.0": 49963300.3, "915000000.0": 49966739.6, "916000000.0": 49970171.8, "917000000.0": 49973597.0, "918000000.0": 49977015.3, "919000000.0": 49980426.5, "920000000.0": 49983830.9, "921000000.0": 49987228.3, "922000000.0": 49990618.8, "923000000.0": 49994002.5, "924000000.0": 49997379.3, "925000000.0": 50000749.2, "926000000.0": 50004112.4, "927000000.0": 50007468.7, "928000000.0": 50010818.3, "929000000.0": 50014161.1, "930000000.0": 50017497.2, "931000000.0": 50020826.6, "932000000.0": 50024149.3, "933000000.0": 50027465.3, "934000000.0": 50030774.7, "935000000.0": 50034077.4, "936000000.0": 50037373.5, "937000000.0": 50040663.1, "938000000.0": 50043946.0, "939000000.0": 50047222.4, "940000000.0": 50050492.3, "941000000.0": 50053755.7, "942000000.0": 50057012.5, "943000000.0": 50060262.9, "944000000.0": 50063506.9, "945000000.0": 50066744.4, "946000000.0": 50069975.5, "947000000.0": 50073200.1, "948000000.0": 50076418.5, "949000000.0": 50079630.4, "950000000.0": 50082836.0, "951000000.0": 50086035.3, "952000000.0": 50089228.3, "953000000.0": 50092415.0, "954000000.0": 50095595.4, "955000000.0": 50098769.6, "956000000.0": 50101937.5, "957000000.0": 50105099.3, "958000000.0": 50108254.8, "959000000.0": 50111404.2, "960000000.0": 50114547.4, "961000000.0": 50117684.5, "962000000.0": 50120815.4, "963000000.0": 50123940.3, "964000000.0": 50127059.1, "965000000.0": 50130171.8, "966000000.0": 50133278.4, "967000000.0": 50136379.0, "968000000.0": 50139473.7, "969000000.0": 50142562.3, "970000000.0": 50145644.9, "971000000.0": 50148721.6, "972000000.0": 50151792.3, "973000000.0": 50154857.1, "974000000.0": 50157916.0, "975000000.0": 50160969.0, "976000000.0": 50164016.1, "977000000.0": 50167057.3, "978000000.0": 50170092.7, "979000000.0": 50173122.3, "980000000.0": 50176146.1, "981000000.0": 50179164.1, "982000000.0": 50182176.3, "983000000.0": 50185182.8, "984000000.0": 50188183.5, "985000000.0": 50191178.4, "986000000.0": 50194167.7, "987000000.0": 50197151.3, "988000000.0": 50200129.2, "989000000.0": 50203101.4, "990000000.0": 50206068.0, "991000000.0": 50209029.0, "992000000.0": 50211984.4, "993000000.0": 50214934.1, "994000000.0": 50217878.3, "995000000.0": 50220816.9, "996000000.0": 50223750.0, "997000000.0": 50226677.5, "998000000.0": 50229599.5, "999000000.0": 50232516.0, "1000000000.0": 50235427.0, "1001000000.0": 50238332.6, "1002000000.0": 50241232.7, "1003000000.0": 50244127.3, "1004000000.0": 50247016.6, "1005000000.0": 50249900.4, "1006000000.0": 50252778.8, "1007000000.0": 50255651.8, "1008000000.0": 50258519.5, "1009000000.0": 50261381.8, "1010000000.0": 50264238.8, "1011000000.0": 50267090.5, "1012000000.0": 50269936.9, "1013000000.0": 50272778.0, "1014000000.0": 50275613.8, "1015000000.0": 50278444.3, "1016000000.0": 50281269.6, "1017000000.0": 50284089.7, "1018000000.0": 50286904.5, "1019000000.0": 50289714.2, "1020000000.0": 50292518.6, "1021000000.0": 50295317.9, "1022000000.0": 50298112.0, "1023000000.0": 50300901.0, "1024000000.0": 50303684.8, "1025000000.0": 50306463.6, "1026000000.0": 50309237.2, "1027000000.0": 50312005.7, "1028000000.0": 50314769.2, "1029000000.0": 50317527.6, "1030000000.0": 50320280.9, "1031000000.0": 50323029.3, "1032000000.0": 50325772.6, "1033000000.0": 50328510.9, "1034000000.0": 50331244.2, "1035000000.0": 50333972.5, "1036000000.0": 50336695.8, "1037000000.0": 50339414.3, "1038000000.0": 50342127.7, "1039000000.0": 50344836.3, "1040000000.0": 50347539.9, "1041000000.0": 50350238.6, "1042000000.0": 50352932.5, "1043000000.0": 50355621.5, "1044000000.0": 50358305.6, "1045000000.0": 50360984.9, "1046000000.0": 50363659.3, "1047000000.0": 50366329.0, "1048000000.0": 50368993.8, "1049000000.0": 50371653.8, "1050000000.0": 50374309.1, "1051000000.0": 50376959.6, "1052000000.0": 50379605.3, "1053000000.0": 50382246.3, "1054000000.0": 50384882.6, "1055000000.0": 50387514.1, "1056000000.0": 50390141.0, "1057000000.0": 50392763.1, "1058000000.0": 50395380.6, "1059000000.0": 50397993.4, "1060000000.0": 50400601.6, "1061000000.0": 50403205.1, "1062000000.0": 50405804.0, "1063000000.0": 50408398.2, "1064000000.0": 50410987.9, "1065000000.0": 50413573.0, "1066000000.0": 50416153.5, "1067000000.0": 50418729.4, "1068000000.0": 50421300.8, "1069000000.0": 50423867.6, "1070000000.0": 50426429.9, "1071000000.0": 50428987.7, "1072000000.0": 50431541.0, "1073000000.0": 50434089.8, "1074000000.0": 50436634.1, "1075000000.0": 50439173.9, "1076000000.0": 50441709.3, "1077000000.0": 50444240.2, "1078000000.0": 50446766.7, "1079000000.0": 50449288.7, "1080000000.0": 50451806.4, "1081000000.0": 50454319.6, "1082000000.0": 50456828.5, "1083000000.0": 50459333.0, "1084000000.0": 50461833.1, "1085000000.0": 50464328.8, "1086000000.0": 50466820.3, "1087000000.0": 50469307.3, "1088000000.0": 50471790.1, "1089000000.0": 50474268.6, "1090000000.0": 50476742.7, "1091000000.0": 50479212.6, "1092000000.0": 50481678.2, "1093000000.0": 50484139.5, "1094000000.0": 50486596.5, "1095000000.0": 50489049.4, "1096000000.0": 50491498.0, "1097000000.0": 50493942.3, "1098000000.0": 50496382.5, "1099000000.0": 50498818.4, "1100000000.0": 50501250.2, "1101000000.0": 50503677.8, "1102000000.0": 50506101.2, "1103000000.0": 50508520.5, "1104000000.0": 50510935.6, "1105000000.0": 50513346.6, "1106000000.0": 50515753.5, "1107000000.0": 50518156.2, "1108000000.0": 50520554.9, "1109000000.0": 50522949.4, "1110000000.0": 50525339.9, "1111000000.0": 50527726.3, "1112000000.0": 50530108.6, "1113000000.0": 50532486.9, "1114000000.0": 50534861.2, "1115000000.0": 50537231.4, "1116000000.0": 50539597.6, "1117000000.0": 50541959.8, "1118000000.0": 50544317.9, "1119000000.0": 50546672.1, "1120000000.0": 50549022.3, "1121000000.0": 50551368.6, "1122000000.0": 50553710.9, "1123000000.0": 50556049.2, "1124000000.0": 50558383.6, "1125000000.0": 50560714.1, "1126000000.0": 50563040.6, "1127000000.0": 50565363.3, "1128000000.0": 50567682.0, "1129000000.0": 50569996.8, "1130000000.0": 50572307.8, "1131000000.0": 50574614.9, "1132000000.0": 50576918.1, "1133000000.0": 50579217.5, "1134000000.0": 50581513.0, "1135000000.0": 50583804.8, "1136000000.0": 50586092.6, "1137000000.0": 50588376.7, "1138000000.0": 50590657.0, "1139000000.0": 50592933.5, "1140000000.0": 50595206.2, "1141000000.0": 50597475.1, "1142000000.0": 50599740.2, "1143000000.0": 50602001.6, "1144000000.0": 50604259.3, "1145000000.0": 50606513.2, "1146000000.0": 50608763.4, "1147000000.0": 50611009.8, "1148000000.0": 50613252.6, "1149000000.0": 50615491.6, "1150000000.0": 50617727.0, "1151000000.0": 50619958.7, "1152000000.0": 50622186.7, "1153000000.0": 50624411.0, "1154000000.0": 50626631.7, "1155000000.0": 50628848.7, "1156000000.0": 50631062.1, "1157000000.0": 50633271.9, "1158000000.0": 50635478.1, "1159000000.0": 50637680.6, "1160000000.0": 50639879.5, "1161000000.0": 50642074.9, "1162000000.0": 50644266.7, "1163000000.0": 50646454.9, "1164000000.0": 50648639.5, "1165000000.0": 50650820.5, "1166000000.0": 50652998.1, "1167000000.0": 50655172.0, "1168000000.0": 50657342.5, "1169000000.0": 50659509.4, "1170000000.0": 50661672.8, "1171000000.0": 50663832.7, "1172000000.0": 50665989.1, "1173000000.0": 50668142.0, "1174000000.0": 50670291.5, "1175000000.0": 50672437.4, "1176000000.0": 50674579.9, "1177000000.0": 50676719.0, "1178000000.0": 50678854.6, "1179000000.0": 50680986.7, "1180000000.0": 50683115.4, "1181000000.0": 50685240.7, "1182000000.0": 50687362.6, "1183000000.0": 50689481.1, "1184000000.0": 50691596.2, "1185000000.0": 50693707.9, "1186000000.0": 50695816.2, "1187000000.0": 50697921.2, "1188000000.0": 50700022.7, "1189000000.0": 50702121.0, "1190000000.0": 50704215.8, "1191000000.0": 50706307.4, "1192000000.0": 50708395.6, "1193000000.0": 50710480.4, "1194000000.0": 50712562.0, "1195000000.0": 50714640.2, "1196000000.0": 50716715.2, "1197000000.0": 50718786.8, "1198000000.0": 50720855.2, "1199000000.0": 50722920.3, "1200000000.0": 50724982.1, "1201000000.0": 50727040.7, "1202000000.0": 50729096.0, "1203000000.0": 50731148.0, "1204000000.0": 50733196.8, "1205000000.0": 50735242.4, "1206000000.0": 50737284.8, "1207000000.0": 50739323.9, "1208000000.0": 50741359.9, "1209000000.0": 50743392.6, "1210000000.0": 50745422.2, "1211000000.0": 50747448.5, "1212000000.0": 50749471.7, "1213000000.0": 50751491.7, "1214000000.0": 50753508.5, "1215000000.0": 50755522.2, "1216000000.0": 50757532.8, "1217000000.0": 50759540.2, "1218000000.0": 50761544.4, "1219000000.0": 50763545.6, "1220000000.0": 50765543.6, "1221000000.0": 50767538.5, "1222000000.0": 50769530.3, "1223000000.0": 50771519.0, "1224000000.0": 50773504.6, "1225000000.0": 50775487.2, "1226000000.0": 50777466.6, "1227000000.0": 50779443.0, "1228000000.0": 50781416.3, "1229000000.0": 50783386.6, "1230000000.0": 50785353.8, "1231000000.0": 50787318.0, "1232000000.0": 50789279.2, "1233000000.0": 50791237.3, "1234000000.0": 50793192.4, "1235000000.0": 50795144.5, "1236000000.0": 50797093.6, "1237000000.0": 50799039.6, "1238000000.0": 50800982.7, "1239000000.0": 50802922.9, "1240000000.0": 50804860.0, "1241000000.0": 50806794.2, "1242000000.0": 50808725.4, "1243000000.0": 50810653.6, "1244000000.0": 50812578.9, "1245000000.0": 50814501.2, "1246000000.0": 50816420.6, "1247000000.0": 50818337.1, "1248000000.0": 50820250.7, "1249000000.0": 50822161.3, "1250000000.0": 50824069.1, "1251000000.0": 50825973.9, "1252000000.0": 50827875.8, "1253000000.0": 50829774.9, "1254000000.0": 50831671.0, "1255000000.0": 50833564.3, "1256000000.0": 50835454.7, "1257000000.0": 50837342.2, "1258000000.0": 50839226.9, "1259000000.0": 50841108.8, "1260000000.0": 50842987.8, "1261000000.0": 50844863.9, "1262000000.0": 50846737.2, "1263000000.0": 50848607.7, "1264000000.0": 50850475.4, "1265000000.0": 50852340.3, "1266000000.0": 50854202.3, "1267000000.0": 50856061.6, "1268000000.0": 50857918.0, "1269000000.0": 50859771.7, "1270000000.0": 50861622.6, "1271000000.0": 50863470.7, "1272000000.0": 50865316.1, "1273000000.0": 50867158.7, "1274000000.0": 50868998.5, "1275000000.0": 50870835.6, "1276000000.0": 50872669.9, "1277000000.0": 50874501.6, "1278000000.0": 50876330.4, "1279000000.0": 50878156.6, "1280000000.0": 50879980.0, "1281000000.0": 50881800.7, "1282000000.0": 50883618.7, "1283000000.0": 50885434.0, "1284000000.0": 50887246.6, "1285000000.0": 50889056.6, "1286000000.0": 50890863.8, "1287000000.0": 50892668.4, "1288000000.0": 50894470.2, "1289000000.0": 50896269.5, "1290000000.0": 50898066.0, "1291000000.0": 50899859.9, "1292000000.0": 50901651.2, "1293000000.0": 50903439.8, "1294000000.0": 50905225.8, "1295000000.0": 50907009.2, "1296000000.0": 50908789.9, "1297000000.0": 50910568.0, "1298000000.0": 50912343.5, "1299000000.0": 50914116.4, "1300000000.0": 50915886.7, "1301000000.0": 50917654.4, "1302000000.0": 50919419.5, "1303000000.0": 50921182.0, "1304000000.0": 50922942.0, "1305000000.0": 50924699.3, "1306000000.0": 50926454.1, "1307000000.0": 50928206.4, "1308000000.0": 50929956.1, "1309000000.0": 50931703.2, "1310000000.0": 50933447.8, "1311000000.0": 50935189.8, "1312000000.0": 50936929.4, "1313000000.0": 50938666.3, "1314000000.0": 50940400.8, "1315000000.0": 50942132.8, "1316000000.0": 50943862.2, "1317000000.0": 50945589.1, "1318000000.0": 50947313.6, "1319000000.0": 50949035.5, "1320000000.0": 50950754.9, "1321000000.0": 50952471.9, "1322000000.0": 50954186.4, "1323000000.0": 50955898.4, "1324000000.0": 50957607.9, "1325000000.0": 50959315.0, "1326000000.0": 50961019.6, "1327000000.0": 50962721.8, "1328000000.0": 50964421.5, "1329000000.0": 50966118.8, "1330000000.0": 50967813.6, "1331000000.0": 50969506.0, "1332000000.0": 50971196.0, "1333000000.0": 50972883.6, "1334000000.0": 50974568.7, "1335000000.0": 50976251.5, "1336000000.0": 50977931.8, "1337000000.0": 50979609.7, "1338000000.0": 50981285.2, "1339000000.0": 50982958.4, "1340000000.0": 50984629.1, "1341000000.0": 50986297.5, "1342000000.0": 50987963.5, "1343000000.0": 50989627.2, "1344000000.0": 50991288.4, "1345000000.0": 50992947.3, "1346000000.0": 50994603.9, "1347000000.0": 50996258.1, "1348000000.0": 50997910.0, "1349000000.0": 50999559.5, "1350000000.0": 51001206.7, "1351000000.0": 51002851.5, "1352000000.0": 51004494.1, "1353000000.0": 51006134.3, "1354000000.0": 51007772.2, "1355000000.0": 51009407.8, "1356000000.0": 51011041.0, "1357000000.0": 51012672.0, "1358000000.0": 51014300.7, "1359000000.0": 51015927.1, "1360000000.0": 51017551.2, "1361000000.0": 51019173.1, "1362000000.0": 51020792.6, "1363000000.0": 51022409.9, "1364000000.0": 51024024.9, "1365000000.0": 51025637.7, "1366000000.0": 51027248.2, "1367000000.0": 51028856.4, "1368000000.0": 51030462.4, "1369000000.0": 51032066.2, "1370000000.0": 51033667.7, "1371000000.0": 51035266.9, "1372000000.0": 51036864.0, "1373000000.0": 51038458.8, "1374000000.0": 51040051.4, "1375000000.0": 51041641.8, "1376000000.0": 51043230.0, "1377000000.0": 51044816.0, "1378000000.0": 51046399.8, "1379000000.0": 51047981.4, "1380000000.0": 51049560.8, "1381000000.0": 51051138.0, "1382000000.0": 51052713.0, "1383000000.0": 51054285.8, "1384000000.0": 51055856.5, "1385000000.0": 51057425.0, "1386000000.0": 51058991.3, "1387000000.0": 51060555.5, "1388000000.0": 51062117.5, "1389000000.0": 51063677.4, "1390000000.0": 51065235.1, "1391000000.0": 51066790.7, "1392000000.0": 51068344.1, "1393000000.0": 51069895.4, "1394000000.0": 51071444.6, "1395000000.0": 51072991.6, "1396000000.0": 51074536.6, "1397000000.0": 51076079.4, "1398000000.0": 51077620.1, "1399000000.0": 51079158.7, "1400000000.0": 51080695.2, "1401000000.0": 51082229.6, "1402000000.0": 51083761.9, "1403000000.0": 51085292.1, "1404000000.0": 51086820.2, "1405000000.0": 51088346.2, "1406000000.0": 51089870.2, "1407000000.0": 51091392.1, "1408000000.0": 51092911.9, "1409000000.0": 51094429.6, "1410000000.0": 51095945.3, "1411000000.0": 51097459.0, "1412000000.0": 51098970.6, "1413000000.0": 51100480.1, "1414000000.0": 51101987.6, "1415000000.0": 51103493.0, "1416000000.0": 51104996.5, "1417000000.0": 51106497.8, "1418000000.0": 51107997.2, "1419000000.0": 51109494.5, "1420000000.0": 51110989.9, "1421000000.0": 51112483.2, "1422000000.0": 51113974.4, "1423000000.0": 51115463.7, "1424000000.0": 51116951.0, "1425000000.0": 51118436.3, "1426000000.0": 51119919.6, "1427000000.0": 51121400.9, "1428000000.0": 51122880.2, "1429000000.0": 51124357.5, "1430000000.0": 51125832.9, "1431000000.0": 51127306.2, "1432000000.0": 51128777.6, "1433000000.0": 51130247.1, "1434000000.0": 51131714.5, "1435000000.0": 51133180.0, "1436000000.0": 51134643.6, "1437000000.0": 51136105.2, "1438000000.0": 51137564.9, "1439000000.0": 51139022.6, "1440000000.0": 51140478.4, "1441000000.0": 51141932.2, "1442000000.0": 51143384.1, "1443000000.0": 51144834.1, "1444000000.0": 51146282.1, "1445000000.0": 51147728.3, "1446000000.0": 51149172.5, "1447000000.0": 51150614.8, "1448000000.0": 51152055.2, "1449000000.0": 51153493.7, "1450000000.0": 51154930.3, "1451000000.0": 51156365.0, "1452000000.0": 51157797.8, "1453000000.0": 51159228.7, "1454000000.0": 51160657.7, "1455000000.0": 51162084.8, "1456000000.0": 51163510.1, "1457000000.0": 51164933.5, "1458000000.0": 51166355.0, "1459000000.0": 51167774.6, "1460000000.0": 51169192.4, "1461000000.0": 51170608.3, "1462000000.0": 51172022.4, "1463000000.0": 51173434.6, "1464000000.0": 51174845.0, "1465000000.0": 51176253.5, "1466000000.0": 51177660.2, "1467000000.0": 51179065.0, "1468000000.0": 51180468.0, "1469000000.0": 51181869.2, "1470000000.0": 51183268.5, "1471000000.0": 51184666.0, "1472000000.0": 51186061.7, "1473000000.0": 51187455.6, "1474000000.0": 51188847.7, "1475000000.0": 51190237.9, "1476000000.0": 51191626.4, "1477000000.0": 51193013.0, "1478000000.0": 51194397.8, "1479000000.0": 51195780.9, "1480000000.0": 51197162.1, "1481000000.0": 51198541.6, "1482000000.0": 51199919.3, "1483000000.0": 51201295.2, "1484000000.0": 51202669.3, "1485000000.0": 51204041.7, "1486000000.0": 51205412.2, "1487000000.0": 51206781.0, "1488000000.0": 51208148.1, "1489000000.0": 51209513.4, "1490000000.0": 51210876.9, "1491000000.0": 51212238.6, "1492000000.0": 51213598.7, "1493000000.0": 51214956.9, "1494000000.0": 51216313.4, "1495000000.0": 51217668.2, "1496000000.0": 51219021.3, "1497000000.0": 51220372.6, "1498000000.0": 51221722.2, "1499000000.0": 51223070.0, "1500000000.0": 51224416.1, "1501000000.0": 51225760.5, "1502000000.0": 51227103.2, "1503000000.0": 51228444.2, "1504000000.0": 51229783.4, "1505000000.0": 51231121.0, "1506000000.0": 51232456.8, "1507000000.0": 51233791.0, "1508000000.0": 51235123.4, "1509000000.0": 51236454.2, "1510000000.0": 51237783.2, "1511000000.0": 51239110.6, "1512000000.0": 51240436.3, "1513000000.0": 51241760.3, "1514000000.0": 51243082.6, "1515000000.0": 51244403.3, "1516000000.0": 51245722.2, "1517000000.0": 51247039.6, "1518000000.0": 51248355.2, "1519000000.0": 51249669.2, "1520000000.0": 51250981.5, "1521000000.0": 51252292.1, "1522000000.0": 51253601.1, "1523000000.0": 51254908.5, "1524000000.0": 51256214.2, "1525000000.0": 51257518.3, "1526000000.0": 51258820.7, "1527000000.0": 51260121.5, "1528000000.0": 51261420.6, "1529000000.0": 51262718.1, "1530000000.0": 51264014.0, "1531000000.0": 51265308.3, "1532000000.0": 51266600.9, "1533000000.0": 51267892.0, "1534000000.0": 51269181.4, "1535000000.0": 51270469.1, "1536000000.0": 51271755.3, "1537000000.0": 51273039.9, "1538000000.0": 51274322.9, "1539000000.0": 51275604.2, "1540000000.0": 51276884.0, "1541000000.0": 51278162.2, "1542000000.0": 51279438.7, "1543000000.0": 51280713.7, "1544000000.0": 51281987.1, "1545000000.0": 51283258.9, "1546000000.0": 51284529.2, "1547000000.0": 51285797.8, "1548000000.0": 51287064.9, "1549000000.0": 51288330.4, "1550000000.0": 51289594.4, "1551000000.0": 51290856.8, "1552000000.0": 51292117.6, "1553000000.0": 51293376.8, "1554000000.0": 51294634.5, "1555000000.0": 51295890.7, "1556000000.0": 51297145.2, "1557000000.0": 51298398.3, "1558000000.0": 51299649.8, "1559000000.0": 51300899.7, "1560000000.0": 51302148.1, "1561000000.0": 51303395.0, "1562000000.0": 51304640.4, "1563000000.0": 51305884.2, "1564000000.0": 51307126.4, "1565000000.0": 51308367.2, "1566000000.0": 51309606.4, "1567000000.0": 51310844.1, "1568000000.0": 51312080.3, "1569000000.0": 51313315.0, "1570000000.0": 51314548.2, "1571000000.0": 51315779.8, "1572000000.0": 51317010.0, "1573000000.0": 51318238.6, "1574000000.0": 51319465.8, "1575000000.0": 51320691.4, "1576000000.0": 51321915.6, "1577000000.0": 51323138.2, "1578000000.0": 51324359.4, "1579000000.0": 51325579.1, "1580000000.0": 51326797.3, "1581000000.0": 51328014.0, "1582000000.0": 51329229.2, "1583000000.0": 51330443.0, "1584000000.0": 51331655.3, "1585000000.0": 51332866.1, "1586000000.0": 51334075.4, "1587000000.0": 51335283.3, "1588000000.0": 51336489.7, "1589000000.0": 51337694.7, "1590000000.0": 51338898.2, "1591000000.0": 51340100.2, "1592000000.0": 51341300.8, "1593000000.0": 51342499.9, "1594000000.0": 51343697.6, "1595000000.0": 51344893.9, "1596000000.0": 51346088.7, "1597000000.0": 51347282.0, "1598000000.0": 51348474.0, "1599000000.0": 51349664.5, "1600000000.0": 51350853.5, "1601000000.0": 51352041.2, "1602000000.0": 51353227.4, "1603000000.0": 51354412.2, "1604000000.0": 51355595.5, "1605000000.0": 51356777.5, "1606000000.0": 51357958.0, "1607000000.0": 51359137.1, "1608000000.0": 51360314.8, "1609000000.0": 51361491.1, "1610000000.0": 51362666.0, "1611000000.0": 51363839.5, "1612000000.0": 51365011.6, "1613000000.0": 51366182.2, "1614000000.0": 51367351.5, "1615000000.0": 51368519.4, "1616000000.0": 51369685.9, "1617000000.0": 51370851.1, "1618000000.0": 51372014.8, "1619000000.0": 51373177.1, "1620000000.0": 51374338.1, "1621000000.0": 51375497.7, "1622000000.0": 51376655.9, "1623000000.0": 51377812.7, "1624000000.0": 51378968.2, "1625000000.0": 51380122.3, "1626000000.0": 51381275.0, "1627000000.0": 51382426.4, "1628000000.0": 51383576.4, "1629000000.0": 51384725.0, "1630000000.0": 51385872.3, "1631000000.0": 51387018.2, "1632000000.0": 51388162.8, "1633000000.0": 51389306.0, "1634000000.0": 51390447.9, "1635000000.0": 51391588.5, "1636000000.0": 51392727.7, "1637000000.0": 51393865.5, "1638000000.0": 51395002.0, "1639000000.0": 51396137.2, "1640000000.0": 51397271.1, "1641000000.0": 51398403.6, "1642000000.0": 51399534.8, "1643000000.0": 51400664.6, "1644000000.0": 51401793.2, "1645000000.0": 51402920.4, "1646000000.0": 51404046.3, "1647000000.0": 51405170.9, "1648000000.0": 51406294.2, "1649000000.0": 51407416.1, "1650000000.0": 51408536.8, "1651000000.0": 51409656.1, "1652000000.0": 51410774.1, "1653000000.0": 51411890.9, "1654000000.0": 51413006.3, "1655000000.0": 51414120.4, "1656000000.0": 51415233.3, "1657000000.0": 51416344.8, "1658000000.0": 51417455.1, "1659000000.0": 51418564.0, "1660000000.0": 51419671.7, "1661000000.0": 51420778.1, "1662000000.0": 51421883.2, "1663000000.0": 51422987.0, "1664000000.0": 51424089.6, "1665000000.0": 51425190.8, "1666000000.0": 51426290.8, "1667000000.0": 51427389.5, "1668000000.0": 51428487.0, "1669000000.0": 51429583.2, "1670000000.0": 51430678.1, "1671000000.0": 51431771.8, "1672000000.0": 51432864.2, "1673000000.0": 51433955.3, "1674000000.0": 51435045.2, "1675000000.0": 51436133.8, "1676000000.0": 51437221.2, "1677000000.0": 51438307.4, "1678000000.0": 51439392.2, "1679000000.0": 51440475.9, "1680000000.0": 51441558.3, "1681000000.0": 51442639.4, "1682000000.0": 51443719.3, "1683000000.0": 51444798.0, "1684000000.0": 51445875.4, "1685000000.0": 51446951.7, "1686000000.0": 51448026.6, "1687000000.0": 51449100.4, "1688000000.0": 51450172.9, "1689000000.0": 51451244.2, "1690000000.0": 51452314.3, "1691000000.0": 51453383.1, "1692000000.0": 51454450.8, "1693000000.0": 51455517.2, "1694000000.0": 51456582.4, "1695000000.0": 51457646.4, "1696000000.0": 51458709.2, "1697000000.0": 51459770.8, "1698000000.0": 51460831.2, "1699000000.0": 51461890.3, "1700000000.0": 51462948.3, "1701000000.0": 51464005.1, "1702000000.0": 51465060.6, "1703000000.0": 51466115.0, "1704000000.0": 51467168.2, "1705000000.0": 51468220.2, "1706000000.0": 51469271.0, "1707000000.0": 51470320.6, "1708000000.0": 51471369.0, "1709000000.0": 51472416.3, "1710000000.0": 51473462.4, "1711000000.0": 51474507.2, "1712000000.0": 51475550.9, "1713000000.0": 51476593.5, "1714000000.0": 51477634.8, "1715000000.0": 51478675.0, "1716000000.0": 51479714.1, "1717000000.0": 51480751.9, "1718000000.0": 51481788.6, "1719000000.0": 51482824.1, "1720000000.0": 51483858.5, "1721000000.0": 51484891.7, "1722000000.0": 51485923.7, "1723000000.0": 51486954.6, "1724000000.0": 51487984.4, "1725000000.0": 51489012.9, "1726000000.0": 51490040.4, "1727000000.0": 51491066.7, "1728000000.0": 51492091.8, "1729000000.0": 51493115.8, "1730000000.0": 51494138.7, "1731000000.0": 51495160.4, "1732000000.0": 51496180.9, "1733000000.0": 51497200.4, "1734000000.0": 51498218.7, "1735000000.0": 51499235.9, "1736000000.0": 51500251.9, "1737000000.0": 51501266.8, "1738000000.0": 51502280.6, "1739000000.0": 51503293.3, "1740000000.0": 51504304.8, "1741000000.0": 51505315.2, "1742000000.0": 51506324.5, "1743000000.0": 51507332.7, "1744000000.0": 51508339.7, "1745000000.0": 51509345.7, "1746000000.0": 51510350.5, "1747000000.0": 51511354.3, "1748000000.0": 51512356.9, "1749000000.0": 51513358.4, "1750000000.0": 51514358.8, "1751000000.0": 51515358.1, "1752000000.0": 51516356.3, "1753000000.0": 51517353.4, "1754000000.0": 51518349.4, "1755000000.0": 51519344.3, "1756000000.0": 51520338.1, "1757000000.0": 51521330.9, "1758000000.0": 51522322.5, "1759000000.0": 51523313.0, "1760000000.0": 51524302.5, "1761000000.0": 51525290.9, "1762000000.0": 51526278.2, "1763000000.0": 51527264.4, "1764000000.0": 51528249.5, "1765000000.0": 51529233.6, "1766000000.0": 51530216.5, "1767000000.0": 51531198.4, "1768000000.0": 51532179.3, "1769000000.0": 51533159.0, "1770000000.0": 51534137.7, "1771000000.0": 51535115.3, "1772000000.0": 51536091.9, "1773000000.0": 51537067.4, "1774000000.0": 51538041.8, "1775000000.0": 51539015.2, "1776000000.0": 51539987.5, "1777000000.0": 51540958.8, "1778000000.0": 51541929.0, "1779000000.0": 51542898.1, "1780000000.0": 51543866.2, "1781000000.0": 51544833.3, "1782000000.0": 51545799.3, "1783000000.0": 51546764.2, "1784000000.0": 51547728.1, "1785000000.0": 51548691.0, "1786000000.0": 51549652.8, "1787000000.0": 51550613.6, "1788000000.0": 51551573.3, "1789000000.0": 51552532.0, "1790000000.0": 51553489.7, "1791000000.0": 51554446.4, "1792000000.0": 51555402.0, "1793000000.0": 51556356.5, "1794000000.0": 51557310.1, "1795000000.0": 51558262.6, "1796000000.0": 51559214.1, "1797000000.0": 51560164.6, "1798000000.0": 51561114.0, "1799000000.0": 51562062.5, "1800000000.0": 51563009.9, "1801000000.0": 51563956.3, "1802000000.0": 51564901.7, "1803000000.0": 51565846.1, "1804000000.0": 51566789.4, "1805000000.0": 51567731.8, "1806000000.0": 51568673.1, "1807000000.0": 51569613.5, "1808000000.0": 51570552.8, "1809000000.0": 51571491.1, "1810000000.0": 51572428.4, "1811000000.0": 51573364.8, "1812000000.0": 51574300.1, "1813000000.0": 51575234.4, "1814000000.0": 51576167.8, "1815000000.0": 51577100.1, "1816000000.0": 51578031.4, "1817000000.0": 51578961.8, "1818000000.0": 51579891.2, "1819000000.0": 51580819.5, "1820000000.0": 51581746.9, "1821000000.0": 51582673.4, "1822000000.0": 51583598.8, "1823000000.0": 51584523.2, "1824000000.0": 51585446.7, "1825000000.0": 51586369.2, "1826000000.0": 51587290.7, "1827000000.0": 51588211.2, "1828000000.0": 51589130.8, "1829000000.0": 51590049.4, "1830000000.0": 51590967.0, "1831000000.0": 51591883.7, "1832000000.0": 51592799.3, "1833000000.0": 51593714.1, "1834000000.0": 51594627.8, "1835000000.0": 51595540.6, "1836000000.0": 51596452.4, "1837000000.0": 51597363.3, "1838000000.0": 51598273.2, "1839000000.0": 51599182.2, "1840000000.0": 51600090.2, "1841000000.0": 51600997.2, "1842000000.0": 51601903.3, "1843000000.0": 51602808.4, "1844000000.0": 51603712.6, "1845000000.0": 51604615.9, "1846000000.0": 51605518.2, "1847000000.0": 51606419.5, "1848000000.0": 51607320.0, "1849000000.0": 51608219.4, "1850000000.0": 51609118.0, "1851000000.0": 51610015.5, "1852000000.0": 51610912.2, "1853000000.0": 51611807.9, "1854000000.0": 51612702.7, "1855000000.0": 51613596.5, "1856000000.0": 51614489.5, "1857000000.0": 51615381.5, "1858000000.0": 51616272.5, "1859000000.0": 51617162.6, "1860000000.0": 51618051.9, "1861000000.0": 51618940.1, "1862000000.0": 51619827.5, "1863000000.0": 51620713.9, "1864000000.0": 51621599.5, "1865000000.0": 51622484.1, "1866000000.0": 51623367.7, "1867000000.0": 51624250.5, "1868000000.0": 51625132.4, "1869000000.0": 51626013.3, "1870000000.0": 51626893.3, "1871000000.0": 51627772.4, "1872000000.0": 51628650.6, "1873000000.0": 51629528.0, "1874000000.0": 51630404.3, "1875000000.0": 51631279.8, "1876000000.0": 51632154.4, "1877000000.0": 51633028.1, "1878000000.0": 51633900.9, "1879000000.0": 51634772.8, "1880000000.0": 51635643.8, "1881000000.0": 51636513.9, "1882000000.0": 51637383.1, "1883000000.0": 51638251.4, "1884000000.0": 51639118.8, "1885000000.0": 51639985.3, "1886000000.0": 51640851.0, "1887000000.0": 51641715.7, "1888000000.0": 51642579.6, "1889000000.0": 51643442.6, "1890000000.0": 51644304.6, "1891000000.0": 51645165.9, "1892000000.0": 51646026.2, "1893000000.0": 51646885.6, "1894000000.0": 51647744.2, "1895000000.0": 51648601.9, "1896000000.0": 51649458.7, "1897000000.0": 51650314.7, "1898000000.0": 51651169.7, "1899000000.0": 51652023.9, "1900000000.0": 51652877.3, "1901000000.0": 51653729.7, "1902000000.0": 51654581.3, "1903000000.0": 51655432.1, "1904000000.0": 51656281.9, "1905000000.0": 51657130.9, "1906000000.0": 51657979.1, "1907000000.0": 51658826.3, "1908000000.0": 51659672.7, "1909000000.0": 51660518.3, "1910000000.0": 51661363.0, "1911000000.0": 51662206.8, "1912000000.0": 51663049.8, "1913000000.0": 51663892.0, "1914000000.0": 51664733.3, "1915000000.0": 51665573.7, "1916000000.0": 51666413.3, "1917000000.0": 51667252.0, "1918000000.0": 51668089.9, "1919000000.0": 51668926.9, "1920000000.0": 51669763.1, "1921000000.0": 51670598.5, "1922000000.0": 51671433.0, "1923000000.0": 51672266.7, "1924000000.0": 51673099.5, "1925000000.0": 51673931.5, "1926000000.0": 51674762.7, "1927000000.0": 51675593.0, "1928000000.0": 51676422.5, "1929000000.0": 51677251.2, "1930000000.0": 51678079.0, "1931000000.0": 51678906.0, "1932000000.0": 51679732.2, "1933000000.0": 51680557.5, "1934000000.0": 51681382.0, "1935000000.0": 51682205.7, "1936000000.0": 51683028.6, "1937000000.0": 51683850.6, "1938000000.0": 51684671.8, "1939000000.0": 51685492.2, "1940000000.0": 51686311.8, "1941000000.0": 51687130.6, "1942000000.0": 51687948.5, "1943000000.0": 51688765.7, "1944000000.0": 51689582.0, "1945000000.0": 51690397.5, "1946000000.0": 51691212.2, "1947000000.0": 51692026.1, "1948000000.0": 51692839.1, "1949000000.0": 51693651.4, "1950000000.0": 51694462.9, "1951000000.0": 51695273.5, "1952000000.0": 51696083.4, "1953000000.0": 51696892.4, "1954000000.0": 51697700.6, "1955000000.0": 51698508.1, "1956000000.0": 51699314.7, "1957000000.0": 51700120.6, "1958000000.0": 51700925.6, "1959000000.0": 51701729.9, "1960000000.0": 51702533.3, "1961000000.0": 51703336.0, "1962000000.0": 51704137.8, "1963000000.0": 51704938.9, "1964000000.0": 51705739.2, "1965000000.0": 51706538.7, "1966000000.0": 51707337.4, "1967000000.0": 51708135.3, "1968000000.0": 51708932.5, "1969000000.0": 51709728.8, "1970000000.0": 51710524.4, "1971000000.0": 51711319.2, "1972000000.0": 51712113.2, "1973000000.0": 51712906.4, "1974000000.0": 51713698.8, "1975000000.0": 51714490.5, "1976000000.0": 51715281.4, "1977000000.0": 51716071.5, "1978000000.0": 51716860.9, "1979000000.0": 51717649.4, "1980000000.0": 51718437.2, "1981000000.0": 51719224.2, "1982000000.0": 51720010.5, "1983000000.0": 51720796.0, "1984000000.0": 51721580.7, "1985000000.0": 51722364.7, "1986000000.0": 51723147.9, "1987000000.0": 51723930.3, "1988000000.0": 51724711.9, "1989000000.0": 51725492.8, "1990000000.0": 51726273.0, "1991000000.0": 51727052.4, "1992000000.0": 51727831.0, "1993000000.0": 51728608.8, "1994000000.0": 51729386.0, "1995000000.0": 51730162.3, "1996000000.0": 51730937.9, "1997000000.0": 51731712.7, "1998000000.0": 51732486.8, "1999000000.0": 51733260.2, "2000000000.0": 51734032.8, "2001000000.0": 51734804.6, "2002000000.0": 51735575.7, "2003000000.0": 51736346.1, "2004000000.0": 51737115.7, "2005000000.0": 51737884.5, "2006000000.0": 51738652.7, "2007000000.0": 51739420.0, "2008000000.0": 51740186.7, "2009000000.0": 51740952.6, "2010000000.0": 51741717.7, "2011000000.0": 51742482.1, "2012000000.0": 51743245.8, "2013000000.0": 51744008.8, "2014000000.0": 51744771.0, "2015000000.0": 51745532.4, "2016000000.0": 51746293.2, "2017000000.0": 51747053.2, "2018000000.0": 51747812.5, "2019000000.0": 51748571.0, "2020000000.0": 51749328.9, "2021000000.0": 51750086.0, "2022000000.0": 51750842.3, "2023000000.0": 51751598.0, "2024000000.0": 51752352.9, "2025000000.0": 51753107.1, "2026000000.0": 51753860.6, "2027000000.0": 51754613.3, "2028000000.0": 51755365.4, "2029000000.0": 51756116.7, "2030000000.0": 51756867.3, "2031000000.0": 51757617.2, "2032000000.0": 51758366.3, "2033000000.0": 51759114.8, "2034000000.0": 51759862.5, "2035000000.0": 51760609.6, "2036000000.0": 51761355.9, "2037000000.0": 51762101.5, "2038000000.0": 51762846.4, "2039000000.0": 51763590.6, "2040000000.0": 51764334.0, "2041000000.0": 51765076.8, "2042000000.0": 51765818.9, "2043000000.0": 51766560.2, "2044000000.0": 51767300.9, "2045000000.0": 51768040.8, "2046000000.0": 51768780.1, "2047000000.0": 51769518.6, "2048000000.0": 51770256.5, "2049000000.0": 51770993.6, "2050000000.0": 51771730.1, "2051000000.0": 51772465.9, "2052000000.0": 51773200.9, "2053000000.0": 51773935.3, "2054000000.0": 51774669.0, "2055000000.0": 51775401.9, "2056000000.0": 51776134.2, "2057000000.0": 51776865.8, "2058000000.0": 51777596.7, "2059000000.0": 51778327.0, "2060000000.0": 51779056.5, "2061000000.0": 51779785.3, "2062000000.0": 51780513.5, "2063000000.0": 51781241.0, "2064000000.0": 51781967.8, "2065000000.0": 51782693.9, "2066000000.0": 51783419.3, "2067000000.0": 51784144.0, "2068000000.0": 51784868.1, "2069000000.0": 51785591.5, "2070000000.0": 51786314.2, "2071000000.0": 51787036.2, "2072000000.0": 51787757.6, "2073000000.0": 51788478.3, "2074000000.0": 51789198.3, "2075000000.0": 51789917.6, "2076000000.0": 51790636.2, "2077000000.0": 51791354.2, "2078000000.0": 51792071.5, "2079000000.0": 51792788.2, "2080000000.0": 51793504.2, "2081000000.0": 51794219.5, "2082000000.0": 51794934.1, "2083000000.0": 51795648.1, "2084000000.0": 51796361.4, "2085000000.0": 51797074.0, "2086000000.0": 51797786.0, "2087000000.0": 51798497.3, "2088000000.0": 51799208.0, "2089000000.0": 51799918.0, "2090000000.0": 51800627.3, "2091000000.0": 51801336.0, "2092000000.0": 51802044.1, "2093000000.0": 51802751.4, "2094000000.0": 51803458.1, "2095000000.0": 51804164.2, "2096000000.0": 51804869.6, "2097000000.0": 51805574.3, "2098000000.0": 51806278.4, "2099000000.0": 51806981.9, "2100000000.0": 51807684.7, "2101000000.0": 51808386.8, "2102000000.0": 51809088.3, "2103000000.0": 51809789.2, "2104000000.0": 51810489.4, "2105000000.0": 51811188.9, "2106000000.0": 51811887.8, "2107000000.0": 51812586.1, "2108000000.0": 51813283.7, "2109000000.0": 51813980.7, "2110000000.0": 51814677.0, "2111000000.0": 51815372.7, "2112000000.0": 51816067.8, "2113000000.0": 51816762.2, "2114000000.0": 51817456.0, "2115000000.0": 51818149.2, "2116000000.0": 51818841.7, "2117000000.0": 51819533.5, "2118000000.0": 51820224.8, "2119000000.0": 51820915.4, "2120000000.0": 51821605.4, "2121000000.0": 51822294.7, "2122000000.0": 51822983.4, "2123000000.0": 51823671.5, "2124000000.0": 51824358.9, "2125000000.0": 51825045.8, "2126000000.0": 51825732.0, "2127000000.0": 51826417.5, "2128000000.0": 51827102.5, "2129000000.0": 51827786.8, "2130000000.0": 51828470.5, "2131000000.0": 51829153.6, "2132000000.0": 51829836.0, "2133000000.0": 51830517.8, "2134000000.0": 51831199.0, "2135000000.0": 51831879.6, "2136000000.0": 51832559.6, "2137000000.0": 51833238.9, "2138000000.0": 51833917.7, "2139000000.0": 51834595.8, "2140000000.0": 51835273.3, "2141000000.0": 51835950.2, "2142000000.0": 51836626.5, "2143000000.0": 51837302.1, "2144000000.0": 51837977.2, "2145000000.0": 51838651.6, "2146000000.0": 51839325.4, "2147000000.0": 51839998.6, "2148000000.0": 51840671.2, "2149000000.0": 51841343.2, "2150000000.0": 51842014.6, "2151000000.0": 51842685.4, "2152000000.0": 51843355.6, "2153000000.0": 51844025.2, "2154000000.0": 51844694.1, "2155000000.0": 51845362.5, "2156000000.0": 51846030.3, "2157000000.0": 51846697.4, "2158000000.0": 51847364.0, "2159000000.0": 51848029.9, "2160000000.0": 51848695.3, "2161000000.0": 51849360.1, "2162000000.0": 51850024.2, "2163000000.0": 51850687.8, "2164000000.0": 51851350.8, "2165000000.0": 51852013.2, "2166000000.0": 51852674.9, "2167000000.0": 51853336.1, "2168000000.0": 51853996.7, "2169000000.0": 51854656.7, "2170000000.0": 51855316.2, "2171000000.0": 51855975.0, "2172000000.0": 51856633.2, "2173000000.0": 51857290.9, "2174000000.0": 51857947.9, "2175000000.0": 51858604.4, "2176000000.0": 51859260.3, "2177000000.0": 51859915.6, "2178000000.0": 51860570.3, "2179000000.0": 51861224.4, "2180000000.0": 51861878.0, "2181000000.0": 51862530.9, "2182000000.0": 51863183.3, "2183000000.0": 51863835.1, "2184000000.0": 51864486.4, "2185000000.0": 51865137.0, "2186000000.0": 51865787.1, "2187000000.0": 51866436.5, "2188000000.0": 51867085.5, "2189000000.0": 51867733.8, "2190000000.0": 51868381.5, "2191000000.0": 51869028.7, "2192000000.0": 51869675.3, "2193000000.0": 51870321.4, "2194000000.0": 51870966.8, "2195000000.0": 51871611.7, "2196000000.0": 51872256.1, "2197000000.0": 51872899.8, "2198000000.0": 51873543.0, "2199000000.0": 51874185.6, "2200000000.0": 51874827.6, "2201000000.0": 51875469.1, "2202000000.0": 51876110.0, "2203000000.0": 51876750.4, "2204000000.0": 51877390.2, "2205000000.0": 51878029.4, "2206000000.0": 51878668.0, "2207000000.0": 51879306.1, "2208000000.0": 51879943.6, "2209000000.0": 51880580.6, "2210000000.0": 51881217.0, "2211000000.0": 51881852.9, "2212000000.0": 51882488.2, "2213000000.0": 51883122.9, "2214000000.0": 51883757.1, "2215000000.0": 51884390.7, "2216000000.0": 51885023.7, "2217000000.0": 51885656.2, "2218000000.0": 51886288.2, "2219000000.0": 51886919.6, "2220000000.0": 51887550.4, "2221000000.0": 51888180.7, "2222000000.0": 51888810.5, "2223000000.0": 51889439.6, "2224000000.0": 51890068.3, "2225000000.0": 51890696.4, "2226000000.0": 51891323.9, "2227000000.0": 51891950.9, "2228000000.0": 51892577.4, "2229000000.0": 51893203.2, "2230000000.0": 51893828.6, "2231000000.0": 51894453.4, "2232000000.0": 51895077.7, "2233000000.0": 51895701.4, "2234000000.0": 51896324.6, "2235000000.0": 51896947.2, "2236000000.0": 51897569.3, "2237000000.0": 51898190.8, "2238000000.0": 51898811.8, "2239000000.0": 51899432.3, "2240000000.0": 51900052.3, "2241000000.0": 51900671.6, "2242000000.0": 51901290.5, "2243000000.0": 51901908.8, "2244000000.0": 51902526.6, "2245000000.0": 51903143.9, "2246000000.0": 51903760.6, "2247000000.0": 51904376.7, "2248000000.0": 51904992.4, "2249000000.0": 51905607.5, "2250000000.0": 51906222.1, "2251000000.0": 51906836.1, "2252000000.0": 51907449.7, "2253000000.0": 51908062.7, "2254000000.0": 51908675.1, "2255000000.0": 51909287.0, "2256000000.0": 51909898.5, "2257000000.0": 51910509.3, "2258000000.0": 51911119.7, "2259000000.0": 51911729.5, "2260000000.0": 51912338.8, "2261000000.0": 51912947.6, "2262000000.0": 51913555.8, "2263000000.0": 51914163.6, "2264000000.0": 51914770.8, "2265000000.0": 51915377.5, "2266000000.0": 51915983.6, "2267000000.0": 51916589.3, "2268000000.0": 51917194.4, "2269000000.0": 51917799.0, "2270000000.0": 51918403.1, "2271000000.0": 51919006.7, "2272000000.0": 51919609.7, "2273000000.0": 51920212.3, "2274000000.0": 51920814.3, "2275000000.0": 51921415.8, "2276000000.0": 51922016.8, "2277000000.0": 51922617.3, "2278000000.0": 51923217.2, "2279000000.0": 51923816.7, "2280000000.0": 51924415.6, "2281000000.0": 51925014.1, "2282000000.0": 51925612.0, "2283000000.0": 51926209.4, "2284000000.0": 51926806.3, "2285000000.0": 51927402.7, "2286000000.0": 51927998.6, "2287000000.0": 51928593.9, "2288000000.0": 51929188.8, "2289000000.0": 51929783.2, "2290000000.0": 51930377.0, "2291000000.0": 51930970.4, "2292000000.0": 51931563.3, "2293000000.0": 51932155.6, "2294000000.0": 51932747.5, "2295000000.0": 51933338.8, "2296000000.0": 51933929.6, "2297000000.0": 51934520.0, "2298000000.0": 51935109.8, "2299000000.0": 51935699.2, "2300000000.0": 51936288.0, "2301000000.0": 51936876.4, "2302000000.0": 51937464.2, "2303000000.0": 51938051.6, "2304000000.0": 51938638.4, "2305000000.0": 51939224.8, "2306000000.0": 51939810.6, "2307000000.0": 51940396.0, "2308000000.0": 51940980.9, "2309000000.0": 51941565.3, "2310000000.0": 51942149.2, "2311000000.0": 51942732.6, "2312000000.0": 51943315.5, "2313000000.0": 51943897.9, "2314000000.0": 51944479.8, "2315000000.0": 51945061.3, "2316000000.0": 51945642.2, "2317000000.0": 51946222.7, "2318000000.0": 51946802.6, "2319000000.0": 51947382.1, "2320000000.0": 51947961.1, "2321000000.0": 51948539.6, "2322000000.0": 51949117.7, "2323000000.0": 51949695.2, "2324000000.0": 51950272.3, "2325000000.0": 51950848.9, "2326000000.0": 51951425.0, "2327000000.0": 51952000.6, "2328000000.0": 51952575.7, "2329000000.0": 51953150.3, "2330000000.0": 51953724.5, "2331000000.0": 51954298.2, "2332000000.0": 51954871.4, "2333000000.0": 51955444.2, "2334000000.0": 51956016.4, "2335000000.0": 51956588.2, "2336000000.0": 51957159.5, "2337000000.0": 51957730.3, "2338000000.0": 51958300.7, "2339000000.0": 51958870.5, "2340000000.0": 51959439.9, "2341000000.0": 51960008.9, "2342000000.0": 51960577.3, "2343000000.0": 51961145.3, "2344000000.0": 51961712.8, "2345000000.0": 51962279.9, "2346000000.0": 51962846.4, "2347000000.0": 51963412.5, "2348000000.0": 51963978.1, "2349000000.0": 51964543.3, "2350000000.0": 51965108.0, "2351000000.0": 51965672.2, "2352000000.0": 51966236.0, "2353000000.0": 51966799.3, "2354000000.0": 51967362.1, "2355000000.0": 51967924.4, "2356000000.0": 51968486.3, "2357000000.0": 51969047.8, "2358000000.0": 51969608.7, "2359000000.0": 51970169.2, "2360000000.0": 51970729.3, "2361000000.0": 51971288.8, "2362000000.0": 51971848.0, "2363000000.0": 51972406.6, "2364000000.0": 51972964.8, "2365000000.0": 51973522.5, "2366000000.0": 51974079.8, "2367000000.0": 51974636.6, "2368000000.0": 51975193.0, "2369000000.0": 51975748.9, "2370000000.0": 51976304.3, "2371000000.0": 51976859.3, "2372000000.0": 51977413.9, "2373000000.0": 51977967.9, "2374000000.0": 51978521.5, "2375000000.0": 51979074.7, "2376000000.0": 51979627.4, "2377000000.0": 51980179.7, "2378000000.0": 51980731.5, "2379000000.0": 51981282.9, "2380000000.0": 51981833.8, "2381000000.0": 51982384.2, "2382000000.0": 51982934.2, "2383000000.0": 51983483.8, "2384000000.0": 51984032.9, "2385000000.0": 51984581.5, "2386000000.0": 51985129.7, "2387000000.0": 51985677.5, "2388000000.0": 51986224.8, "2389000000.0": 51986771.7, "2390000000.0": 51987318.1, "2391000000.0": 51987864.1, "2392000000.0": 51988409.6, "2393000000.0": 51988954.7, "2394000000.0": 51989499.3, "2395000000.0": 51990043.5, "2396000000.0": 51990587.3, "2397000000.0": 51991130.6, "2398000000.0": 51991673.5, "2399000000.0": 51992215.9, "2400000000.0": 51992757.9, "2401000000.0": 51993299.5, "2402000000.0": 51993840.6, "2403000000.0": 51994381.3, "2404000000.0": 51994921.5, "2405000000.0": 51995461.3, "2406000000.0": 51996000.7, "2407000000.0": 51996539.6, "2408000000.0": 51997078.1, "2409000000.0": 51997616.1, "2410000000.0": 51998153.7, "2411000000.0": 51998690.9, "2412000000.0": 51999227.7, "2413000000.0": 51999764.0, "2414000000.0": 52000299.9, "2415000000.0": 52000835.3, "2416000000.0": 52001370.3, "2417000000.0": 52001904.9, "2418000000.0": 52002439.1, "2419000000.0": 52002972.8, "2420000000.0": 52003506.1, "2421000000.0": 52004039.0, "2422000000.0": 52004571.4, "2423000000.0": 52005103.4, "2424000000.0": 52005635.0, "2425000000.0": 52006166.1, "2426000000.0": 52006696.9, "2427000000.0": 52007227.2, "2428000000.0": 52007757.0, "2429000000.0": 52008286.5, "2430000000.0": 52008815.5, "2431000000.0": 52009344.1, "2432000000.0": 52009872.3, "2433000000.0": 52010400.1, "2434000000.0": 52010927.4, "2435000000.0": 52011454.3, "2436000000.0": 52011980.8, "2437000000.0": 52012506.8, "2438000000.0": 52013032.5, "2439000000.0": 52013557.7, "2440000000.0": 52014082.5, "2441000000.0": 52014606.9, "2442000000.0": 52015130.9, "2443000000.0": 52015654.4, "2444000000.0": 52016177.6, "2445000000.0": 52016700.3, "2446000000.0": 52017222.6, "2447000000.0": 52017744.5, "2448000000.0": 52018265.9, "2449000000.0": 52018787.0, "2450000000.0": 52019307.6, "2451000000.0": 52019827.8, "2452000000.0": 52020347.6, "2453000000.0": 52020867.0, "2454000000.0": 52021386.0, "2455000000.0": 52021904.6, "2456000000.0": 52022422.7, "2457000000.0": 52022940.5, "2458000000.0": 52023457.8, "2459000000.0": 52023974.8, "2460000000.0": 52024491.3, "2461000000.0": 52025007.4, "2462000000.0": 52025523.1, "2463000000.0": 52026038.4, "2464000000.0": 52026553.3, "2465000000.0": 52027067.7, "2466000000.0": 52027581.8, "2467000000.0": 52028095.5, "2468000000.0": 52028608.7, "2469000000.0": 52029121.6, "2470000000.0": 52029634.0, "2471000000.0": 52030146.1, "2472000000.0": 52030657.7, "2473000000.0": 52031168.9, "2474000000.0": 52031679.8, "2475000000.0": 52032190.2, "2476000000.0": 52032700.2, "2477000000.0": 52033209.8, "2478000000.0": 52033719.1, "2479000000.0": 52034227.9, "2480000000.0": 52034736.3, "2481000000.0": 52035244.3, "2482000000.0": 52035752.0, "2483000000.0": 52036259.2, "2484000000.0": 52036766.0, "2485000000.0": 52037272.4, "2486000000.0": 52037778.5, "2487000000.0": 52038284.1, "2488000000.0": 52038789.3, "2489000000.0": 52039294.2, "2490000000.0": 52039798.6, "2491000000.0": 52040302.7, "2492000000.0": 52040806.3, "2493000000.0": 52041309.6, "2494000000.0": 52041812.5, "2495000000.0": 52042315.0, "2496000000.0": 52042817.0, "2497000000.0": 52043318.7, "2498000000.0": 52043820.0, "2499000000.0": 52044320.9, "2500000000.0": 52044821.5, "2501000000.0": 52045321.6, "2502000000.0": 52045821.3, "2503000000.0": 52046320.7, "2504000000.0": 52046819.6, "2505000000.0": 52047318.2, "2506000000.0": 52047816.4, "2507000000.0": 52048314.2, "2508000000.0": 52048811.6, "2509000000.0": 52049308.6, "2510000000.0": 52049805.2, "2511000000.0": 52050301.5, "2512000000.0": 52050797.4, "2513000000.0": 52051292.8, "2514000000.0": 52051787.9, "2515000000.0": 52052282.6, "2516000000.0": 52052777.0, "2517000000.0": 52053270.9, "2518000000.0": 52053764.5, "2519000000.0": 52054257.6, "2520000000.0": 52054750.4, "2521000000.0": 52055242.9, "2522000000.0": 52055734.9, "2523000000.0": 52056226.5, "2524000000.0": 52056717.8, "2525000000.0": 52057208.7, "2526000000.0": 52057699.2, "2527000000.0": 52058189.4, "2528000000.0": 52058679.1, "2529000000.0": 52059168.5, "2530000000.0": 52059657.5, "2531000000.0": 52060146.1, "2532000000.0": 52060634.4, "2533000000.0": 52061122.2, "2534000000.0": 52061609.7, "2535000000.0": 52062096.9, "2536000000.0": 52062583.6, "2537000000.0": 52063070.0, "2538000000.0": 52063556.0, "2539000000.0": 52064041.6, "2540000000.0": 52064526.8, "2541000000.0": 52065011.7, "2542000000.0": 52065496.2, "2543000000.0": 52065980.4, "2544000000.0": 52066464.1, "2545000000.0": 52066947.5, "2546000000.0": 52067430.5, "2547000000.0": 52067913.2, "2548000000.0": 52068395.5, "2549000000.0": 52068877.4, "2550000000.0": 52069358.9, "2551000000.0": 52069840.1, "2552000000.0": 52070320.9, "2553000000.0": 52070801.4, "2554000000.0": 52071281.4, "2555000000.0": 52071761.1, "2556000000.0": 52072240.5, "2557000000.0": 52072719.4, "2558000000.0": 52073198.1, "2559000000.0": 52073676.3, "2560000000.0": 52074154.2, "2561000000.0": 52074631.7, "2562000000.0": 52075108.8, "2563000000.0": 52075585.6, "2564000000.0": 52076062.0, "2565000000.0": 52076538.1, "2566000000.0": 52077013.8, "2567000000.0": 52077489.1, "2568000000.0": 52077964.1, "2569000000.0": 52078438.7, "2570000000.0": 52078913.0, "2571000000.0": 52079386.9, "2572000000.0": 52079860.4, "2573000000.0": 52080333.6, "2574000000.0": 52080806.4, "2575000000.0": 52081278.9, "2576000000.0": 52081751.0, "2577000000.0": 52082222.7, "2578000000.0": 52082694.1, "2579000000.0": 52083165.1, "2580000000.0": 52083635.8, "2581000000.0": 52084106.1, "2582000000.0": 52084576.1, "2583000000.0": 52085045.7, "2584000000.0": 52085514.9, "2585000000.0": 52085983.8, "2586000000.0": 52086452.4, "2587000000.0": 52086920.6, "2588000000.0": 52087388.4, "2589000000.0": 52087855.9, "2590000000.0": 52088323.0, "2591000000.0": 52088789.8, "2592000000.0": 52089256.2, "2593000000.0": 52089722.3, "2594000000.0": 52090188.0, "2595000000.0": 52090653.4, "2596000000.0": 52091118.4, "2597000000.0": 52091583.1, "2598000000.0": 52092047.4, "2599000000.0": 52092511.4, "2600000000.0": 52092975.0, "2601000000.0": 52093438.3, "2602000000.0": 52093901.2, "2603000000.0": 52094363.8, "2604000000.0": 52094826.1, "2605000000.0": 52095287.9, "2606000000.0": 52095749.5, "2607000000.0": 52096210.7, "2608000000.0": 52096671.5, "2609000000.0": 52097132.1, "2610000000.0": 52097592.2, "2611000000.0": 52098052.0, "2612000000.0": 52098511.5, "2613000000.0": 52098970.7, "2614000000.0": 52099429.4, "2615000000.0": 52099887.9, "2616000000.0": 52100346.0, "2617000000.0": 52100803.8, "2618000000.0": 52101261.2, "2619000000.0": 52101718.3, "2620000000.0": 52102175.0, "2621000000.0": 52102631.4, "2622000000.0": 52103087.5, "2623000000.0": 52103543.2, "2624000000.0": 52103998.6, "2625000000.0": 52104453.6, "2626000000.0": 52104908.3, "2627000000.0": 52105362.7, "2628000000.0": 52105816.7, "2629000000.0": 52106270.4, "2630000000.0": 52106723.8, "2631000000.0": 52107176.8, "2632000000.0": 52107629.5, "2633000000.0": 52108081.8, "2634000000.0": 52108533.8, "2635000000.0": 52108985.5, "2636000000.0": 52109436.8, "2637000000.0": 52109887.8, "2638000000.0": 52110338.5, "2639000000.0": 52110788.8, "2640000000.0": 52111238.9, "2641000000.0": 52111688.5, "2642000000.0": 52112137.9, "2643000000.0": 52112586.9, "2644000000.0": 52113035.6, "2645000000.0": 52113483.9, "2646000000.0": 52113931.9, "2647000000.0": 52114379.6, "2648000000.0": 52114827.0, "2649000000.0": 52115274.0, "2650000000.0": 52115720.7, "2651000000.0": 52116167.0, "2652000000.0": 52116613.1, "2653000000.0": 52117058.8, "2654000000.0": 52117504.2, "2655000000.0": 52117949.2, "2656000000.0": 52118393.9, "2657000000.0": 52118838.3, "2658000000.0": 52119282.4, "2659000000.0": 52119726.1, "2660000000.0": 52120169.6, "2661000000.0": 52120612.7, "2662000000.0": 52121055.4, "2663000000.0": 52121497.9, "2664000000.0": 52121940.0, "2665000000.0": 52122381.8, "2666000000.0": 52122823.3, "2667000000.0": 52123264.4, "2668000000.0": 52123705.2, "2669000000.0": 52124145.7, "2670000000.0": 52124585.9, "2671000000.0": 52125025.8, "2672000000.0": 52125465.3, "2673000000.0": 52125904.5, "2674000000.0": 52126343.4, "2675000000.0": 52126782.0, "2676000000.0": 52127220.2, "2677000000.0": 52127658.2, "2678000000.0": 52128095.8, "2679000000.0": 52128533.1, "2680000000.0": 52128970.0, "2681000000.0": 52129406.7, "2682000000.0": 52129843.0, "2683000000.0": 52130279.1, "2684000000.0": 52130714.8, "2685000000.0": 52131150.1, "2686000000.0": 52131585.2, "2687000000.0": 52132020.0, "2688000000.0": 52132454.4, "2689000000.0": 52132888.5, "2690000000.0": 52133322.3, "2691000000.0": 52133755.8, "2692000000.0": 52134189.0, "2693000000.0": 52134621.9, "2694000000.0": 52135054.4, "2695000000.0": 52135486.6, "2696000000.0": 52135918.6, "2697000000.0": 52136350.2, "2698000000.0": 52136781.5, "2699000000.0": 52137212.5, "2700000000.0": 52137643.1, "2701000000.0": 52138073.5, "2702000000.0": 52138503.5, "2703000000.0": 52138933.3, "2704000000.0": 52139362.7, "2705000000.0": 52139791.8, "2706000000.0": 52140220.6, "2707000000.0": 52140649.1, "2708000000.0": 52141077.3, "2709000000.0": 52141505.2, "2710000000.0": 52141932.8, "2711000000.0": 52142360.0, "2712000000.0": 52142787.0, "2713000000.0": 52143213.6, "2714000000.0": 52143640.0, "2715000000.0": 52144066.0, "2716000000.0": 52144491.7, "2717000000.0": 52144917.1, "2718000000.0": 52145342.2, "2719000000.0": 52145767.1, "2720000000.0": 52146191.6, "2721000000.0": 52146615.8, "2722000000.0": 52147039.6, "2723000000.0": 52147463.2, "2724000000.0": 52147886.5, "2725000000.0": 52148309.5, "2726000000.0": 52148732.2, "2727000000.0": 52149154.5, "2728000000.0": 52149576.6, "2729000000.0": 52149998.4, "2730000000.0": 52150419.9, "2731000000.0": 52150841.0, "2732000000.0": 52151261.9, "2733000000.0": 52151682.5, "2734000000.0": 52152102.7, "2735000000.0": 52152522.7, "2736000000.0": 52152942.3, "2737000000.0": 52153361.7, "2738000000.0": 52153780.8, "2739000000.0": 52154199.5, "2740000000.0": 52154618.0, "2741000000.0": 52155036.2, "2742000000.0": 52155454.0, "2743000000.0": 52155871.6, "2744000000.0": 52156288.9, "2745000000.0": 52156705.9, "2746000000.0": 52157122.5, "2747000000.0": 52157538.9, "2748000000.0": 52157955.0, "2749000000.0": 52158370.8, "2750000000.0": 52158786.3, "2751000000.0": 52159201.5, "2752000000.0": 52159616.4, "2753000000.0": 52160031.0, "2754000000.0": 52160445.3, "2755000000.0": 52160859.3, "2756000000.0": 52161273.1, "2757000000.0": 52161686.5, "2758000000.0": 52162099.6, "2759000000.0": 52162512.5, "2760000000.0": 52162925.0, "2761000000.0": 52163337.3, "2762000000.0": 52163749.3, "2763000000.0": 52164161.0, "2764000000.0": 52164572.4, "2765000000.0": 52164983.5, "2766000000.0": 52165394.3, "2767000000.0": 52165804.8, "2768000000.0": 52166215.0, "2769000000.0": 52166624.9, "2770000000.0": 52167034.6, "2771000000.0": 52167444.0, "2772000000.0": 52167853.0, "2773000000.0": 52168261.8, "2774000000.0": 52168670.3, "2775000000.0": 52169078.5, "2776000000.0": 52169486.4, "2777000000.0": 52169894.1, "2778000000.0": 52170301.4, "2779000000.0": 52170708.5, "2780000000.0": 52171115.2, "2781000000.0": 52171521.7, "2782000000.0": 52171927.9, "2783000000.0": 52172333.8, "2784000000.0": 52172739.5, "2785000000.0": 52173144.8, "2786000000.0": 52173549.9, "2787000000.0": 52173954.6, "2788000000.0": 52174359.1, "2789000000.0": 52174763.3, "2790000000.0": 52175167.3, "2791000000.0": 52175570.9, "2792000000.0": 52175974.3, "2793000000.0": 52176377.3, "2794000000.0": 52176780.1, "2795000000.0": 52177182.6, "2796000000.0": 52177584.9, "2797000000.0": 52177986.8, "2798000000.0": 52178388.5, "2799000000.0": 52178789.9, "2800000000.0": 52179191.0, "2801000000.0": 52179591.8, "2802000000.0": 52179992.4, "2803000000.0": 52180392.6, "2804000000.0": 52180792.6, "2805000000.0": 52181192.3, "2806000000.0": 52181591.8, "2807000000.0": 52181990.9, "2808000000.0": 52182389.8, "2809000000.0": 52182788.4, "2810000000.0": 52183186.7, "2811000000.0": 52183584.7, "2812000000.0": 52183982.5, "2813000000.0": 52184380.0, "2814000000.0": 52184777.2, "2815000000.0": 52185174.1, "2816000000.0": 52185570.8, "2817000000.0": 52185967.2, "2818000000.0": 52186363.3, "2819000000.0": 52186759.1, "2820000000.0": 52187154.7, "2821000000.0": 52187550.0, "2822000000.0": 52187945.0, "2823000000.0": 52188339.7, "2824000000.0": 52188734.2, "2825000000.0": 52189128.4, "2826000000.0": 52189522.3, "2827000000.0": 52189916.0, "2828000000.0": 52190309.3, "2829000000.0": 52190702.4, "2830000000.0": 52191095.3, "2831000000.0": 52191487.8, "2832000000.0": 52191880.1, "2833000000.0": 52192272.1, "2834000000.0": 52192663.9, "2835000000.0": 52193055.3, "2836000000.0": 52193446.6, "2837000000.0": 52193837.5, "2838000000.0": 52194228.2, "2839000000.0": 52194618.6, "2840000000.0": 52195008.7, "2841000000.0": 52195398.5, "2842000000.0": 52195788.1, "2843000000.0": 52196177.5, "2844000000.0": 52196566.5, "2845000000.0": 52196955.3, "2846000000.0": 52197343.8, "2847000000.0": 52197732.1, "2848000000.0": 52198120.1, "2849000000.0": 52198507.8, "2850000000.0": 52198895.2, "2851000000.0": 52199282.4, "2852000000.0": 52199669.3, "2853000000.0": 52200056.0, "2854000000.0": 52200442.4, "2855000000.0": 52200828.5, "2856000000.0": 52201214.4, "2857000000.0": 52201600.0, "2858000000.0": 52201985.3, "2859000000.0": 52202370.4, "2860000000.0": 52202755.2, "2861000000.0": 52203139.7, "2862000000.0": 52203524.0, "2863000000.0": 52203908.0, "2864000000.0": 52204291.8, "2865000000.0": 52204675.3, "2866000000.0": 52205058.5, "2867000000.0": 52205441.5, "2868000000.0": 52205824.2, "2869000000.0": 52206206.6, "2870000000.0": 52206588.8, "2871000000.0": 52206970.8, "2872000000.0": 52207352.4, "2873000000.0": 52207733.8, "2874000000.0": 52208115.0, "2875000000.0": 52208495.9, "2876000000.0": 52208876.5, "2877000000.0": 52209256.9, "2878000000.0": 52209637.0, "2879000000.0": 52210016.8, "2880000000.0": 52210396.4, "2881000000.0": 52210775.8, "2882000000.0": 52211154.8, "2883000000.0": 52211533.7, "2884000000.0": 52211912.2, "2885000000.0": 52212290.5, "2886000000.0": 52212668.6, "2887000000.0": 52213046.4, "2888000000.0": 52213423.9, "2889000000.0": 52213801.2, "2890000000.0": 52214178.2, "2891000000.0": 52214555.0, "2892000000.0": 52214931.5, "2893000000.0": 52215307.8, "2894000000.0": 52215683.8, "2895000000.0": 52216059.5, "2896000000.0": 52216435.0, "2897000000.0": 52216810.3, "2898000000.0": 52217185.3, "2899000000.0": 52217560.0, "2900000000.0": 52217934.5, "2901000000.0": 52218308.7, "2902000000.0": 52218682.7, "2903000000.0": 52219056.4, "2904000000.0": 52219429.9, "2905000000.0": 52219803.1, "2906000000.0": 52220176.1, "2907000000.0": 52220548.8, "2908000000.0": 52220921.3, "2909000000.0": 52221293.5, "2910000000.0": 52221665.5, "2911000000.0": 52222037.2, "2912000000.0": 52222408.7, "2913000000.0": 52222779.9, "2914000000.0": 52223150.9, "2915000000.0": 52223521.6, "2916000000.0": 52223892.1, "2917000000.0": 52224262.3, "2918000000.0": 52224632.3, "2919000000.0": 52225002.0, "2920000000.0": 52225371.5, "2921000000.0": 52225740.7, "2922000000.0": 52226109.7, "2923000000.0": 52226478.5, "2924000000.0": 52226847.0, "2925000000.0": 52227215.2, "2926000000.0": 52227583.2, "2927000000.0": 52227950.9, "2928000000.0": 52228318.5, "2929000000.0": 52228685.7, "2930000000.0": 52229052.7, "2931000000.0": 52229419.5, "2932000000.0": 52229786.0, "2933000000.0": 52230152.3, "2934000000.0": 52230518.3, "2935000000.0": 52230884.1, "2936000000.0": 52231249.7, "2937000000.0": 52231615.0, "2938000000.0": 52231980.1, "2939000000.0": 52232344.9, "2940000000.0": 52232709.4, "2941000000.0": 52233073.8, "2942000000.0": 52233437.9, "2943000000.0": 52233801.7, "2944000000.0": 52234165.3, "2945000000.0": 52234528.7, "2946000000.0": 52234891.8, "2947000000.0": 52235254.7, "2948000000.0": 52235617.3, "2949000000.0": 52235979.7, "2950000000.0": 52236341.9, "2951000000.0": 52236703.8, "2952000000.0": 52237065.5, "2953000000.0": 52237426.9, "2954000000.0": 52237788.1, "2955000000.0": 52238149.1, "2956000000.0": 52238509.8, "2957000000.0": 52238870.3, "2958000000.0": 52239230.5, "2959000000.0": 52239590.5, "2960000000.0": 52239950.3, "2961000000.0": 52240309.8, "2962000000.0": 52240669.1, "2963000000.0": 52241028.2, "2964000000.0": 52241387.0, "2965000000.0": 52241745.6, "2966000000.0": 52242103.9, "2967000000.0": 52242462.0, "2968000000.0": 52242819.9, "2969000000.0": 52243177.5, "2970000000.0": 52243534.9, "2971000000.0": 52243892.1, "2972000000.0": 52244249.0, "2973000000.0": 52244605.7, "2974000000.0": 52244962.2, "2975000000.0": 52245318.4, "2976000000.0": 52245674.4, "2977000000.0": 52246030.1, "2978000000.0": 52246385.6, "2979000000.0": 52246740.9, "2980000000.0": 52247096.0, "2981000000.0": 52247450.8, "2982000000.0": 52247805.4, "2983000000.0": 52248159.7, "2984000000.0": 52248513.9, "2985000000.0": 52248867.7, "2986000000.0": 52249221.4, "2987000000.0": 52249574.8, "2988000000.0": 52249928.0, "2989000000.0": 52250281.0, "2990000000.0": 52250633.7, "2991000000.0": 52250986.2, "2992000000.0": 52251338.5, "2993000000.0": 52251690.5, "2994000000.0": 52252042.3, "2995000000.0": 52252393.9, "2996000000.0": 52252745.2, "2997000000.0": 52253096.4, "2998000000.0": 52253447.2, "2999000000.0": 52253797.9, "3000000000.0": 52254148.3, "3001000000.0": 52254498.5, "3002000000.0": 52254848.5, "3003000000.0": 52255198.3, "3004000000.0": 52255547.8, "3005000000.0": 52255897.1, "3006000000.0": 52256246.1, "3007000000.0": 52256595.0, "3008000000.0": 52256943.6, "3009000000.0": 52257291.9, "3010000000.0": 52257640.1, "3011000000.0": 52257988.0, "3012000000.0": 52258335.7, "3013000000.0": 52258683.2, "3014000000.0": 52259030.4, "3015000000.0": 52259377.5, "3016000000.0": 52259724.3, "3017000000.0": 52260070.8, "3018000000.0": 52260417.2, "3019000000.0": 52260763.3, "3020000000.0": 52261109.2, "3021000000.0": 52261454.9, "3022000000.0": 52261800.3, "3023000000.0": 52262145.6, "3024000000.0": 52262490.6, "3025000000.0": 52262835.3, "3026000000.0": 52263179.9, "3027000000.0": 52263524.2, "3028000000.0": 52263868.3, "3029000000.0": 52264212.2, "3030000000.0": 52264555.9, "3031000000.0": 52264899.3, "3032000000.0": 52265242.5, "3033000000.0": 52265585.5, "3034000000.0": 52265928.3, "3035000000.0": 52266270.9, "3036000000.0": 52266613.2, "3037000000.0": 52266955.3, "3038000000.0": 52267297.2, "3039000000.0": 52267638.9, "3040000000.0": 52267980.3, "3041000000.0": 52268321.6, "3042000000.0": 52268662.6, "3043000000.0": 52269003.4, "3044000000.0": 52269344.0, "3045000000.0": 52269684.3, "3046000000.0": 52270024.4, "3047000000.0": 52270364.4, "3048000000.0": 52270704.1, "3049000000.0": 52271043.5, "3050000000.0": 52271382.8, "3051000000.0": 52271721.8, "3052000000.0": 52272060.7, "3053000000.0": 52272399.3, "3054000000.0": 52272737.7, "3055000000.0": 52273075.9, "3056000000.0": 52273413.8, "3057000000.0": 52273751.6, "3058000000.0": 52274089.1, "3059000000.0": 52274426.4, "3060000000.0": 52274763.5, "3061000000.0": 52275100.4, "3062000000.0": 52275437.0, "3063000000.0": 52275773.5, "3064000000.0": 52276109.7, "3065000000.0": 52276445.7, "3066000000.0": 52276781.5, "3067000000.0": 52277117.1, "3068000000.0": 52277452.5, "3069000000.0": 52277787.6, "3070000000.0": 52278122.6, "3071000000.0": 52278457.3, "3072000000.0": 52278791.8, "3073000000.0": 52279126.1, "3074000000.0": 52279460.2, "3075000000.0": 52279794.1, "3076000000.0": 52280127.8, "3077000000.0": 52280461.2, "3078000000.0": 52280794.4, "3079000000.0": 52281127.5, "3080000000.0": 52281460.3, "3081000000.0": 52281792.9, "3082000000.0": 52282125.3, "3083000000.0": 52282457.5, "3084000000.0": 52282789.4, "3085000000.0": 52283121.2, "3086000000.0": 52283452.7, "3087000000.0": 52283784.1, "3088000000.0": 52284115.2, "3089000000.0": 52284446.1, "3090000000.0": 52284776.8, "3091000000.0": 52285107.3, "3092000000.0": 52285437.6, "3093000000.0": 52285767.7, "3094000000.0": 52286097.6, "3095000000.0": 52286427.2, "3096000000.0": 52286756.7, "3097000000.0": 52287085.9, "3098000000.0": 52287415.0, "3099000000.0": 52287743.8, "3100000000.0": 52288072.4, "3101000000.0": 52288400.8, "3102000000.0": 52288729.0, "3103000000.0": 52289057.0, "3104000000.0": 52289384.8, "3105000000.0": 52289712.4, "3106000000.0": 52290039.8, "3107000000.0": 52290366.9, "3108000000.0": 52290693.9, "3109000000.0": 52291020.7, "3110000000.0": 52291347.2, "3111000000.0": 52291673.6, "3112000000.0": 52291999.7, "3113000000.0": 52292325.6, "3114000000.0": 52292651.4, "3115000000.0": 52292976.9, "3116000000.0": 52293302.2, "3117000000.0": 52293627.3, "3118000000.0": 52293952.2, "3119000000.0": 52294276.9, "3120000000.0": 52294601.5, "3121000000.0": 52294925.7, "3122000000.0": 52295249.8, "3123000000.0": 52295573.7, "3124000000.0": 52295897.4, "3125000000.0": 52296220.9, "3126000000.0": 52296544.2, "3127000000.0": 52296867.3, "3128000000.0": 52297190.1, "3129000000.0": 52297512.8, "3130000000.0": 52297835.3, "3131000000.0": 52298157.6, "3132000000.0": 52298479.6, "3133000000.0": 52298801.5, "3134000000.0": 52299123.2, "3135000000.0": 52299444.6, "3136000000.0": 52299765.9, "3137000000.0": 52300087.0, "3138000000.0": 52300407.8, "3139000000.0": 52300728.5, "3140000000.0": 52301049.0, "3141000000.0": 52301369.2, "3142000000.0": 52301689.3, "3143000000.0": 52302009.1, "3144000000.0": 52302328.8, "3145000000.0": 52302648.3, "3146000000.0": 52302967.5, "3147000000.0": 52303286.6, "3148000000.0": 52303605.5, "3149000000.0": 52303924.1, "3150000000.0": 52304242.6, "3151000000.0": 52304560.9, "3152000000.0": 52304879.0, "3153000000.0": 52305196.8, "3154000000.0": 52305514.5, "3155000000.0": 52305832.0, "3156000000.0": 52306149.3, "3157000000.0": 52306466.4, "3158000000.0": 52306783.2, "3159000000.0": 52307099.9, "3160000000.0": 52307416.4, "3161000000.0": 52307732.7, "3162000000.0": 52308048.8, "3163000000.0": 52308364.8, "3164000000.0": 52308680.5, "3165000000.0": 52308996.0, "3166000000.0": 52309311.3, "3167000000.0": 52309626.4, "3168000000.0": 52309941.4, "3169000000.0": 52310256.1, "3170000000.0": 52310570.6, "3171000000.0": 52310885.0, "3172000000.0": 52311199.1, "3173000000.0": 52311513.1, "3174000000.0": 52311826.9, "3175000000.0": 52312140.4, "3176000000.0": 52312453.8, "3177000000.0": 52312767.0, "3178000000.0": 52313080.0, "3179000000.0": 52313392.8, "3180000000.0": 52313705.4, "3181000000.0": 52314017.8, "3182000000.0": 52314330.0, "3183000000.0": 52314642.0, "3184000000.0": 52314953.9, "3185000000.0": 52315265.5, "3186000000.0": 52315577.0, "3187000000.0": 52315888.2, "3188000000.0": 52316199.3, "3189000000.0": 52316510.2, "3190000000.0": 52316820.9, "3191000000.0": 52317131.4, "3192000000.0": 52317441.7, "3193000000.0": 52317751.8, "3194000000.0": 52318061.7, "3195000000.0": 52318371.4, "3196000000.0": 52318681.0, "3197000000.0": 52318990.3, "3198000000.0": 52319299.5, "3199000000.0": 52319608.5, "3200000000.0": 52319917.2, "3201000000.0": 52320225.8, "3202000000.0": 52320534.2, "3203000000.0": 52320842.5, "3204000000.0": 52321150.5, "3205000000.0": 52321458.3, "3206000000.0": 52321766.0, "3207000000.0": 52322073.4, "3208000000.0": 52322380.7, "3209000000.0": 52322687.8, "3210000000.0": 52322994.7, "3211000000.0": 52323301.4, "3212000000.0": 52323607.9, "3213000000.0": 52323914.3, "3214000000.0": 52324220.4, "3215000000.0": 52324526.4, "3216000000.0": 52324832.2, "3217000000.0": 52325137.8, "3218000000.0": 52325443.2, "3219000000.0": 52325748.4, "3220000000.0": 52326053.4, "3221000000.0": 52326358.3, "3222000000.0": 52326662.9, "3223000000.0": 52326967.4, "3224000000.0": 52327271.7, "3225000000.0": 52327575.8, "3226000000.0": 52327879.7, "3227000000.0": 52328183.5, "3228000000.0": 52328487.0, "3229000000.0": 52328790.4, "3230000000.0": 52329093.6, "3231000000.0": 52329396.6, "3232000000.0": 52329699.4, "3233000000.0": 52330002.0, "3234000000.0": 52330304.5, "3235000000.0": 52330606.7, "3236000000.0": 52330908.8, "3237000000.0": 52331210.7, "3238000000.0": 52331512.4, "3239000000.0": 52331813.9, "3240000000.0": 52332115.3, "3241000000.0": 52332416.5, "3242000000.0": 52332717.4, "3243000000.0": 52333018.2, "3244000000.0": 52333318.9, "3245000000.0": 52333619.3, "3246000000.0": 52333919.6, "3247000000.0": 52334219.6, "3248000000.0": 52334519.5, "3249000000.0": 52334819.3, "3250000000.0": 52335118.8, "3251000000.0": 52335418.1, "3252000000.0": 52335717.3, "3253000000.0": 52336016.3, "3254000000.0": 52336315.1, "3255000000.0": 52336613.7, "3256000000.0": 52336912.2, "3257000000.0": 52337210.5, "3258000000.0": 52337508.6, "3259000000.0": 52337806.5, "3260000000.0": 52338104.2, "3261000000.0": 52338401.8, "3262000000.0": 52338699.1, "3263000000.0": 52338996.3, "3264000000.0": 52339293.3, "3265000000.0": 52339590.2, "3266000000.0": 52339886.8, "3267000000.0": 52340183.3, "3268000000.0": 52340479.6, "3269000000.0": 52340775.7, "3270000000.0": 52341071.7, "3271000000.0": 52341367.5, "3272000000.0": 52341663.1, "3273000000.0": 52341958.5, "3274000000.0": 52342253.7, "3275000000.0": 52342548.8, "3276000000.0": 52342843.7, "3277000000.0": 52343138.4, "3278000000.0": 52343432.9, "3279000000.0": 52343727.3, "3280000000.0": 52344021.4, "3281000000.0": 52344315.4, "3282000000.0": 52344609.3, "3283000000.0": 52344902.9, "3284000000.0": 52345196.4, "3285000000.0": 52345489.7, "3286000000.0": 52345782.8, "3287000000.0": 52346075.8, "3288000000.0": 52346368.6, "3289000000.0": 52346661.2, "3290000000.0": 52346953.6, "3291000000.0": 52347245.9, "3292000000.0": 52347537.9, "3293000000.0": 52347829.8, "3294000000.0": 52348121.6, "3295000000.0": 52348413.1, "3296000000.0": 52348704.5, "3297000000.0": 52348995.7, "3298000000.0": 52349286.8, "3299000000.0": 52349577.6, "3300000000.0": 52349868.3, "3301000000.0": 52350158.8, "3302000000.0": 52350449.2, "3303000000.0": 52350739.4, "3304000000.0": 52351029.4, "3305000000.0": 52351319.2, "3306000000.0": 52351608.8, "3307000000.0": 52351898.3, "3308000000.0": 52352187.6, "3309000000.0": 52352476.8, "3310000000.0": 52352765.7, "3311000000.0": 52353054.5, "3312000000.0": 52353343.2, "3313000000.0": 52353631.6, "3314000000.0": 52353919.9, "3315000000.0": 52354208.0, "3316000000.0": 52354496.0, "3317000000.0": 52354783.7, "3318000000.0": 52355071.4, "3319000000.0": 52355358.8, "3320000000.0": 52355646.1, "3321000000.0": 52355933.1, "3322000000.0": 52356220.1, "3323000000.0": 52356506.8, "3324000000.0": 52356793.4, "3325000000.0": 52357079.8, "3326000000.0": 52357366.1, "3327000000.0": 52357652.2, "3328000000.0": 52357938.1, "3329000000.0": 52358223.8, "3330000000.0": 52358509.4, "3331000000.0": 52358794.8, "3332000000.0": 52359080.0, "3333000000.0": 52359365.1, "3334000000.0": 52359650.0, "3335000000.0": 52359934.7, "3336000000.0": 52360219.3, "3337000000.0": 52360503.7, "3338000000.0": 52360787.9, "3339000000.0": 52361072.0, "3340000000.0": 52361355.9, "3341000000.0": 52361639.6, "3342000000.0": 52361923.2, "3343000000.0": 52362206.6, "3344000000.0": 52362489.8, "3345000000.0": 52362772.9, "3346000000.0": 52363055.8, "3347000000.0": 52363338.5, "3348000000.0": 52363621.1, "3349000000.0": 52363903.5, "3350000000.0": 52364185.7, "3351000000.0": 52364467.8, "3352000000.0": 52364749.7, "3353000000.0": 52365031.4, "3354000000.0": 52365313.0, "3355000000.0": 52365594.4, "3356000000.0": 52365875.6, "3357000000.0": 52366156.7, "3358000000.0": 52366437.6, "3359000000.0": 52366718.4, "3360000000.0": 52366999.0, "3361000000.0": 52367279.4, "3362000000.0": 52367559.7, "3363000000.0": 52367839.8, "3364000000.0": 52368119.7, "3365000000.0": 52368399.5, "3366000000.0": 52368679.1, "3367000000.0": 52368958.5, "3368000000.0": 52369237.8, "3369000000.0": 52369516.9, "3370000000.0": 52369795.9, "3371000000.0": 52370074.7, "3372000000.0": 52370353.3, "3373000000.0": 52370631.8, "3374000000.0": 52370910.1, "3375000000.0": 52371188.2, "3376000000.0": 52371466.2, "3377000000.0": 52371744.0, "3378000000.0": 52372021.7, "3379000000.0": 52372299.2, "3380000000.0": 52372576.5, "3381000000.0": 52372853.7, "3382000000.0": 52373130.7, "3383000000.0": 52373407.6, "3384000000.0": 52373684.3, "3385000000.0": 52373960.8, "3386000000.0": 52374237.2, "3387000000.0": 52374513.4, "3388000000.0": 52374789.5, "3389000000.0": 52375065.3, "3390000000.0": 52375341.1, "3391000000.0": 52375616.7, "3392000000.0": 52375892.1, "3393000000.0": 52376167.3, "3394000000.0": 52376442.4, "3395000000.0": 52376717.4, "3396000000.0": 52376992.1, "3397000000.0": 52377266.8, "3398000000.0": 52377541.2, "3399000000.0": 52377815.5, "3400000000.0": 52378089.7, "3401000000.0": 52378363.6, "3402000000.0": 52378637.5, "3403000000.0": 52378911.1, "3404000000.0": 52379184.7, "3405000000.0": 52379458.0, "3406000000.0": 52379731.2, "3407000000.0": 52380004.2, "3408000000.0": 52380277.1, "3409000000.0": 52380549.8, "3410000000.0": 52380822.4, "3411000000.0": 52381094.8, "3412000000.0": 52381367.1, "3413000000.0": 52381639.2, "3414000000.0": 52381911.1, "3415000000.0": 52382182.9, "3416000000.0": 52382454.5, "3417000000.0": 52382726.0, "3418000000.0": 52382997.3, "3419000000.0": 52383268.5, "3420000000.0": 52383539.5, "3421000000.0": 52383810.3, "3422000000.0": 52384081.0, "3423000000.0": 52384351.6, "3424000000.0": 52384621.9, "3425000000.0": 52384892.2, "3426000000.0": 52385162.2, "3427000000.0": 52385432.2, "3428000000.0": 52385701.9, "3429000000.0": 52385971.5, "3430000000.0": 52386241.0, "3431000000.0": 52386510.3, "3432000000.0": 52386779.4, "3433000000.0": 52387048.4, "3434000000.0": 52387317.3, "3435000000.0": 52387585.9, "3436000000.0": 52387854.5, "3437000000.0": 52388122.8, "3438000000.0": 52388391.1, "3439000000.0": 52388659.1, "3440000000.0": 52388927.1, "3441000000.0": 52389194.8, "3442000000.0": 52389462.4, "3443000000.0": 52389729.9, "3444000000.0": 52389997.2, "3445000000.0": 52390264.4, "3446000000.0": 52390531.4, "3447000000.0": 52390798.2, "3448000000.0": 52391064.9, "3449000000.0": 52391331.5, "3450000000.0": 52391597.8, "3451000000.0": 52391864.1, "3452000000.0": 52392130.2, "3453000000.0": 52392396.1, "3454000000.0": 52392661.9, "3455000000.0": 52392927.5, "3456000000.0": 52393193.0, "3457000000.0": 52393458.4, "3458000000.0": 52393723.6, "3459000000.0": 52393988.6, "3460000000.0": 52394253.5, "3461000000.0": 52394518.2, "3462000000.0": 52394782.8, "3463000000.0": 52395047.2, "3464000000.0": 52395311.5, "3465000000.0": 52395575.6, "3466000000.0": 52395839.6, "3467000000.0": 52396103.5, "3468000000.0": 52396367.1, "3469000000.0": 52396630.7, "3470000000.0": 52396894.1, "3471000000.0": 52397157.3, "3472000000.0": 52397420.4, "3473000000.0": 52397683.3, "3474000000.0": 52397946.1, "3475000000.0": 52398208.8, "3476000000.0": 52398471.3, "3477000000.0": 52398733.6, "3478000000.0": 52398995.8, "3479000000.0": 52399257.9, "3480000000.0": 52399519.8, "3481000000.0": 52399781.5, "3482000000.0": 52400043.1, "3483000000.0": 52400304.6, "3484000000.0": 52400565.9, "3485000000.0": 52400827.1, "3486000000.0": 52401088.1, "3487000000.0": 52401348.9, "3488000000.0": 52401609.7, "3489000000.0": 52401870.2, "3490000000.0": 52402130.7, "3491000000.0": 52402391.0, "3492000000.0": 52402651.1, "3493000000.0": 52402911.1, "3494000000.0": 52403170.9, "3495000000.0": 52403430.6, "3496000000.0": 52403690.2, "3497000000.0": 52403949.6, "3498000000.0": 52404208.8, "3499000000.0": 52404468.0, "3500000000.0": 52404726.9, "3501000000.0": 52404985.7, "3502000000.0": 52405244.4, "3503000000.0": 52405503.0, "3504000000.0": 52405761.4, "3505000000.0": 52406019.6, "3506000000.0": 52406277.7, "3507000000.0": 52406535.6, "3508000000.0": 52406793.5, "3509000000.0": 52407051.1, "3510000000.0": 52407308.6, "3511000000.0": 52407566.0, "3512000000.0": 52407823.3, "3513000000.0": 52408080.3, "3514000000.0": 52408337.3, "3515000000.0": 52408594.1, "3516000000.0": 52408850.8, "3517000000.0": 52409107.3, "3518000000.0": 52409363.6, "3519000000.0": 52409619.9, "3520000000.0": 52409876.0, "3521000000.0": 52410131.9, "3522000000.0": 52410387.7, "3523000000.0": 52410643.4, "3524000000.0": 52410898.9, "3525000000.0": 52411154.2, "3526000000.0": 52411409.5, "3527000000.0": 52411664.6, "3528000000.0": 52411919.5, "3529000000.0": 52412174.3, "3530000000.0": 52412429.0, "3531000000.0": 52412683.5, "3532000000.0": 52412937.9, "3533000000.0": 52413192.1, "3534000000.0": 52413446.2, "3535000000.0": 52413700.2, "3536000000.0": 52413954.0, "3537000000.0": 52414207.7, "3538000000.0": 52414461.2, "3539000000.0": 52414714.6, "3540000000.0": 52414967.8, "3541000000.0": 52415220.9, "3542000000.0": 52415473.9, "3543000000.0": 52415726.7, "3544000000.0": 52415979.4, "3545000000.0": 52416232.0, "3546000000.0": 52416484.4, "3547000000.0": 52416736.7, "3548000000.0": 52416988.8, "3549000000.0": 52417240.8, "3550000000.0": 52417492.6, "3551000000.0": 52417744.3, "3552000000.0": 52417995.9, "3553000000.0": 52418247.3, "3554000000.0": 52418498.6, "3555000000.0": 52418749.8, "3556000000.0": 52419000.8, "3557000000.0": 52419251.7, "3558000000.0": 52419502.4, "3559000000.0": 52419753.0, "3560000000.0": 52420003.5, "3561000000.0": 52420253.8, "3562000000.0": 52420504.0, "3563000000.0": 52420754.0, "3564000000.0": 52421004.0, "3565000000.0": 52421253.7, "3566000000.0": 52421503.4, "3567000000.0": 52421752.9, "3568000000.0": 52422002.2, "3569000000.0": 52422251.4, "3570000000.0": 52422500.5, "3571000000.0": 52422749.5, "3572000000.0": 52422998.3, "3573000000.0": 52423247.0, "3574000000.0": 52423495.5, "3575000000.0": 52423743.9, "3576000000.0": 52423992.2, "3577000000.0": 52424240.3, "3578000000.0": 52424488.3, "3579000000.0": 52424736.1, "3580000000.0": 52424983.9, "3581000000.0": 52425231.4, "3582000000.0": 52425478.9, "3583000000.0": 52425726.2, "3584000000.0": 52425973.4, "3585000000.0": 52426220.4, "3586000000.0": 52426467.3, "3587000000.0": 52426714.1, "3588000000.0": 52426960.7, "3589000000.0": 52427207.2, "3590000000.0": 52427453.6, "3591000000.0": 52427699.8, "3592000000.0": 52427945.9, "3593000000.0": 52428191.9, "3594000000.0": 52428437.7, "3595000000.0": 52428683.4, "3596000000.0": 52428929.0, "3597000000.0": 52429174.4, "3598000000.0": 52429419.7, "3599000000.0": 52429664.8, "3600000000.0": 52429909.8, "3601000000.0": 52430154.7, "3602000000.0": 52430399.5, "3603000000.0": 52430644.1, "3604000000.0": 52430888.6, "3605000000.0": 52431132.9, "3606000000.0": 52431377.2, "3607000000.0": 52431621.3, "3608000000.0": 52431865.2, "3609000000.0": 52432109.0, "3610000000.0": 52432352.7, "3611000000.0": 52432596.3, "3612000000.0": 52432839.7, "3613000000.0": 52433083.0, "3614000000.0": 52433326.1, "3615000000.0": 52433569.2, "3616000000.0": 52433812.1, "3617000000.0": 52434054.8, "3618000000.0": 52434297.5, "3619000000.0": 52434540.0, "3620000000.0": 52434782.3, "3621000000.0": 52435024.6, "3622000000.0": 52435266.7, "3623000000.0": 52435508.6, "3624000000.0": 52435750.5, "3625000000.0": 52435992.2, "3626000000.0": 52436233.8, "3627000000.0": 52436475.2, "3628000000.0": 52436716.5, "3629000000.0": 52436957.7, "3630000000.0": 52437198.8, "3631000000.0": 52437439.7, "3632000000.0": 52437680.5, "3633000000.0": 52437921.2, "3634000000.0": 52438161.7, "3635000000.0": 52438402.1, "3636000000.0": 52438642.4, "3637000000.0": 52438882.5, "3638000000.0": 52439122.5, "3639000000.0": 52439362.4, "3640000000.0": 52439602.2, "3641000000.0": 52439841.8, "3642000000.0": 52440081.3, "3643000000.0": 52440320.7, "3644000000.0": 52440559.9, "3645000000.0": 52440799.0, "3646000000.0": 52441038.0, "3647000000.0": 52441276.9, "3648000000.0": 52441515.6, "3649000000.0": 52441754.2, "3650000000.0": 52441992.6, "3651000000.0": 52442231.0, "3652000000.0": 52442469.2, "3653000000.0": 52442707.3, "3654000000.0": 52442945.2, "3655000000.0": 52443183.0, "3656000000.0": 52443420.7, "3657000000.0": 52443658.3, "3658000000.0": 52443895.8, "3659000000.0": 52444133.1, "3660000000.0": 52444370.3, "3661000000.0": 52444607.3, "3662000000.0": 52444844.2, "3663000000.0": 52445081.0, "3664000000.0": 52445317.7, "3665000000.0": 52445554.3, "3666000000.0": 52445790.7, "3667000000.0": 52446027.0, "3668000000.0": 52446263.2, "3669000000.0": 52446499.2, "3670000000.0": 52446735.1, "3671000000.0": 52446970.9, "3672000000.0": 52447206.6, "3673000000.0": 52447442.1, "3674000000.0": 52447677.5, "3675000000.0": 52447912.8, "3676000000.0": 52448148.0, "3677000000.0": 52448383.0, "3678000000.0": 52448617.9, "3679000000.0": 52448852.7, "3680000000.0": 52449087.4, "3681000000.0": 52449321.9, "3682000000.0": 52449556.3, "3683000000.0": 52449790.6, "3684000000.0": 52450024.8, "3685000000.0": 52450258.8, "3686000000.0": 52450492.7, "3687000000.0": 52450726.5, "3688000000.0": 52450960.1, "3689000000.0": 52451193.7, "3690000000.0": 52451427.1, "3691000000.0": 52451660.4, "3692000000.0": 52451893.5, "3693000000.0": 52452126.6, "3694000000.0": 52452359.5, "3695000000.0": 52452592.3, "3696000000.0": 52452824.9, "3697000000.0": 52453057.5, "3698000000.0": 52453289.9, "3699000000.0": 52453522.2, "3700000000.0": 52453754.4, "3701000000.0": 52453986.4, "3702000000.0": 52454218.3, "3703000000.0": 52454450.1, "3704000000.0": 52454681.8, "3705000000.0": 52454913.4, "3706000000.0": 52455144.8, "3707000000.0": 52455376.1, "3708000000.0": 52455607.3, "3709000000.0": 52455838.3, "3710000000.0": 52456069.3, "3711000000.0": 52456300.1, "3712000000.0": 52456530.8, "3713000000.0": 52456761.4, "3714000000.0": 52456991.8, "3715000000.0": 52457222.2, "3716000000.0": 52457452.4, "3717000000.0": 52457682.5, "3718000000.0": 52457912.4, "3719000000.0": 52458142.3, "3720000000.0": 52458372.0, "3721000000.0": 52458601.6, "3722000000.0": 52458831.1, "3723000000.0": 52459060.4, "3724000000.0": 52459289.7, "3725000000.0": 52459518.8, "3726000000.0": 52459747.8, "3727000000.0": 52459976.6, "3728000000.0": 52460205.4, "3729000000.0": 52460434.0, "3730000000.0": 52460662.5, "3731000000.0": 52460890.9, "3732000000.0": 52461119.2, "3733000000.0": 52461347.4, "3734000000.0": 52461575.4, "3735000000.0": 52461803.3, "3736000000.0": 52462031.1, "3737000000.0": 52462258.8, "3738000000.0": 52462486.3, "3739000000.0": 52462713.7, "3740000000.0": 52462941.0, "3741000000.0": 52463168.2, "3742000000.0": 52463395.3, "3743000000.0": 52463622.3, "3744000000.0": 52463849.1, "3745000000.0": 52464075.8, "3746000000.0": 52464302.4, "3747000000.0": 52464528.9, "3748000000.0": 52464755.2, "3749000000.0": 52464981.5, "3750000000.0": 52465207.6, "3751000000.0": 52465433.6, "3752000000.0": 52465659.5, "3753000000.0": 52465885.3, "3754000000.0": 52466110.9, "3755000000.0": 52466336.4, "3756000000.0": 52466561.8, "3757000000.0": 52466787.1, "3758000000.0": 52467012.3, "3759000000.0": 52467237.4, "3760000000.0": 52467462.3, "3761000000.0": 52467687.1, "3762000000.0": 52467911.8, "3763000000.0": 52468136.4, "3764000000.0": 52468360.9, "3765000000.0": 52468585.2, "3766000000.0": 52468809.5, "3767000000.0": 52469033.6, "3768000000.0": 52469257.6, "3769000000.0": 52469481.5, "3770000000.0": 52469705.2, "3771000000.0": 52469928.9, "3772000000.0": 52470152.4, "3773000000.0": 52470375.8, "3774000000.0": 52470599.2, "3775000000.0": 52470822.3, "3776000000.0": 52471045.4, "3777000000.0": 52471268.4, "3778000000.0": 52471491.2, "3779000000.0": 52471713.9, "3780000000.0": 52471936.5, "3781000000.0": 52472159.0, "3782000000.0": 52472381.4, "3783000000.0": 52472603.6, "3784000000.0": 52472825.8, "3785000000.0": 52473047.8, "3786000000.0": 52473269.7, "3787000000.0": 52473491.5, "3788000000.0": 52473713.2, "3789000000.0": 52473934.7, "3790000000.0": 52474156.2, "3791000000.0": 52474377.5, "3792000000.0": 52474598.8, "3793000000.0": 52474819.9, "3794000000.0": 52475040.8, "3795000000.0": 52475261.7, "3796000000.0": 52475482.5, "3797000000.0": 52475703.1, "3798000000.0": 52475923.7, "3799000000.0": 52476144.1, "3800000000.0": 52476364.4, "3801000000.0": 52476584.6, "3802000000.0": 52476804.7, "3803000000.0": 52477024.6, "3804000000.0": 52477244.5, "3805000000.0": 52477464.2, "3806000000.0": 52477683.8, "3807000000.0": 52477903.3, "3808000000.0": 52478122.7, "3809000000.0": 52478342.0, "3810000000.0": 52478561.2, "3811000000.0": 52478780.2, "3812000000.0": 52478999.2, "3813000000.0": 52479218.0, "3814000000.0": 52479436.7, "3815000000.0": 52479655.3, "3816000000.0": 52479873.8, "3817000000.0": 52480092.2, "3818000000.0": 52480310.5, "3819000000.0": 52480528.6, "3820000000.0": 52480746.7, "3821000000.0": 52480964.6, "3822000000.0": 52481182.4, "3823000000.0": 52481400.1, "3824000000.0": 52481617.7, "3825000000.0": 52481835.2, "3826000000.0": 52482052.5, "3827000000.0": 52482269.8, "3828000000.0": 52482486.9, "3829000000.0": 52482704.0, "3830000000.0": 52482920.9, "3831000000.0": 52483137.7, "3832000000.0": 52483354.4, "3833000000.0": 52483571.0, "3834000000.0": 52483787.5, "3835000000.0": 52484003.8, "3836000000.0": 52484220.1, "3837000000.0": 52484436.2, "3838000000.0": 52484652.3, "3839000000.0": 52484868.2, "3840000000.0": 52485084.0, "3841000000.0": 52485299.7, "3842000000.0": 52485515.3, "3843000000.0": 52485730.8, "3844000000.0": 52485946.2, "3845000000.0": 52486161.4, "3846000000.0": 52486376.6, "3847000000.0": 52486591.6, "3848000000.0": 52486806.5, "3849000000.0": 52487021.3, "3850000000.0": 52487236.1, "3851000000.0": 52487450.7, "3852000000.0": 52487665.1, "3853000000.0": 52487879.5, "3854000000.0": 52488093.8, "3855000000.0": 52488308.0, "3856000000.0": 52488522.0, "3857000000.0": 52488736.0, "3858000000.0": 52488949.8, "3859000000.0": 52489163.5, "3860000000.0": 52489377.1, "3861000000.0": 52489590.6, "3862000000.0": 52489804.0, "3863000000.0": 52490017.3, "3864000000.0": 52490230.5, "3865000000.0": 52490443.6, "3866000000.0": 52490656.6, "3867000000.0": 52490869.4, "3868000000.0": 52491082.2, "3869000000.0": 52491294.8, "3870000000.0": 52491507.3, "3871000000.0": 52491719.8, "3872000000.0": 52491932.1, "3873000000.0": 52492144.3, "3874000000.0": 52492356.4, "3875000000.0": 52492568.4, "3876000000.0": 52492780.3, "3877000000.0": 52492992.0, "3878000000.0": 52493203.7, "3879000000.0": 52493415.3, "3880000000.0": 52493626.7, "3881000000.0": 52493838.1, "3882000000.0": 52494049.3, "3883000000.0": 52494260.4, "3884000000.0": 52494471.5, "3885000000.0": 52494682.4, "3886000000.0": 52494893.2, "3887000000.0": 52495103.9, "3888000000.0": 52495314.5, "3889000000.0": 52495525.0, "3890000000.0": 52495735.4, "3891000000.0": 52495945.7, "3892000000.0": 52496155.8, "3893000000.0": 52496365.9, "3894000000.0": 52496575.9, "3895000000.0": 52496785.7, "3896000000.0": 52496995.5, "3897000000.0": 52497205.1, "3898000000.0": 52497414.6, "3899000000.0": 52497624.1, "3900000000.0": 52497833.4, "3901000000.0": 52498042.6, "3902000000.0": 52498251.7, "3903000000.0": 52498460.8, "3904000000.0": 52498669.7, "3905000000.0": 52498878.5, "3906000000.0": 52499087.1, "3907000000.0": 52499295.7, "3908000000.0": 52499504.2, "3909000000.0": 52499712.6, "3910000000.0": 52499920.9, "3911000000.0": 52500129.0, "3912000000.0": 52500337.1, "3913000000.0": 52500545.1, "3914000000.0": 52500752.9, "3915000000.0": 52500960.7, "3916000000.0": 52501168.3, "3917000000.0": 52501375.9, "3918000000.0": 52501583.3, "3919000000.0": 52501790.6, "3920000000.0": 52501997.9, "3921000000.0": 52502205.0, "3922000000.0": 52502412.0, "3923000000.0": 52502618.9, "3924000000.0": 52502825.7, "3925000000.0": 52503032.4, "3926000000.0": 52503239.0, "3927000000.0": 52503445.5, "3928000000.0": 52503651.9, "3929000000.0": 52503858.2, "3930000000.0": 52504064.4, "3931000000.0": 52504270.5, "3932000000.0": 52504476.5, "3933000000.0": 52504682.4, "3934000000.0": 52504888.2, "3935000000.0": 52505093.8, "3936000000.0": 52505299.4, "3937000000.0": 52505504.9, "3938000000.0": 52505710.3, "3939000000.0": 52505915.5, "3940000000.0": 52506120.7, "3941000000.0": 52506325.7, "3942000000.0": 52506530.7, "3943000000.0": 52506735.6, "3944000000.0": 52506940.3, "3945000000.0": 52507145.0, "3946000000.0": 52507349.5, "3947000000.0": 52507554.0, "3948000000.0": 52507758.3, "3949000000.0": 52507962.5, "3950000000.0": 52508166.7, "3951000000.0": 52508370.7, "3952000000.0": 52508574.7, "3953000000.0": 52508778.5, "3954000000.0": 52508982.2, "3955000000.0": 52509185.9, "3956000000.0": 52509389.4, "3957000000.0": 52509592.8, "3958000000.0": 52509796.2, "3959000000.0": 52509999.4, "3960000000.0": 52510202.5, "3961000000.0": 52510405.5, "3962000000.0": 52510608.5, "3963000000.0": 52510811.3, "3964000000.0": 52511014.0, "3965000000.0": 52511216.6, "3966000000.0": 52511419.2, "3967000000.0": 52511621.6, "3968000000.0": 52511823.9, "3969000000.0": 52512026.1, "3970000000.0": 52512228.3, "3971000000.0": 52512430.3, "3972000000.0": 52512632.2, "3973000000.0": 52512834.0, "3974000000.0": 52513035.7, "3975000000.0": 52513237.4, "3976000000.0": 52513438.9, "3977000000.0": 52513640.3, "3978000000.0": 52513841.6, "3979000000.0": 52514042.9, "3980000000.0": 52514244.0, "3981000000.0": 52514445.0, "3982000000.0": 52514645.9, "3983000000.0": 52514846.8, "3984000000.0": 52515047.5, "3985000000.0": 52515248.1, "3986000000.0": 52515448.6, "3987000000.0": 52515649.1, "3988000000.0": 52515849.4, "3989000000.0": 52516049.6, "3990000000.0": 52516249.8, "3991000000.0": 52516449.8, "3992000000.0": 52516649.7, "3993000000.0": 52516849.6, "3994000000.0": 52517049.3, "3995000000.0": 52517248.9, "3996000000.0": 52517448.5, "3997000000.0": 52517647.9, "3998000000.0": 52517847.3, "3999000000.0": 52518046.5, "4000000000.0": 52518245.6, "4001000000.0": 52518444.7, "4002000000.0": 52518643.6, "4003000000.0": 52518842.5, "4004000000.0": 52519041.3, "4005000000.0": 52519239.9, "4006000000.0": 52519438.5, "4007000000.0": 52519636.9, "4008000000.0": 52519835.3, "4009000000.0": 52520033.6, "4010000000.0": 52520231.7, "4011000000.0": 52520429.8, "4012000000.0": 52520627.8, "4013000000.0": 52520825.7, "4014000000.0": 52521023.5, "4015000000.0": 52521221.1, "4016000000.0": 52521418.7, "4017000000.0": 52521616.2, "4018000000.0": 52521813.6, "4019000000.0": 52522010.9, "4020000000.0": 52522208.1, "4021000000.0": 52522405.2, "4022000000.0": 52522602.2, "4023000000.0": 52522799.1, "4024000000.0": 52522996.0, "4025000000.0": 52523192.7, "4026000000.0": 52523389.3, "4027000000.0": 52523585.8, "4028000000.0": 52523782.3, "4029000000.0": 52523978.6, "4030000000.0": 52524174.8, "4031000000.0": 52524371.0, "4032000000.0": 52524567.0, "4033000000.0": 52524763.0, "4034000000.0": 52524958.8, "4035000000.0": 52525154.6, "4036000000.0": 52525350.3, "4037000000.0": 52525545.8, "4038000000.0": 52525741.3, "4039000000.0": 52525936.7, "4040000000.0": 52526132.0, "4041000000.0": 52526327.1, "4042000000.0": 52526522.2, "4043000000.0": 52526717.2, "4044000000.0": 52526912.1, "4045000000.0": 52527106.9, "4046000000.0": 52527301.7, "4047000000.0": 52527496.3, "4048000000.0": 52527690.8, "4049000000.0": 52527885.2, "4050000000.0": 52528079.6, "4051000000.0": 52528273.8, "4052000000.0": 52528468.0, "4053000000.0": 52528662.0, "4054000000.0": 52528856.0, "4055000000.0": 52529049.8, "4056000000.0": 52529243.6, "4057000000.0": 52529437.3, "4058000000.0": 52529630.8, "4059000000.0": 52529824.3, "4060000000.0": 52530017.7, "4061000000.0": 52530211.0, "4062000000.0": 52530404.2, "4063000000.0": 52530597.3, "4064000000.0": 52530790.4, "4065000000.0": 52530983.3, "4066000000.0": 52531176.1, "4067000000.0": 52531368.9, "4068000000.0": 52531561.5, "4069000000.0": 52531754.1, "4070000000.0": 52531946.5, "4071000000.0": 52532138.9, "4072000000.0": 52532331.1, "4073000000.0": 52532523.3, "4074000000.0": 52532715.4, "4075000000.0": 52532907.4, "4076000000.0": 52533099.3, "4077000000.0": 52533291.1, "4078000000.0": 52533482.8, "4079000000.0": 52533674.5, "4080000000.0": 52533866.0, "4081000000.0": 52534057.4, "4082000000.0": 52534248.8, "4083000000.0": 52534440.0, "4084000000.0": 52534631.2, "4085000000.0": 52534822.3, "4086000000.0": 52535013.2, "4087000000.0": 52535204.1, "4088000000.0": 52535394.9, "4089000000.0": 52535585.6, "4090000000.0": 52535776.2, "4091000000.0": 52535966.7, "4092000000.0": 52536157.2, "4093000000.0": 52536347.5, "4094000000.0": 52536537.7, "4095000000.0": 52536727.9, "4096000000.0": 52536917.9, "4097000000.0": 52537107.9, "4098000000.0": 52537297.8, "4099000000.0": 52537487.6, "4100000000.0": 52537677.3, "4101000000.0": 52537866.9, "4102000000.0": 52538056.4, "4103000000.0": 52538245.8, "4104000000.0": 52538435.1, "4105000000.0": 52538624.4, "4106000000.0": 52538813.5, "4107000000.0": 52539002.6, "4108000000.0": 52539191.5, "4109000000.0": 52539380.4, "4110000000.0": 52539569.2, "4111000000.0": 52539757.9, "4112000000.0": 52539946.5, "4113000000.0": 52540135.0, "4114000000.0": 52540323.5, "4115000000.0": 52540511.8, "4116000000.0": 52540700.0, "4117000000.0": 52540888.2, "4118000000.0": 52541076.2, "4119000000.0": 52541264.2, "4120000000.0": 52541452.1, "4121000000.0": 52541639.9, "4122000000.0": 52541827.6, "4123000000.0": 52542015.2, "4124000000.0": 52542202.7, "4125000000.0": 52542390.2, "4126000000.0": 52542577.5, "4127000000.0": 52542764.8, "4128000000.0": 52542952.0, "4129000000.0": 52543139.0, "4130000000.0": 52543326.0, "4131000000.0": 52543512.9, "4132000000.0": 52543699.7, "4133000000.0": 52543886.5, "4134000000.0": 52544073.1, "4135000000.0": 52544259.6, "4136000000.0": 52544446.1, "4137000000.0": 52544632.5, "4138000000.0": 52544818.7, "4139000000.0": 52545004.9, "4140000000.0": 52545191.0, "4141000000.0": 52545377.0, "4142000000.0": 52545563.0, "4143000000.0": 52545748.8, "4144000000.0": 52545934.5, "4145000000.0": 52546120.2, "4146000000.0": 52546305.8, "4147000000.0": 52546491.2, "4148000000.0": 52546676.6, "4149000000.0": 52546861.9, "4150000000.0": 52547047.2, "4151000000.0": 52547232.3, "4152000000.0": 52547417.3, "4153000000.0": 52547602.3, "4154000000.0": 52547787.2, "4155000000.0": 52547971.9, "4156000000.0": 52548156.6, "4157000000.0": 52548341.2, "4158000000.0": 52548525.7, "4159000000.0": 52548710.2, "4160000000.0": 52548894.5, "4161000000.0": 52549078.8, "4162000000.0": 52549262.9, "4163000000.0": 52549447.0, "4164000000.0": 52549631.0, "4165000000.0": 52549814.9, "4166000000.0": 52549998.7, "4167000000.0": 52550182.5, "4168000000.0": 52550366.1, "4169000000.0": 52550549.7, "4170000000.0": 52550733.1, "4171000000.0": 52550916.5, "4172000000.0": 52551099.8, "4173000000.0": 52551283.0, "4174000000.0": 52551466.2, "4175000000.0": 52551649.2, "4176000000.0": 52551832.2, "4177000000.0": 52552015.0, "4178000000.0": 52552197.8, "4179000000.0": 52552380.5, "4180000000.0": 52552563.1, "4181000000.0": 52552745.6, "4182000000.0": 52552928.1, "4183000000.0": 52553110.4, "4184000000.0": 52553292.7, "4185000000.0": 52553474.9, "4186000000.0": 52553656.9, "4187000000.0": 52553839.0, "4188000000.0": 52554020.9, "4189000000.0": 52554202.7, "4190000000.0": 52554384.5, "4191000000.0": 52554566.1, "4192000000.0": 52554747.7, "4193000000.0": 52554929.2, "4194000000.0": 52555110.6, "4195000000.0": 52555291.9, "4196000000.0": 52555473.2, "4197000000.0": 52555654.3, "4198000000.0": 52555835.4, "4199000000.0": 52556016.4, "4200000000.0": 52556197.3, "4201000000.0": 52556378.1, "4202000000.0": 52556558.8, "4203000000.0": 52556739.5, "4204000000.0": 52556920.0, "4205000000.0": 52557100.5, "4206000000.0": 52557280.9, "4207000000.0": 52557461.2, "4208000000.0": 52557641.4, "4209000000.0": 52557821.5, "4210000000.0": 52558001.6, "4211000000.0": 52558181.6, "4212000000.0": 52558361.5, "4213000000.0": 52558541.3, "4214000000.0": 52558721.0, "4215000000.0": 52558900.6, "4216000000.0": 52559080.1, "4217000000.0": 52559259.6, "4218000000.0": 52559439.0, "4219000000.0": 52559618.3, "4220000000.0": 52559797.5, "4221000000.0": 52559976.6, "4222000000.0": 52560155.7, "4223000000.0": 52560334.6, "4224000000.0": 52560513.5, "4225000000.0": 52560692.3, "4226000000.0": 52560871.0, "4227000000.0": 52561049.6, "4228000000.0": 52561228.2, "4229000000.0": 52561406.7, "4230000000.0": 52561585.0, "4231000000.0": 52561763.3, "4232000000.0": 52561941.5, "4233000000.0": 52562119.7, "4234000000.0": 52562297.7, "4235000000.0": 52562475.7, "4236000000.0": 52562653.6, "4237000000.0": 52562831.4, "4238000000.0": 52563009.1, "4239000000.0": 52563186.7, "4240000000.0": 52563364.3, "4241000000.0": 52563541.7, "4242000000.0": 52563719.1, "4243000000.0": 52563896.4, "4244000000.0": 52564073.6, "4245000000.0": 52564250.8, "4246000000.0": 52564427.8, "4247000000.0": 52564604.8, "4248000000.0": 52564781.7, "4249000000.0": 52564958.5, "4250000000.0": 52565135.2, "4251000000.0": 52565311.9, "4252000000.0": 52565488.4, "4253000000.0": 52565664.9, "4254000000.0": 52565841.3, "4255000000.0": 52566017.6, "4256000000.0": 52566193.9, "4257000000.0": 52566370.0, "4258000000.0": 52566546.1, "4259000000.0": 52566722.1, "4260000000.0": 52566898.0, "4261000000.0": 52567073.8, "4262000000.0": 52567249.6, "4263000000.0": 52567425.3, "4264000000.0": 52567600.8, "4265000000.0": 52567776.4, "4266000000.0": 52567951.8, "4267000000.0": 52568127.1, "4268000000.0": 52568302.4, "4269000000.0": 52568477.6, "4270000000.0": 52568652.7, "4271000000.0": 52568827.7, "4272000000.0": 52569002.6, "4273000000.0": 52569177.5, "4274000000.0": 52569352.3, "4275000000.0": 52569527.0, "4276000000.0": 52569701.6, "4277000000.0": 52569876.1, "4278000000.0": 52570050.6, "4279000000.0": 52570224.9, "4280000000.0": 52570399.2, "4281000000.0": 52570573.4, "4282000000.0": 52570747.6, "4283000000.0": 52570921.6, "4284000000.0": 52571095.6, "4285000000.0": 52571269.5, "4286000000.0": 52571443.3, "4287000000.0": 52571617.0, "4288000000.0": 52571790.7, "4289000000.0": 52571964.3, "4290000000.0": 52572137.8, "4291000000.0": 52572311.2, "4292000000.0": 52572484.5, "4293000000.0": 52572657.8, "4294000000.0": 52572831.0, "4295000000.0": 52573004.1, "4296000000.0": 52573177.1, "4297000000.0": 52573350.0, "4298000000.0": 52573522.9, "4299000000.0": 52573695.6, "4300000000.0": 52573868.3, "4301000000.0": 52574041.0, "4302000000.0": 52574213.5, "4303000000.0": 52574386.0, "4304000000.0": 52574558.4, "4305000000.0": 52574730.7, "4306000000.0": 52574902.9, "4307000000.0": 52575075.0, "4308000000.0": 52575247.1, "4309000000.0": 52575419.1, "4310000000.0": 52575591.0, "4311000000.0": 52575762.8, "4312000000.0": 52575934.6, "4313000000.0": 52576106.3, "4314000000.0": 52576277.9, "4315000000.0": 52576449.4, "4316000000.0": 52576620.8, "4317000000.0": 52576792.2, "4318000000.0": 52576963.5, "4319000000.0": 52577134.7, "4320000000.0": 52577305.8, "4321000000.0": 52577476.8, "4322000000.0": 52577647.8, "4323000000.0": 52577818.7, "4324000000.0": 52577989.5, "4325000000.0": 52578160.3, "4326000000.0": 52578330.9, "4327000000.0": 52578501.5, "4328000000.0": 52578672.0, "4329000000.0": 52578842.4, "4330000000.0": 52579012.8, "4331000000.0": 52579183.1, "4332000000.0": 52579353.3, "4333000000.0": 52579523.4, "4334000000.0": 52579693.4, "4335000000.0": 52579863.4, "4336000000.0": 52580033.3, "4337000000.0": 52580203.1, "4338000000.0": 52580372.8, "4339000000.0": 52580542.5, "4340000000.0": 52580712.0, "4341000000.0": 52580881.5, "4342000000.0": 52581050.9, "4343000000.0": 52581220.3, "4344000000.0": 52581389.6, "4345000000.0": 52581558.8, "4346000000.0": 52581727.9, "4347000000.0": 52581896.9, "4348000000.0": 52582065.9, "4349000000.0": 52582234.8, "4350000000.0": 52582403.6, "4351000000.0": 52582572.3, "4352000000.0": 52582741.0, "4353000000.0": 52582909.5, "4354000000.0": 52583078.0, "4355000000.0": 52583246.5, "4356000000.0": 52583414.8, "4357000000.0": 52583583.1, "4358000000.0": 52583751.3, "4359000000.0": 52583919.4, "4360000000.0": 52584087.5, "4361000000.0": 52584255.4, "4362000000.0": 52584423.3, "4363000000.0": 52584591.1, "4364000000.0": 52584758.9, "4365000000.0": 52584926.5, "4366000000.0": 52585094.1, "4367000000.0": 52585261.6, "4368000000.0": 52585429.1, "4369000000.0": 52585596.5, "4370000000.0": 52585763.7, "4371000000.0": 52585931.0, "4372000000.0": 52586098.1, "4373000000.0": 52586265.2, "4374000000.0": 52586432.1, "4375000000.0": 52586599.1, "4376000000.0": 52586765.9, "4377000000.0": 52586932.7, "4378000000.0": 52587099.3, "4379000000.0": 52587266.0, "4380000000.0": 52587432.5, "4381000000.0": 52587598.9, "4382000000.0": 52587765.3, "4383000000.0": 52587931.6, "4384000000.0": 52588097.9, "4385000000.0": 52588264.0, "4386000000.0": 52588430.1, "4387000000.0": 52588596.1, "4388000000.0": 52588762.1, "4389000000.0": 52588927.9, "4390000000.0": 52589093.7, "4391000000.0": 52589259.5, "4392000000.0": 52589425.1, "4393000000.0": 52589590.7, "4394000000.0": 52589756.2, "4395000000.0": 52589921.6, "4396000000.0": 52590086.9, "4397000000.0": 52590252.2, "4398000000.0": 52590417.4, "4399000000.0": 52590582.5, "4400000000.0": 52590747.5, "4401000000.0": 52590912.5, "4402000000.0": 52591077.4, "4403000000.0": 52591242.2, "4404000000.0": 52591407.0, "4405000000.0": 52591571.7, "4406000000.0": 52591736.3, "4407000000.0": 52591900.8, "4408000000.0": 52592065.3, "4409000000.0": 52592229.6, "4410000000.0": 52592394.0, "4411000000.0": 52592558.2, "4412000000.0": 52592722.4, "4413000000.0": 52592886.4, "4414000000.0": 52593050.5, "4415000000.0": 52593214.4, "4416000000.0": 52593378.3, "4417000000.0": 52593542.1, "4418000000.0": 52593705.8, "4419000000.0": 52593869.4, "4420000000.0": 52594033.0, "4421000000.0": 52594196.5, "4422000000.0": 52594360.0, "4423000000.0": 52594523.3, "4424000000.0": 52594686.6, "4425000000.0": 52594849.8, "4426000000.0": 52595013.0, "4427000000.0": 52595176.0, "4428000000.0": 52595339.0, "4429000000.0": 52595501.9, "4430000000.0": 52595664.8, "4431000000.0": 52595827.6, "4432000000.0": 52595990.3, "4433000000.0": 52596152.9, "4434000000.0": 52596315.5, "4435000000.0": 52596478.0, "4436000000.0": 52596640.4, "4437000000.0": 52596802.7, "4438000000.0": 52596965.0, "4439000000.0": 52597127.2, "4440000000.0": 52597289.3, "4441000000.0": 52597451.4, "4442000000.0": 52597613.4, "4443000000.0": 52597775.3, "4444000000.0": 52597937.1, "4445000000.0": 52598098.9, "4446000000.0": 52598260.6, "4447000000.0": 52598422.2, "4448000000.0": 52598583.8, "4449000000.0": 52598745.2, "4450000000.0": 52598906.6, "4451000000.0": 52599068.0, "4452000000.0": 52599229.2, "4453000000.0": 52599390.4, "4454000000.0": 52599551.6, "4455000000.0": 52599712.6, "4456000000.0": 52599873.6, "4457000000.0": 52600034.5, "4458000000.0": 52600195.4, "4459000000.0": 52600356.1, "4460000000.0": 52600516.8, "4461000000.0": 52600677.4, "4462000000.0": 52600838.0, "4463000000.0": 52600998.5, "4464000000.0": 52601158.9, "4465000000.0": 52601319.2, "4466000000.0": 52601479.5, "4467000000.0": 52601639.7, "4468000000.0": 52601799.8, "4469000000.0": 52601959.9, "4470000000.0": 52602119.9, "4471000000.0": 52602279.8, "4472000000.0": 52602439.6, "4473000000.0": 52602599.4, "4474000000.0": 52602759.1, "4475000000.0": 52602918.8, "4476000000.0": 52603078.3, "4477000000.0": 52603237.8, "4478000000.0": 52603397.3, "4479000000.0": 52603556.6, "4480000000.0": 52603715.9, "4481000000.0": 52603875.1, "4482000000.0": 52604034.3, "4483000000.0": 52604193.3, "4484000000.0": 52604352.3, "4485000000.0": 52604511.3, "4486000000.0": 52604670.1, "4487000000.0": 52604828.9, "4488000000.0": 52604987.7, "4489000000.0": 52605146.3, "4490000000.0": 52605304.9, "4491000000.0": 52605463.4, "4492000000.0": 52605621.9, "4493000000.0": 52605780.2, "4494000000.0": 52605938.5, "4495000000.0": 52606096.8, "4496000000.0": 52606255.0, "4497000000.0": 52606413.1, "4498000000.0": 52606571.1, "4499000000.0": 52606729.0, "4500000000.0": 52606886.9, "4501000000.0": 52607044.8, "4502000000.0": 52607202.5, "4503000000.0": 52607360.2, "4504000000.0": 52607517.8, "4505000000.0": 52607675.4, "4506000000.0": 52607832.8, "4507000000.0": 52607990.2, "4508000000.0": 52608147.6, "4509000000.0": 52608304.9, "4510000000.0": 52608462.1, "4511000000.0": 52608619.2, "4512000000.0": 52608776.2, "4513000000.0": 52608933.2, "4514000000.0": 52609090.2, "4515000000.0": 52609247.0, "4516000000.0": 52609403.8, "4517000000.0": 52609560.5, "4518000000.0": 52609717.2, "4519000000.0": 52609873.8, "4520000000.0": 52610030.3, "4521000000.0": 52610186.7, "4522000000.0": 52610343.1, "4523000000.0": 52610499.4, "4524000000.0": 52610655.7, "4525000000.0": 52610811.9, "4526000000.0": 52610968.0, "4527000000.0": 52611124.0, "4528000000.0": 52611280.0, "4529000000.0": 52611435.9, "4530000000.0": 52611591.7, "4531000000.0": 52611747.5, "4532000000.0": 52611903.2, "4533000000.0": 52612058.8, "4534000000.0": 52612214.4, "4535000000.0": 52612369.9, "4536000000.0": 52612525.3, "4537000000.0": 52612680.7, "4538000000.0": 52612836.0, "4539000000.0": 52612991.2, "4540000000.0": 52613146.3, "4541000000.0": 52613301.4, "4542000000.0": 52613456.5, "4543000000.0": 52613611.4, "4544000000.0": 52613766.3, "4545000000.0": 52613921.1, "4546000000.0": 52614075.9, "4547000000.0": 52614230.6, "4548000000.0": 52614385.2, "4549000000.0": 52614539.7, "4550000000.0": 52614694.2, "4551000000.0": 52614848.7, "4552000000.0": 52615003.0, "4553000000.0": 52615157.3, "4554000000.0": 52615311.5, "4555000000.0": 52615465.7, "4556000000.0": 52615619.8, "4557000000.0": 52615773.8, "4558000000.0": 52615927.7, "4559000000.0": 52616081.6, "4560000000.0": 52616235.4, "4561000000.0": 52616389.2, "4562000000.0": 52616542.9, "4563000000.0": 52616696.5, "4564000000.0": 52616850.0, "4565000000.0": 52617003.5, "4566000000.0": 52617157.0, "4567000000.0": 52617310.3, "4568000000.0": 52617463.6, "4569000000.0": 52617616.8, "4570000000.0": 52617770.0, "4571000000.0": 52617923.1, "4572000000.0": 52618076.1, "4573000000.0": 52618229.0, "4574000000.0": 52618381.9, "4575000000.0": 52618534.8, "4576000000.0": 52618687.5, "4577000000.0": 52618840.2, "4578000000.0": 52618992.8, "4579000000.0": 52619145.4, "4580000000.0": 52619297.9, "4581000000.0": 52619450.3, "4582000000.0": 52619602.7, "4583000000.0": 52619755.0, "4584000000.0": 52619907.2, "4585000000.0": 52620059.4, "4586000000.0": 52620211.5, "4587000000.0": 52620363.5, "4588000000.0": 52620515.5, "4589000000.0": 52620667.4, "4590000000.0": 52620819.3, "4591000000.0": 52620971.0, "4592000000.0": 52621122.8, "4593000000.0": 52621274.4, "4594000000.0": 52621426.0, "4595000000.0": 52621577.5, "4596000000.0": 52621729.0, "4597000000.0": 52621880.3, "4598000000.0": 52622031.7, "4599000000.0": 52622182.9, "4600000000.0": 52622334.1, "4601000000.0": 52622485.2, "4602000000.0": 52622636.3, "4603000000.0": 52622787.3, "4604000000.0": 52622938.2, "4605000000.0": 52623089.1, "4606000000.0": 52623239.9, "4607000000.0": 52623390.6, "4608000000.0": 52623541.3, "4609000000.0": 52623691.9, "4610000000.0": 52623842.5, "4611000000.0": 52623992.9, "4612000000.0": 52624143.4, "4613000000.0": 52624293.7, "4614000000.0": 52624444.0, "4615000000.0": 52624594.2, "4616000000.0": 52624744.4, "4617000000.0": 52624894.5, "4618000000.0": 52625044.5, "4619000000.0": 52625194.5, "4620000000.0": 52625344.4, "4621000000.0": 52625494.2, "4622000000.0": 52625644.0, "4623000000.0": 52625793.7, "4624000000.0": 52625943.4, "4625000000.0": 52626092.9, "4626000000.0": 52626242.5, "4627000000.0": 52626391.9, "4628000000.0": 52626541.3, "4629000000.0": 52626690.6, "4630000000.0": 52626839.9, "4631000000.0": 52626989.1, "4632000000.0": 52627138.2, "4633000000.0": 52627287.3, "4634000000.0": 52627436.3, "4635000000.0": 52627585.3, "4636000000.0": 52627734.2, "4637000000.0": 52627883.0, "4638000000.0": 52628031.7, "4639000000.0": 52628180.4, "4640000000.0": 52628329.1, "4641000000.0": 52628477.6, "4642000000.0": 52628626.1, "4643000000.0": 52628774.6, "4644000000.0": 52628922.9, "4645000000.0": 52629071.3, "4646000000.0": 52629219.5, "4647000000.0": 52629367.7, "4648000000.0": 52629515.8, "4649000000.0": 52629663.9, "4650000000.0": 52629811.9, "4651000000.0": 52629959.8, "4652000000.0": 52630107.7, "4653000000.0": 52630255.5, "4654000000.0": 52630403.3, "4655000000.0": 52630550.9, "4656000000.0": 52630698.6, "4657000000.0": 52630846.1, "4658000000.0": 52630993.6, "4659000000.0": 52631141.1, "4660000000.0": 52631288.4, "4661000000.0": 52631435.8, "4662000000.0": 52631583.0, "4663000000.0": 52631730.2, "4664000000.0": 52631877.3, "4665000000.0": 52632024.4, "4666000000.0": 52632171.4, "4667000000.0": 52632318.3, "4668000000.0": 52632465.2, "4669000000.0": 52632612.0, "4670000000.0": 52632758.8, "4671000000.0": 52632905.5, "4672000000.0": 52633052.1, "4673000000.0": 52633198.6, "4674000000.0": 52633345.2, "4675000000.0": 52633491.6, "4676000000.0": 52633638.0, "4677000000.0": 52633784.3, "4678000000.0": 52633930.6, "4679000000.0": 52634076.7, "4680000000.0": 52634222.9, "4681000000.0": 52634369.0, "4682000000.0": 52634515.0, "4683000000.0": 52634660.9, "4684000000.0": 52634806.8, "4685000000.0": 52634952.6, "4686000000.0": 52635098.4, "4687000000.0": 52635244.1, "4688000000.0": 52635389.7, "4689000000.0": 52635535.3, "4690000000.0": 52635680.8, "4691000000.0": 52635826.3, "4692000000.0": 52635971.7, "4693000000.0": 52636117.0, "4694000000.0": 52636262.3, "4695000000.0": 52636407.5, "4696000000.0": 52636552.7, "4697000000.0": 52636697.8, "4698000000.0": 52636842.8, "4699000000.0": 52636987.8, "4700000000.0": 52637132.7, "4701000000.0": 52637277.5, "4702000000.0": 52637422.3, "4703000000.0": 52637567.0, "4704000000.0": 52637711.7, "4705000000.0": 52637856.3, "4706000000.0": 52638000.9, "4707000000.0": 52638145.3, "4708000000.0": 52638289.8, "4709000000.0": 52638434.1, "4710000000.0": 52638578.4, "4711000000.0": 52638722.7, "4712000000.0": 52638866.8, "4713000000.0": 52639011.0, "4714000000.0": 52639155.0, "4715000000.0": 52639299.0, "4716000000.0": 52639443.0, "4717000000.0": 52639586.9, "4718000000.0": 52639730.7, "4719000000.0": 52639874.4, "4720000000.0": 52640018.1, "4721000000.0": 52640161.8, "4722000000.0": 52640305.3, "4723000000.0": 52640448.9, "4724000000.0": 52640592.3, "4725000000.0": 52640735.7, "4726000000.0": 52640879.1, "4727000000.0": 52641022.3, "4728000000.0": 52641165.6, "4729000000.0": 52641308.7, "4730000000.0": 52641451.8, "4731000000.0": 52641594.9, "4732000000.0": 52641737.9, "4733000000.0": 52641880.8, "4734000000.0": 52642023.6, "4735000000.0": 52642166.4, "4736000000.0": 52642309.2, "4737000000.0": 52642451.9, "4738000000.0": 52642594.5, "4739000000.0": 52642737.1, "4740000000.0": 52642879.6, "4741000000.0": 52643022.0, "4742000000.0": 52643164.4, "4743000000.0": 52643306.7, "4744000000.0": 52643449.0, "4745000000.0": 52643591.2, "4746000000.0": 52643733.3, "4747000000.0": 52643875.4, "4748000000.0": 52644017.5, "4749000000.0": 52644159.4, "4750000000.0": 52644301.4, "4751000000.0": 52644443.2, "4752000000.0": 52644585.0, "4753000000.0": 52644726.7, "4754000000.0": 52644868.4, "4755000000.0": 52645010.0, "4756000000.0": 52645151.6, "4757000000.0": 52645293.1, "4758000000.0": 52645434.5, "4759000000.0": 52645575.9, "4760000000.0": 52645717.3, "4761000000.0": 52645858.5, "4762000000.0": 52645999.7, "4763000000.0": 52646140.9, "4764000000.0": 52646282.0, "4765000000.0": 52646423.0, "4766000000.0": 52646564.0, "4767000000.0": 52646704.9, "4768000000.0": 52646845.8, "4769000000.0": 52646986.6, "4770000000.0": 52647127.3, "4771000000.0": 52647268.0, "4772000000.0": 52647408.6, "4773000000.0": 52647549.2, "4774000000.0": 52647689.7, "4775000000.0": 52647830.1, "4776000000.0": 52647970.5, "4777000000.0": 52648110.9, "4778000000.0": 52648251.1, "4779000000.0": 52648391.4, "4780000000.0": 52648531.5, "4781000000.0": 52648671.6, "4782000000.0": 52648811.7, "4783000000.0": 52648951.7, "4784000000.0": 52649091.6, "4785000000.0": 52649231.5, "4786000000.0": 52649371.3, "4787000000.0": 52649511.0, "4788000000.0": 52649650.7, "4789000000.0": 52649790.4, "4790000000.0": 52649929.9, "4791000000.0": 52650069.5, "4792000000.0": 52650208.9, "4793000000.0": 52650348.4, "4794000000.0": 52650487.7, "4795000000.0": 52650627.0, "4796000000.0": 52650766.2, "4797000000.0": 52650905.4, "4798000000.0": 52651044.6, "4799000000.0": 52651183.6, "4800000000.0": 52651322.6, "4801000000.0": 52651461.6, "4802000000.0": 52651600.5, "4803000000.0": 52651739.3, "4804000000.0": 52651878.1, "4805000000.0": 52652016.8, "4806000000.0": 52652155.5, "4807000000.0": 52652294.1, "4808000000.0": 52652432.7, "4809000000.0": 52652571.2, "4810000000.0": 52652709.6, "4811000000.0": 52652848.0, "4812000000.0": 52652986.3, "4813000000.0": 52653124.6, "4814000000.0": 52653262.8, "4815000000.0": 52653400.9, "4816000000.0": 52653539.0, "4817000000.0": 52653677.1, "4818000000.0": 52653815.1, "4819000000.0": 52653953.0, "4820000000.0": 52654090.9, "4821000000.0": 52654228.7, "4822000000.0": 52654366.5, "4823000000.0": 52654504.2, "4824000000.0": 52654641.8, "4825000000.0": 52654779.4, "4826000000.0": 52654916.9, "4827000000.0": 52655054.4, "4828000000.0": 52655191.8, "4829000000.0": 52655329.2, "4830000000.0": 52655466.5, "4831000000.0": 52655603.8, "4832000000.0": 52655741.0, "4833000000.0": 52655878.1, "4834000000.0": 52656015.2, "4835000000.0": 52656152.2, "4836000000.0": 52656289.2, "4837000000.0": 52656426.1, "4838000000.0": 52656563.0, "4839000000.0": 52656699.8, "4840000000.0": 52656836.5, "4841000000.0": 52656973.2, "4842000000.0": 52657109.9, "4843000000.0": 52657246.5, "4844000000.0": 52657383.0, "4845000000.0": 52657519.5, "4846000000.0": 52657655.9, "4847000000.0": 52657792.2, "4848000000.0": 52657928.6, "4849000000.0": 52658064.8, "4850000000.0": 52658201.0, "4851000000.0": 52658337.1, "4852000000.0": 52658473.2, "4853000000.0": 52658609.2, "4854000000.0": 52658745.2, "4855000000.0": 52658881.1, "4856000000.0": 52659017.0, "4857000000.0": 52659152.8, "4858000000.0": 52659288.6, "4859000000.0": 52659424.3, "4860000000.0": 52659559.9, "4861000000.0": 52659695.5, "4862000000.0": 52659831.0, "4863000000.0": 52659966.5, "4864000000.0": 52660101.9, "4865000000.0": 52660237.3, "4866000000.0": 52660372.6, "4867000000.0": 52660507.9, "4868000000.0": 52660643.1, "4869000000.0": 52660778.2, "4870000000.0": 52660913.3, "4871000000.0": 52661048.3, "4872000000.0": 52661183.3, "4873000000.0": 52661318.3, "4874000000.0": 52661453.1, "4875000000.0": 52661587.9, "4876000000.0": 52661722.7, "4877000000.0": 52661857.4, "4878000000.0": 52661992.1, "4879000000.0": 52662126.7, "4880000000.0": 52662261.2, "4881000000.0": 52662395.7, "4882000000.0": 52662530.2, "4883000000.0": 52662664.5, "4884000000.0": 52662798.9, "4885000000.0": 52662933.1, "4886000000.0": 52663067.4, "4887000000.0": 52663201.5, "4888000000.0": 52663335.6, "4889000000.0": 52663469.7, "4890000000.0": 52663603.7, "4891000000.0": 52663737.7, "4892000000.0": 52663871.5, "4893000000.0": 52664005.4, "4894000000.0": 52664139.2, "4895000000.0": 52664272.9, "4896000000.0": 52664406.6, "4897000000.0": 52664540.2, "4898000000.0": 52664673.8, "4899000000.0": 52664807.3, "4900000000.0": 52664940.8, "4901000000.0": 52665074.2, "4902000000.0": 52665207.5, "4903000000.0": 52665340.8, "4904000000.0": 52665474.1, "4905000000.0": 52665607.3, "4906000000.0": 52665740.4, "4907000000.0": 52665873.5, "4908000000.0": 52666006.6, "4909000000.0": 52666139.5, "4910000000.0": 52666272.5, "4911000000.0": 52666405.3, "4912000000.0": 52666538.2, "4913000000.0": 52666670.9, "4914000000.0": 52666803.6, "4915000000.0": 52666936.3, "4916000000.0": 52667068.9, "4917000000.0": 52667201.5, "4918000000.0": 52667334.0, "4919000000.0": 52667466.4, "4920000000.0": 52667598.8, "4921000000.0": 52667731.2, "4922000000.0": 52667863.4, "4923000000.0": 52667995.7, "4924000000.0": 52668127.9, "4925000000.0": 52668260.0, "4926000000.0": 52668392.1, "4927000000.0": 52668524.1, "4928000000.0": 52668656.1, "4929000000.0": 52668788.0, "4930000000.0": 52668919.8, "4931000000.0": 52669051.7, "4932000000.0": 52669183.4, "4933000000.0": 52669315.1, "4934000000.0": 52669446.8, "4935000000.0": 52669578.4, "4936000000.0": 52669709.9, "4937000000.0": 52669841.4, "4938000000.0": 52669972.9, "4939000000.0": 52670104.3, "4940000000.0": 52670235.6, "4941000000.0": 52670366.9, "4942000000.0": 52670498.1, "4943000000.0": 52670629.3, "4944000000.0": 52670760.4, "4945000000.0": 52670891.5, "4946000000.0": 52671022.5, "4947000000.0": 52671153.5, "4948000000.0": 52671284.4, "4949000000.0": 52671415.3, "4950000000.0": 52671546.1, "4951000000.0": 52671676.9, "4952000000.0": 52671807.6, "4953000000.0": 52671938.2, "4954000000.0": 52672068.8, "4955000000.0": 52672199.4, "4956000000.0": 52672329.9, "4957000000.0": 52672460.4, "4958000000.0": 52672590.8, "4959000000.0": 52672721.1, "4960000000.0": 52672851.4, "4961000000.0": 52672981.6, "4962000000.0": 52673111.8, "4963000000.0": 52673242.0, "4964000000.0": 52673372.1, "4965000000.0": 52673502.1, "4966000000.0": 52673632.1, "4967000000.0": 52673762.0, "4968000000.0": 52673891.9, "4969000000.0": 52674021.7, "4970000000.0": 52674151.5, "4971000000.0": 52674281.2, "4972000000.0": 52674410.9, "4973000000.0": 52674540.5, "4974000000.0": 52674670.1, "4975000000.0": 52674799.6, "4976000000.0": 52674929.1, "4977000000.0": 52675058.5, "4978000000.0": 52675187.9, "4979000000.0": 52675317.2, "4980000000.0": 52675446.4, "4981000000.0": 52675575.6, "4982000000.0": 52675704.8, "4983000000.0": 52675833.9, "4984000000.0": 52675963.0, "4985000000.0": 52676092.0, "4986000000.0": 52676220.9, "4987000000.0": 52676349.8, "4988000000.0": 52676478.7, "4989000000.0": 52676607.5, "4990000000.0": 52676736.3, "4991000000.0": 52676865.0, "4992000000.0": 52676993.6, "4993000000.0": 52677122.2, "4994000000.0": 52677250.8, "4995000000.0": 52677379.3, "4996000000.0": 52677507.7, "4997000000.0": 52677636.1, "4998000000.0": 52677764.4, "4999000000.0": 52677892.7, "5000000000.0": 52678021.0, "5001000000.0": 52678149.2, "5002000000.0": 52678277.3, "5003000000.0": 52678405.4, "5004000000.0": 52678533.4, "5005000000.0": 52678661.4, "5006000000.0": 52678789.4, "5007000000.0": 52678917.3, "5008000000.0": 52679045.1, "5009000000.0": 52679172.9, "5010000000.0": 52679300.6, "5011000000.0": 52679428.3, "5012000000.0": 52679556.0, "5013000000.0": 52679683.6, "5014000000.0": 52679811.1, "5015000000.0": 52679938.6, "5016000000.0": 52680066.0, "5017000000.0": 52680193.4, "5018000000.0": 52680320.7, "5019000000.0": 52680448.0, "5020000000.0": 52680575.3, "5021000000.0": 52680702.4, "5022000000.0": 52680829.6, "5023000000.0": 52680956.7, "5024000000.0": 52681083.7, "5025000000.0": 52681210.7, "5026000000.0": 52681337.6, "5027000000.0": 52681464.5, "5028000000.0": 52681591.4, "5029000000.0": 52681718.1, "5030000000.0": 52681844.9, "5031000000.0": 52681971.6, "5032000000.0": 52682098.2, "5033000000.0": 52682224.8, "5034000000.0": 52682351.3, "5035000000.0": 52682477.8, "5036000000.0": 52682604.3, "5037000000.0": 52682730.7, "5038000000.0": 52682857.0, "5039000000.0": 52682983.3, "5040000000.0": 52683109.5, "5041000000.0": 52683235.7, "5042000000.0": 52683361.9, "5043000000.0": 52683488.0, "5044000000.0": 52683614.0, "5045000000.0": 52683740.0, "5046000000.0": 52683865.9, "5047000000.0": 52683991.8, "5048000000.0": 52684117.7, "5049000000.0": 52684243.5, "5050000000.0": 52684369.2, "5051000000.0": 52684494.9, "5052000000.0": 52684620.6, "5053000000.0": 52684746.2, "5054000000.0": 52684871.7, "5055000000.0": 52684997.2, "5056000000.0": 52685122.7, "5057000000.0": 52685248.1, "5058000000.0": 52685373.4, "5059000000.0": 52685498.7, "5060000000.0": 52685624.0, "5061000000.0": 52685749.2, "5062000000.0": 52685874.4, "5063000000.0": 52685999.5, "5064000000.0": 52686124.5, "5065000000.0": 52686249.6, "5066000000.0": 52686374.5, "5067000000.0": 52686499.4, "5068000000.0": 52686624.3, "5069000000.0": 52686749.1, "5070000000.0": 52686873.9, "5071000000.0": 52686998.6, "5072000000.0": 52687123.3, "5073000000.0": 52687247.9, "5074000000.0": 52687372.5, "5075000000.0": 52687497.0, "5076000000.0": 52687621.5, "5077000000.0": 52687745.9, "5078000000.0": 52687870.3, "5079000000.0": 52687994.6, "5080000000.0": 52688118.9, "5081000000.0": 52688243.2, "5082000000.0": 52688367.3, "5083000000.0": 52688491.5, "5084000000.0": 52688615.6, "5085000000.0": 52688739.6, "5086000000.0": 52688863.6, "5087000000.0": 52688987.6, "5088000000.0": 52689111.5, "5089000000.0": 52689235.3, "5090000000.0": 52689359.1, "5091000000.0": 52689482.9, "5092000000.0": 52689606.6, "5093000000.0": 52689730.2, "5094000000.0": 52689853.8, "5095000000.0": 52689977.4, "5096000000.0": 52690100.9, "5097000000.0": 52690224.4, "5098000000.0": 52690347.8, "5099000000.0": 52690471.2, "5100000000.0": 52690594.5, "5101000000.0": 52690717.8, "5102000000.0": 52690841.0, "5103000000.0": 52690964.2, "5104000000.0": 52691087.3, "5105000000.0": 52691210.4, "5106000000.0": 52691333.5, "5107000000.0": 52691456.4, "5108000000.0": 52691579.4, "5109000000.0": 52691702.3, "5110000000.0": 52691825.1, "5111000000.0": 52691947.9, "5112000000.0": 52692070.7, "5113000000.0": 52692193.4, "5114000000.0": 52692316.0, "5115000000.0": 52692438.7, "5116000000.0": 52692561.2, "5117000000.0": 52692683.7, "5118000000.0": 52692806.2, "5119000000.0": 52692928.6, "5120000000.0": 52693051.0, "5121000000.0": 52693173.3, "5122000000.0": 52693295.6, "5123000000.0": 52693417.8, "5124000000.0": 52693540.0, "5125000000.0": 52693662.2, "5126000000.0": 52693784.2, "5127000000.0": 52693906.3, "5128000000.0": 52694028.3, "5129000000.0": 52694150.2, "5130000000.0": 52694272.1, "5131000000.0": 52694394.0, "5132000000.0": 52694515.8, "5133000000.0": 52694637.6, "5134000000.0": 52694759.3, "5135000000.0": 52694881.0, "5136000000.0": 52695002.6, "5137000000.0": 52695124.2, "5138000000.0": 52695245.7, "5139000000.0": 52695367.2, "5140000000.0": 52695488.6, "5141000000.0": 52695610.0, "5142000000.0": 52695731.3, "5143000000.0": 52695852.6, "5144000000.0": 52695973.9, "5145000000.0": 52696095.1, "5146000000.0": 52696216.2, "5147000000.0": 52696337.3, "5148000000.0": 52696458.4, "5149000000.0": 52696579.4, "5150000000.0": 52696700.4, "5151000000.0": 52696821.3, "5152000000.0": 52696942.2, "5153000000.0": 52697063.0, "5154000000.0": 52697183.8, "5155000000.0": 52697304.5, "5156000000.0": 52697425.2, "5157000000.0": 52697545.9, "5158000000.0": 52697666.5, "5159000000.0": 52697787.0, "5160000000.0": 52697907.5, "5161000000.0": 52698028.0, "5162000000.0": 52698148.4, "5163000000.0": 52698268.8, "5164000000.0": 52698389.1, "5165000000.0": 52698509.4, "5166000000.0": 52698629.6, "5167000000.0": 52698749.8, "5168000000.0": 52698869.9, "5169000000.0": 52698990.0, "5170000000.0": 52699110.1, "5171000000.0": 52699230.1, "5172000000.0": 52699350.0, "5173000000.0": 52699469.9, "5174000000.0": 52699589.8, "5175000000.0": 52699709.6, "5176000000.0": 52699829.4, "5177000000.0": 52699949.1, "5178000000.0": 52700068.8, "5179000000.0": 52700188.4, "5180000000.0": 52700308.0, "5181000000.0": 52700427.5, "5182000000.0": 52700547.0, "5183000000.0": 52700666.5, "5184000000.0": 52700785.9, "5185000000.0": 52700905.3, "5186000000.0": 52701024.6, "5187000000.0": 52701143.9, "5188000000.0": 52701263.1, "5189000000.0": 52701382.3, "5190000000.0": 52701501.4, "5191000000.0": 52701620.5, "5192000000.0": 52701739.5, "5193000000.0": 52701858.5, "5194000000.0": 52701977.5, "5195000000.0": 52702096.4, "5196000000.0": 52702215.2, "5197000000.0": 52702334.1, "5198000000.0": 52702452.8, "5199000000.0": 52702571.6, "5200000000.0": 52702690.2, "5201000000.0": 52702808.9, "5202000000.0": 52702927.5, "5203000000.0": 52703046.0, "5204000000.0": 52703164.5, "5205000000.0": 52703283.0, "5206000000.0": 52703401.4, "5207000000.0": 52703519.8, "5208000000.0": 52703638.1, "5209000000.0": 52703756.4, "5210000000.0": 52703874.6, "5211000000.0": 52703992.8, "5212000000.0": 52704110.9, "5213000000.0": 52704229.0, "5214000000.0": 52704347.1, "5215000000.0": 52704465.1, "5216000000.0": 52704583.0, "5217000000.0": 52704701.0, "5218000000.0": 52704818.8, "5219000000.0": 52704936.7, "5220000000.0": 52705054.4, "5221000000.0": 52705172.2, "5222000000.0": 52705289.9, "5223000000.0": 52705407.5, "5224000000.0": 52705525.1, "5225000000.0": 52705642.7, "5226000000.0": 52705760.2, "5227000000.0": 52705877.7, "5228000000.0": 52705995.1, "5229000000.0": 52706112.5, "5230000000.0": 52706229.8, "5231000000.0": 52706347.1, "5232000000.0": 52706464.4, "5233000000.0": 52706581.6, "5234000000.0": 52706698.8, "5235000000.0": 52706815.9, "5236000000.0": 52706932.9, "5237000000.0": 52707050.0, "5238000000.0": 52707167.0, "5239000000.0": 52707283.9, "5240000000.0": 52707400.8, "5241000000.0": 52707517.7, "5242000000.0": 52707634.5, "5243000000.0": 52707751.2, "5244000000.0": 52707868.0, "5245000000.0": 52707984.6, "5246000000.0": 52708101.3, "5247000000.0": 52708217.9, "5248000000.0": 52708334.4, "5249000000.0": 52708450.9, "5250000000.0": 52708567.4, "5251000000.0": 52708683.8, "5252000000.0": 52708800.1, "5253000000.0": 52708916.5, "5254000000.0": 52709032.8, "5255000000.0": 52709149.0, "5256000000.0": 52709265.2, "5257000000.0": 52709381.3, "5258000000.0": 52709497.5, "5259000000.0": 52709613.5, "5260000000.0": 52709729.5, "5261000000.0": 52709845.5, "5262000000.0": 52709961.5, "5263000000.0": 52710077.3, "5264000000.0": 52710193.2, "5265000000.0": 52710309.0, "5266000000.0": 52710424.8, "5267000000.0": 52710540.5, "5268000000.0": 52710656.1, "5269000000.0": 52710771.8, "5270000000.0": 52710887.4, "5271000000.0": 52711002.9, "5272000000.0": 52711118.4, "5273000000.0": 52711233.9, "5274000000.0": 52711349.3, "5275000000.0": 52711464.6, "5276000000.0": 52711580.0, "5277000000.0": 52711695.2, "5278000000.0": 52711810.5, "5279000000.0": 52711925.7, "5280000000.0": 52712040.8, "5281000000.0": 52712156.0, "5282000000.0": 52712271.0, "5283000000.0": 52712386.0, "5284000000.0": 52712501.0, "5285000000.0": 52712616.0, "5286000000.0": 52712730.9, "5287000000.0": 52712845.7, "5288000000.0": 52712960.5, "5289000000.0": 52713075.3, "5290000000.0": 52713190.0, "5291000000.0": 52713304.7, "5292000000.0": 52713419.3, "5293000000.0": 52713533.9, "5294000000.0": 52713648.5, "5295000000.0": 52713763.0, "5296000000.0": 52713877.5, "5297000000.0": 52713991.9, "5298000000.0": 52714106.3, "5299000000.0": 52714220.6, "5300000000.0": 52714334.9, "5301000000.0": 52714449.2, "5302000000.0": 52714563.4, "5303000000.0": 52714677.5, "5304000000.0": 52714791.7, "5305000000.0": 52714905.7, "5306000000.0": 52715019.8, "5307000000.0": 52715133.8, "5308000000.0": 52715247.7, "5309000000.0": 52715361.7, "5310000000.0": 52715475.5, "5311000000.0": 52715589.4, "5312000000.0": 52715703.1, "5313000000.0": 52715816.9, "5314000000.0": 52715930.6, "5315000000.0": 52716044.3, "5316000000.0": 52716157.9, "5317000000.0": 52716271.4, "5318000000.0": 52716385.0, "5319000000.0": 52716498.5, "5320000000.0": 52716611.9, "5321000000.0": 52716725.3, "5322000000.0": 52716838.7, "5323000000.0": 52716952.0, "5324000000.0": 52717065.3, "5325000000.0": 52717178.5, "5326000000.0": 52717291.7, "5327000000.0": 52717404.9, "5328000000.0": 52717518.0, "5329000000.0": 52717631.1, "5330000000.0": 52717744.1, "5331000000.0": 52717857.1, "5332000000.0": 52717970.0, "5333000000.0": 52718082.9, "5334000000.0": 52718195.8, "5335000000.0": 52718308.6, "5336000000.0": 52718421.4, "5337000000.0": 52718534.1, "5338000000.0": 52718646.8, "5339000000.0": 52718759.5, "5340000000.0": 52718872.1, "5341000000.0": 52718984.6, "5342000000.0": 52719097.2, "5343000000.0": 52719209.7, "5344000000.0": 52719322.1, "5345000000.0": 52719434.5, "5346000000.0": 52719546.9, "5347000000.0": 52719659.2, "5348000000.0": 52719771.5, "5349000000.0": 52719883.7, "5350000000.0": 52719995.9, "5351000000.0": 52720108.0, "5352000000.0": 52720220.2, "5353000000.0": 52720332.2, "5354000000.0": 52720444.3, "5355000000.0": 52720556.2, "5356000000.0": 52720668.2, "5357000000.0": 52720780.1, "5358000000.0": 52720892.0, "5359000000.0": 52721003.8, "5360000000.0": 52721115.6, "5361000000.0": 52721227.3, "5362000000.0": 52721339.0, "5363000000.0": 52721450.7, "5364000000.0": 52721562.3, "5365000000.0": 52721673.9, "5366000000.0": 52721785.4, "5367000000.0": 52721896.9, "5368000000.0": 52722008.3, "5369000000.0": 52722119.7, "5370000000.0": 52722231.1, "5371000000.0": 52722342.4, "5372000000.0": 52722453.7, "5373000000.0": 52722565.0, "5374000000.0": 52722676.2, "5375000000.0": 52722787.4, "5376000000.0": 52722898.5, "5377000000.0": 52723009.6, "5378000000.0": 52723120.6, "5379000000.0": 52723231.6, "5380000000.0": 52723342.6, "5381000000.0": 52723453.5, "5382000000.0": 52723564.4, "5383000000.0": 52723675.2, "5384000000.0": 52723786.0, "5385000000.0": 52723896.8, "5386000000.0": 52724007.5, "5387000000.0": 52724118.2, "5388000000.0": 52724228.8, "5389000000.0": 52724339.4, "5390000000.0": 52724449.9, "5391000000.0": 52724560.5, "5392000000.0": 52724670.9, "5393000000.0": 52724781.4, "5394000000.0": 52724891.8, "5395000000.0": 52725002.1, "5396000000.0": 52725112.4, "5397000000.0": 52725222.7, "5398000000.0": 52725332.9, "5399000000.0": 52725443.1, "5400000000.0": 52725553.3, "5401000000.0": 52725663.4, "5402000000.0": 52725773.4, "5403000000.0": 52725883.5, "5404000000.0": 52725993.5, "5405000000.0": 52726103.4, "5406000000.0": 52726213.3, "5407000000.0": 52726323.2, "5408000000.0": 52726433.0, "5409000000.0": 52726542.8, "5410000000.0": 52726652.6, "5411000000.0": 52726762.3, "5412000000.0": 52726871.9, "5413000000.0": 52726981.6, "5414000000.0": 52727091.1, "5415000000.0": 52727200.7, "5416000000.0": 52727310.2, "5417000000.0": 52727419.7, "5418000000.0": 52727529.1, "5419000000.0": 52727638.5, "5420000000.0": 52727747.8, "5421000000.0": 52727857.1, "5422000000.0": 52727966.4, "5423000000.0": 52728075.6, "5424000000.0": 52728184.8, "5425000000.0": 52728294.0, "5426000000.0": 52728403.1, "5427000000.0": 52728512.2, "5428000000.0": 52728621.2, "5429000000.0": 52728730.2, "5430000000.0": 52728839.1, "5431000000.0": 52728948.0, "5432000000.0": 52729056.9, "5433000000.0": 52729165.7, "5434000000.0": 52729274.5, "5435000000.0": 52729383.3, "5436000000.0": 52729492.0, "5437000000.0": 52729600.7, "5438000000.0": 52729709.3, "5439000000.0": 52729817.9, "5440000000.0": 52729926.4, "5441000000.0": 52730035.0, "5442000000.0": 52730143.4, "5443000000.0": 52730251.9, "5444000000.0": 52730360.3, "5445000000.0": 52730468.6, "5446000000.0": 52730577.0, "5447000000.0": 52730685.2, "5448000000.0": 52730793.5, "5449000000.0": 52730901.7, "5450000000.0": 52731009.8, "5451000000.0": 52731118.0, "5452000000.0": 52731226.0, "5453000000.0": 52731334.1, "5454000000.0": 52731442.1, "5455000000.0": 52731550.0, "5456000000.0": 52731658.0, "5457000000.0": 52731765.9, "5458000000.0": 52731873.7, "5459000000.0": 52731981.5, "5460000000.0": 52732089.3, "5461000000.0": 52732197.0, "5462000000.0": 52732304.7, "5463000000.0": 52732412.4, "5464000000.0": 52732520.0, "5465000000.0": 52732627.6, "5466000000.0": 52732735.1, "5467000000.0": 52732842.6, "5468000000.0": 52732950.0, "5469000000.0": 52733057.5, "5470000000.0": 52733164.8, "5471000000.0": 52733272.2, "5472000000.0": 52733379.5, "5473000000.0": 52733486.8, "5474000000.0": 52733594.0, "5475000000.0": 52733701.2, "5476000000.0": 52733808.3, "5477000000.0": 52733915.4, "5478000000.0": 52734022.5, "5479000000.0": 52734129.5, "5480000000.0": 52734236.5, "5481000000.0": 52734343.5, "5482000000.0": 52734450.4, "5483000000.0": 52734557.3, "5484000000.0": 52734664.1, "5485000000.0": 52734770.9, "5486000000.0": 52734877.7, "5487000000.0": 52734984.4, "5488000000.0": 52735091.1, "5489000000.0": 52735197.7, "5490000000.0": 52735304.3, "5491000000.0": 52735410.9, "5492000000.0": 52735517.4, "5493000000.0": 52735623.9, "5494000000.0": 52735730.4, "5495000000.0": 52735836.8, "5496000000.0": 52735943.2, "5497000000.0": 52736049.5, "5498000000.0": 52736155.8, "5499000000.0": 52736262.1, "5500000000.0": 52736368.3, "5501000000.0": 52736474.5, "5502000000.0": 52736580.6, "5503000000.0": 52736686.8, "5504000000.0": 52736792.8, "5505000000.0": 52736898.9, "5506000000.0": 52737004.9, "5507000000.0": 52737110.8, "5508000000.0": 52737216.7, "5509000000.0": 52737322.6, "5510000000.0": 52737428.5, "5511000000.0": 52737534.3, "5512000000.0": 52737640.0, "5513000000.0": 52737745.8, "5514000000.0": 52737851.5, "5515000000.0": 52737957.1, "5516000000.0": 52738062.7, "5517000000.0": 52738168.3, "5518000000.0": 52738273.9, "5519000000.0": 52738379.4, "5520000000.0": 52738484.8, "5521000000.0": 52738590.3, "5522000000.0": 52738695.7, "5523000000.0": 52738801.0, "5524000000.0": 52738906.3, "5525000000.0": 52739011.6, "5526000000.0": 52739116.8, "5527000000.0": 52739222.0, "5528000000.0": 52739327.2, "5529000000.0": 52739432.3, "5530000000.0": 52739537.4, "5531000000.0": 52739642.5, "5532000000.0": 52739747.5, "5533000000.0": 52739852.5, "5534000000.0": 52739957.4, "5535000000.0": 52740062.3, "5536000000.0": 52740167.2, "5537000000.0": 52740272.0, "5538000000.0": 52740376.8, "5539000000.0": 52740481.5, "5540000000.0": 52740586.2, "5541000000.0": 52740690.9, "5542000000.0": 52740795.6, "5543000000.0": 52740900.2, "5544000000.0": 52741004.7, "5545000000.0": 52741109.3, "5546000000.0": 52741213.7, "5547000000.0": 52741318.2, "5548000000.0": 52741422.6, "5549000000.0": 52741527.0, "5550000000.0": 52741631.3, "5551000000.0": 52741735.6, "5552000000.0": 52741839.9, "5553000000.0": 52741944.1, "5554000000.0": 52742048.3, "5555000000.0": 52742152.5, "5556000000.0": 52742256.6, "5557000000.0": 52742360.7, "5558000000.0": 52742464.7, "5559000000.0": 52742568.7, "5560000000.0": 52742672.7, "5561000000.0": 52742776.6, "5562000000.0": 52742880.5, "5563000000.0": 52742984.4, "5564000000.0": 52743088.2, "5565000000.0": 52743192.0, "5566000000.0": 52743295.8, "5567000000.0": 52743399.5, "5568000000.0": 52743503.1, "5569000000.0": 52743606.8, "5570000000.0": 52743710.4, "5571000000.0": 52743813.9, "5572000000.0": 52743917.5, "5573000000.0": 52744021.0, "5574000000.0": 52744124.4, "5575000000.0": 52744227.8, "5576000000.0": 52744331.2, "5577000000.0": 52744434.6, "5578000000.0": 52744537.9, "5579000000.0": 52744641.1, "5580000000.0": 52744744.4, "5581000000.0": 52744847.6, "5582000000.0": 52744950.7, "5583000000.0": 52745053.9, "5584000000.0": 52745157.0, "5585000000.0": 52745260.0, "5586000000.0": 52745363.0, "5587000000.0": 52745466.0, "5588000000.0": 52745568.9, "5589000000.0": 52745671.8, "5590000000.0": 52745774.7, "5591000000.0": 52745877.5, "5592000000.0": 52745980.3, "5593000000.0": 52746083.1, "5594000000.0": 52746185.8, "5595000000.0": 52746288.5, "5596000000.0": 52746391.2, "5597000000.0": 52746493.8, "5598000000.0": 52746596.4, "5599000000.0": 52746698.9, "5600000000.0": 52746801.4, "5601000000.0": 52746903.9, "5602000000.0": 52747006.3, "5603000000.0": 52747108.7, "5604000000.0": 52747211.1, "5605000000.0": 52747313.4, "5606000000.0": 52747415.7, "5607000000.0": 52747518.0, "5608000000.0": 52747620.2, "5609000000.0": 52747722.4, "5610000000.0": 52747824.5, "5611000000.0": 52747926.6, "5612000000.0": 52748028.7, "5613000000.0": 52748130.7, "5614000000.0": 52748232.7, "5615000000.0": 52748334.7, "5616000000.0": 52748436.6, "5617000000.0": 52748538.5, "5618000000.0": 52748640.4, "5619000000.0": 52748742.2, "5620000000.0": 52748844.0, "5621000000.0": 52748945.7, "5622000000.0": 52749047.4, "5623000000.0": 52749149.1, "5624000000.0": 52749250.8, "5625000000.0": 52749352.4, "5626000000.0": 52749453.9, "5627000000.0": 52749555.5, "5628000000.0": 52749657.0, "5629000000.0": 52749758.4, "5630000000.0": 52749859.9, "5631000000.0": 52749961.3, "5632000000.0": 52750062.6, "5633000000.0": 52750164.0, "5634000000.0": 52750265.2, "5635000000.0": 52750366.5, "5636000000.0": 52750467.7, "5637000000.0": 52750568.9, "5638000000.0": 52750670.0, "5639000000.0": 52750771.1, "5640000000.0": 52750872.2, "5641000000.0": 52750973.3, "5642000000.0": 52751074.3, "5643000000.0": 52751175.2, "5644000000.0": 52751276.2, "5645000000.0": 52751377.1, "5646000000.0": 52751477.9, "5647000000.0": 52751578.7, "5648000000.0": 52751679.5, "5649000000.0": 52751780.3, "5650000000.0": 52751881.0, "5651000000.0": 52751981.7, "5652000000.0": 52752082.3, "5653000000.0": 52752183.0, "5654000000.0": 52752283.5, "5655000000.0": 52752384.1, "5656000000.0": 52752484.6, "5657000000.0": 52752585.1, "5658000000.0": 52752685.5, "5659000000.0": 52752785.9, "5660000000.0": 52752886.3, "5661000000.0": 52752986.6, "5662000000.0": 52753086.9, "5663000000.0": 52753187.2, "5664000000.0": 52753287.4, "5665000000.0": 52753387.6, "5666000000.0": 52753487.7, "5667000000.0": 52753587.9, "5668000000.0": 52753688.0, "5669000000.0": 52753788.0, "5670000000.0": 52753888.0, "5671000000.0": 52753988.0, "5672000000.0": 52754088.0, "5673000000.0": 52754187.9, "5674000000.0": 52754287.8, "5675000000.0": 52754387.6, "5676000000.0": 52754487.4, "5677000000.0": 52754587.2, "5678000000.0": 52754686.9, "5679000000.0": 52754786.6, "5680000000.0": 52754886.3, "5681000000.0": 52754985.9, "5682000000.0": 52755085.5, "5683000000.0": 52755185.1, "5684000000.0": 52755284.6, "5685000000.0": 52755384.1, "5686000000.0": 52755483.6, "5687000000.0": 52755583.0, "5688000000.0": 52755682.4, "5689000000.0": 52755781.8, "5690000000.0": 52755881.1, "5691000000.0": 52755980.4, "5692000000.0": 52756079.7, "5693000000.0": 52756178.9, "5694000000.0": 52756278.1, "5695000000.0": 52756377.2, "5696000000.0": 52756476.3, "5697000000.0": 52756575.4, "5698000000.0": 52756674.5, "5699000000.0": 52756773.5, "5700000000.0": 52756872.5, "5701000000.0": 52756971.4, "5702000000.0": 52757070.3, "5703000000.0": 52757169.2, "5704000000.0": 52757268.0, "5705000000.0": 52757366.8, "5706000000.0": 52757465.6, "5707000000.0": 52757564.4, "5708000000.0": 52757663.1, "5709000000.0": 52757761.7, "5710000000.0": 52757860.4, "5711000000.0": 52757959.0, "5712000000.0": 52758057.5, "5713000000.0": 52758156.1, "5714000000.0": 52758254.6, "5715000000.0": 52758353.0, "5716000000.0": 52758451.5, "5717000000.0": 52758549.9, "5718000000.0": 52758648.2, "5719000000.0": 52758746.6, "5720000000.0": 52758844.9, "5721000000.0": 52758943.1, "5722000000.0": 52759041.4, "5723000000.0": 52759139.6, "5724000000.0": 52759237.7, "5725000000.0": 52759335.8, "5726000000.0": 52759433.9, "5727000000.0": 52759532.0, "5728000000.0": 52759630.0, "5729000000.0": 52759728.0, "5730000000.0": 52759826.0, "5731000000.0": 52759923.9, "5732000000.0": 52760021.8, "5733000000.0": 52760119.6, "5734000000.0": 52760217.5, "5735000000.0": 52760315.2, "5736000000.0": 52760413.0, "5737000000.0": 52760510.7, "5738000000.0": 52760608.4, "5739000000.0": 52760706.1, "5740000000.0": 52760803.7, "5741000000.0": 52760901.3, "5742000000.0": 52760998.8, "5743000000.0": 52761096.3, "5744000000.0": 52761193.8, "5745000000.0": 52761291.3, "5746000000.0": 52761388.7, "5747000000.0": 52761486.1, "5748000000.0": 52761583.4, "5749000000.0": 52761680.8, "5750000000.0": 52761778.0, "5751000000.0": 52761875.3, "5752000000.0": 52761972.5, "5753000000.0": 52762069.7, "5754000000.0": 52762166.8, "5755000000.0": 52762264.0, "5756000000.0": 52762361.0, "5757000000.0": 52762458.1, "5758000000.0": 52762555.1, "5759000000.0": 52762652.1, "5760000000.0": 52762749.0, "5761000000.0": 52762846.0, "5762000000.0": 52762942.8, "5763000000.0": 52763039.7, "5764000000.0": 52763136.5, "5765000000.0": 52763233.3, "5766000000.0": 52763330.1, "5767000000.0": 52763426.8, "5768000000.0": 52763523.5, "5769000000.0": 52763620.1, "5770000000.0": 52763716.7, "5771000000.0": 52763813.3, "5772000000.0": 52763909.9, "5773000000.0": 52764006.4, "5774000000.0": 52764102.9, "5775000000.0": 52764199.3, "5776000000.0": 52764295.7, "5777000000.0": 52764392.1, "5778000000.0": 52764488.5, "5779000000.0": 52764584.8, "5780000000.0": 52764681.1, "5781000000.0": 52764777.3, "5782000000.0": 52764873.6, "5783000000.0": 52764969.8, "5784000000.0": 52765065.9, "5785000000.0": 52765162.0, "5786000000.0": 52765258.1, "5787000000.0": 52765354.2, "5788000000.0": 52765450.2, "5789000000.0": 52765546.2, "5790000000.0": 52765642.2, "5791000000.0": 52765738.1, "5792000000.0": 52765834.0, "5793000000.0": 52765929.8, "5794000000.0": 52766025.7, "5795000000.0": 52766121.5, "5796000000.0": 52766217.2, "5797000000.0": 52766313.0, "5798000000.0": 52766408.7, "5799000000.0": 52766504.3, "5800000000.0": 52766600.0, "5801000000.0": 52766695.6, "5802000000.0": 52766791.1, "5803000000.0": 52766886.7, "5804000000.0": 52766982.2, "5805000000.0": 52767077.6, "5806000000.0": 52767173.1, "5807000000.0": 52767268.5, "5808000000.0": 52767363.8, "5809000000.0": 52767459.2, "5810000000.0": 52767554.5, "5811000000.0": 52767649.8, "5812000000.0": 52767745.0, "5813000000.0": 52767840.2, "5814000000.0": 52767935.4, "5815000000.0": 52768030.5, "5816000000.0": 52768125.6, "5817000000.0": 52768220.7, "5818000000.0": 52768315.8, "5819000000.0": 52768410.8, "5820000000.0": 52768505.8, "5821000000.0": 52768600.7, "5822000000.0": 52768695.6, "5823000000.0": 52768790.5, "5824000000.0": 52768885.4, "5825000000.0": 52768980.2, "5826000000.0": 52769075.0, "5827000000.0": 52769169.8, "5828000000.0": 52769264.5, "5829000000.0": 52769359.2, "5830000000.0": 52769453.8, "5831000000.0": 52769548.5, "5832000000.0": 52769643.1, "5833000000.0": 52769737.6, "5834000000.0": 52769832.2, "5835000000.0": 52769926.7, "5836000000.0": 52770021.1, "5837000000.0": 52770115.6, "5838000000.0": 52770210.0, "5839000000.0": 52770304.3, "5840000000.0": 52770398.7, "5841000000.0": 52770493.0, "5842000000.0": 52770587.3, "5843000000.0": 52770681.5, "5844000000.0": 52770775.7, "5845000000.0": 52770869.9, "5846000000.0": 52770964.0, "5847000000.0": 52771058.2, "5848000000.0": 52771152.3, "5849000000.0": 52771246.3, "5850000000.0": 52771340.3, "5851000000.0": 52771434.3, "5852000000.0": 52771528.3, "5853000000.0": 52771622.2, "5854000000.0": 52771716.1, "5855000000.0": 52771810.0, "5856000000.0": 52771903.8, "5857000000.0": 52771997.6, "5858000000.0": 52772091.4, "5859000000.0": 52772185.1, "5860000000.0": 52772278.8, "5861000000.0": 52772372.5, "5862000000.0": 52772466.1, "5863000000.0": 52772559.7, "5864000000.0": 52772653.3, "5865000000.0": 52772746.8, "5866000000.0": 52772840.4, "5867000000.0": 52772933.8, "5868000000.0": 52773027.3, "5869000000.0": 52773120.7, "5870000000.0": 52773214.1, "5871000000.0": 52773307.5, "5872000000.0": 52773400.8, "5873000000.0": 52773494.1, "5874000000.0": 52773587.3, "5875000000.0": 52773680.6, "5876000000.0": 52773773.8, "5877000000.0": 52773866.9, "5878000000.0": 52773960.1, "5879000000.0": 52774053.2, "5880000000.0": 52774146.3, "5881000000.0": 52774239.3, "5882000000.0": 52774332.3, "5883000000.0": 52774425.3, "5884000000.0": 52774518.2, "5885000000.0": 52774611.2, "5886000000.0": 52774704.1, "5887000000.0": 52774796.9, "5888000000.0": 52774889.7, "5889000000.0": 52774982.5, "5890000000.0": 52775075.3, "5891000000.0": 52775168.0, "5892000000.0": 52775260.7, "5893000000.0": 52775353.4, "5894000000.0": 52775446.0, "5895000000.0": 52775538.6, "5896000000.0": 52775631.2, "5897000000.0": 52775723.8, "5898000000.0": 52775816.3, "5899000000.0": 52775908.8, "5900000000.0": 52776001.2, "5901000000.0": 52776093.6, "5902000000.0": 52776186.0, "5903000000.0": 52776278.4, "5904000000.0": 52776370.7, "5905000000.0": 52776463.0, "5906000000.0": 52776555.3, "5907000000.0": 52776647.5, "5908000000.0": 52776739.7, "5909000000.0": 52776831.9, "5910000000.0": 52776924.0, "5911000000.0": 52777016.1, "5912000000.0": 52777108.2, "5913000000.0": 52777200.3, "5914000000.0": 52777292.3, "5915000000.0": 52777384.3, "5916000000.0": 52777476.2, "5917000000.0": 52777568.1, "5918000000.0": 52777660.0, "5919000000.0": 52777751.9, "5920000000.0": 52777843.7, "5921000000.0": 52777935.5, "5922000000.0": 52778027.3, "5923000000.0": 52778119.1, "5924000000.0": 52778210.8, "5925000000.0": 52778302.5, "5926000000.0": 52778394.1, "5927000000.0": 52778485.7, "5928000000.0": 52778577.3, "5929000000.0": 52778668.9, "5930000000.0": 52778760.4, "5931000000.0": 52778851.9, "5932000000.0": 52778943.4, "5933000000.0": 52779034.8, "5934000000.0": 52779126.2, "5935000000.0": 52779217.6, "5936000000.0": 52779308.9, "5937000000.0": 52779400.2, "5938000000.0": 52779491.5, "5939000000.0": 52779582.8, "5940000000.0": 52779674.0, "5941000000.0": 52779765.2, "5942000000.0": 52779856.4, "5943000000.0": 52779947.5, "5944000000.0": 52780038.6, "5945000000.0": 52780129.7, "5946000000.0": 52780220.7, "5947000000.0": 52780311.7, "5948000000.0": 52780402.7, "5949000000.0": 52780493.6, "5950000000.0": 52780584.6, "5951000000.0": 52780675.5, "5952000000.0": 52780766.3, "5953000000.0": 52780857.1, "5954000000.0": 52780947.9, "5955000000.0": 52781038.7, "5956000000.0": 52781129.5, "5957000000.0": 52781220.2, "5958000000.0": 52781310.8, "5959000000.0": 52781401.5, "5960000000.0": 52781492.1, "5961000000.0": 52781582.7, "5962000000.0": 52781673.3, "5963000000.0": 52781763.8, "5964000000.0": 52781854.3, "5965000000.0": 52781944.7, "5966000000.0": 52782035.2, "5967000000.0": 52782125.6, "5968000000.0": 52782216.0, "5969000000.0": 52782306.3, "5970000000.0": 52782396.6, "5971000000.0": 52782486.9, "5972000000.0": 52782577.2, "5973000000.0": 52782667.4, "5974000000.0": 52782757.6, "5975000000.0": 52782847.8, "5976000000.0": 52782937.9, "5977000000.0": 52783028.0, "5978000000.0": 52783118.1, "5979000000.0": 52783208.2, "5980000000.0": 52783298.2, "5981000000.0": 52783388.2, "5982000000.0": 52783478.1, "5983000000.0": 52783568.1, "5984000000.0": 52783658.0, "5985000000.0": 52783747.8, "5986000000.0": 52783837.7, "5987000000.0": 52783927.5, "5988000000.0": 52784017.3, "5989000000.0": 52784107.0, "5990000000.0": 52784196.7, "5991000000.0": 52784286.4, "5992000000.0": 52784376.1, "5993000000.0": 52784465.7, "5994000000.0": 52784555.3, "5995000000.0": 52784644.9, "5996000000.0": 52784734.5, "5997000000.0": 52784824.0, "5998000000.0": 52784913.5, "5999000000.0": 52785002.9, "6000000000.0": 52785092.3, "6001000000.0": 52785181.7, "6002000000.0": 52785271.1, "6003000000.0": 52785360.4, "6004000000.0": 52785449.7, "6005000000.0": 52785539.0, "6006000000.0": 52785628.3, "6007000000.0": 52785717.5, "6008000000.0": 52785806.7, "6009000000.0": 52785895.8, "6010000000.0": 52785985.0, "6011000000.0": 52786074.1, "6012000000.0": 52786163.2, "6013000000.0": 52786252.2, "6014000000.0": 52786341.2, "6015000000.0": 52786430.2, "6016000000.0": 52786519.2, "6017000000.0": 52786608.1, "6018000000.0": 52786697.0, "6019000000.0": 52786785.9, "6020000000.0": 52786874.7, "6021000000.0": 52786963.5, "6022000000.0": 52787052.3, "6023000000.0": 52787141.0, "6024000000.0": 52787229.8, "6025000000.0": 52787318.5, "6026000000.0": 52787407.1, "6027000000.0": 52787495.8, "6028000000.0": 52787584.4, "6029000000.0": 52787672.9, "6030000000.0": 52787761.5, "6031000000.0": 52787850.0, "6032000000.0": 52787938.5, "6033000000.0": 52788027.0, "6034000000.0": 52788115.4, "6035000000.0": 52788203.8, "6036000000.0": 52788292.2, "6037000000.0": 52788380.5, "6038000000.0": 52788468.8, "6039000000.0": 52788557.1, "6040000000.0": 52788645.4, "6041000000.0": 52788733.6, "6042000000.0": 52788821.8, "6043000000.0": 52788910.0, "6044000000.0": 52788998.1, "6045000000.0": 52789086.2, "6046000000.0": 52789174.3, "6047000000.0": 52789262.4, "6048000000.0": 52789350.4, "6049000000.0": 52789438.4, "6050000000.0": 52789526.4, "6051000000.0": 52789614.3, "6052000000.0": 52789702.2, "6053000000.0": 52789790.1, "6054000000.0": 52789878.0, "6055000000.0": 52789965.8, "6056000000.0": 52790053.6, "6057000000.0": 52790141.3, "6058000000.0": 52790229.1, "6059000000.0": 52790316.8, "6060000000.0": 52790404.5, "6061000000.0": 52790492.1, "6062000000.0": 52790579.8, "6063000000.0": 52790667.4, "6064000000.0": 52790754.9, "6065000000.0": 52790842.5, "6066000000.0": 52790930.0, "6067000000.0": 52791017.5, "6068000000.0": 52791104.9, "6069000000.0": 52791192.3, "6070000000.0": 52791279.7, "6071000000.0": 52791367.1, "6072000000.0": 52791454.4, "6073000000.0": 52791541.8, "6074000000.0": 52791629.0, "6075000000.0": 52791716.3, "6076000000.0": 52791803.5, "6077000000.0": 52791890.7, "6078000000.0": 52791977.9, "6079000000.0": 52792065.0, "6080000000.0": 52792152.1, "6081000000.0": 52792239.2, "6082000000.0": 52792326.3, "6083000000.0": 52792413.3, "6084000000.0": 52792500.3, "6085000000.0": 52792587.3, "6086000000.0": 52792674.2, "6087000000.0": 52792761.1, "6088000000.0": 52792848.0, "6089000000.0": 52792934.9, "6090000000.0": 52793021.7, "6091000000.0": 52793108.5, "6092000000.0": 52793195.3, "6093000000.0": 52793282.0, "6094000000.0": 52793368.7, "6095000000.0": 52793455.4, "6096000000.0": 52793542.1, "6097000000.0": 52793628.7, "6098000000.0": 52793715.3, "6099000000.0": 52793801.9, "6100000000.0": 52793888.5, "6101000000.0": 52793975.0, "6102000000.0": 52794061.5, "6103000000.0": 52794147.9, "6104000000.0": 52794234.4, "6105000000.0": 52794320.8, "6106000000.0": 52794407.1, "6107000000.0": 52794493.5, "6108000000.0": 52794579.8, "6109000000.0": 52794666.1, "6110000000.0": 52794752.4, "6111000000.0": 52794838.6, "6112000000.0": 52794924.8, "6113000000.0": 52795011.0, "6114000000.0": 52795097.2, "6115000000.0": 52795183.3, "6116000000.0": 52795269.4, "6117000000.0": 52795355.5, "6118000000.0": 52795441.5, "6119000000.0": 52795527.5, "6120000000.0": 52795613.5, "6121000000.0": 52795699.5, "6122000000.0": 52795785.4, "6123000000.0": 52795871.3, "6124000000.0": 52795957.2, "6125000000.0": 52796043.1, "6126000000.0": 52796128.9, "6127000000.0": 52796214.7, "6128000000.0": 52796300.4, "6129000000.0": 52796386.2, "6130000000.0": 52796471.9, "6131000000.0": 52796557.6, "6132000000.0": 52796643.2, "6133000000.0": 52796728.9, "6134000000.0": 52796814.5, "6135000000.0": 52796900.0, "6136000000.0": 52796985.6, "6137000000.0": 52797071.1, "6138000000.0": 52797156.6, "6139000000.0": 52797242.1, "6140000000.0": 52797327.5, "6141000000.0": 52797412.9, "6142000000.0": 52797498.3, "6143000000.0": 52797583.6, "6144000000.0": 52797669.0, "6145000000.0": 52797754.3, "6146000000.0": 52797839.5, "6147000000.0": 52797924.8, "6148000000.0": 52798010.0, "6149000000.0": 52798095.2, "6150000000.0": 52798180.3, "6151000000.0": 52798265.5, "6152000000.0": 52798350.6, "6153000000.0": 52798435.6, "6154000000.0": 52798520.7, "6155000000.0": 52798605.7, "6156000000.0": 52798690.7, "6157000000.0": 52798775.7, "6158000000.0": 52798860.6, "6159000000.0": 52798945.5, "6160000000.0": 52799030.4, "6161000000.0": 52799115.3, "6162000000.0": 52799200.1, "6163000000.0": 52799284.9, "6164000000.0": 52799369.7, "6165000000.0": 52799454.5, "6166000000.0": 52799539.2, "6167000000.0": 52799623.9, "6168000000.0": 52799708.5, "6169000000.0": 52799793.2, "6170000000.0": 52799877.8, "6171000000.0": 52799962.4, "6172000000.0": 52800046.9, "6173000000.0": 52800131.5, "6174000000.0": 52800216.0, "6175000000.0": 52800300.5, "6176000000.0": 52800384.9, "6177000000.0": 52800469.3, "6178000000.0": 52800553.7, "6179000000.0": 52800638.1, "6180000000.0": 52800722.5, "6181000000.0": 52800806.8, "6182000000.0": 52800891.1, "6183000000.0": 52800975.3, "6184000000.0": 52801059.6, "6185000000.0": 52801143.8, "6186000000.0": 52801228.0, "6187000000.0": 52801312.1, "6188000000.0": 52801396.2, "6189000000.0": 52801480.3, "6190000000.0": 52801564.4, "6191000000.0": 52801648.5, "6192000000.0": 52801732.5, "6193000000.0": 52801816.5, "6194000000.0": 52801900.4, "6195000000.0": 52801984.4, "6196000000.0": 52802068.3, "6197000000.0": 52802152.2, "6198000000.0": 52802236.0, "6199000000.0": 52802319.9, "6200000000.0": 52802403.7, "6201000000.0": 52802487.5, "6202000000.0": 52802571.2, "6203000000.0": 52802654.9, "6204000000.0": 52802738.6, "6205000000.0": 52802822.3, "6206000000.0": 52802906.0, "6207000000.0": 52802989.6, "6208000000.0": 52803073.2, "6209000000.0": 52803156.7, "6210000000.0": 52803240.3, "6211000000.0": 52803323.8, "6212000000.0": 52803407.3, "6213000000.0": 52803490.7, "6214000000.0": 52803574.2, "6215000000.0": 52803657.6, "6216000000.0": 52803740.9, "6217000000.0": 52803824.3, "6218000000.0": 52803907.6, "6219000000.0": 52803990.9, "6220000000.0": 52804074.2, "6221000000.0": 52804157.4, "6222000000.0": 52804240.7, "6223000000.0": 52804323.9, "6224000000.0": 52804407.0, "6225000000.0": 52804490.2, "6226000000.0": 52804573.3, "6227000000.0": 52804656.4, "6228000000.0": 52804739.4, "6229000000.0": 52804822.5, "6230000000.0": 52804905.5, "6231000000.0": 52804988.5, "6232000000.0": 52805071.4, "6233000000.0": 52805154.3, "6234000000.0": 52805237.3, "6235000000.0": 52805320.1, "6236000000.0": 52805403.0, "6237000000.0": 52805485.8, "6238000000.0": 52805568.6, "6239000000.0": 52805651.4, "6240000000.0": 52805734.1, "6241000000.0": 52805816.8, "6242000000.0": 52805899.5, "6243000000.0": 52805982.2, "6244000000.0": 52806064.8, "6245000000.0": 52806147.5, "6246000000.0": 52806230.0, "6247000000.0": 52806312.6, "6248000000.0": 52806395.1, "6249000000.0": 52806477.7, "6250000000.0": 52806560.1, "6251000000.0": 52806642.6, "6252000000.0": 52806725.0, "6253000000.0": 52806807.4, "6254000000.0": 52806889.8, "6255000000.0": 52806972.2, "6256000000.0": 52807054.5, "6257000000.0": 52807136.8, "6258000000.0": 52807219.1, "6259000000.0": 52807301.3, "6260000000.0": 52807383.5, "6261000000.0": 52807465.7, "6262000000.0": 52807547.9, "6263000000.0": 52807630.1, "6264000000.0": 52807712.2, "6265000000.0": 52807794.3, "6266000000.0": 52807876.3, "6267000000.0": 52807958.4, "6268000000.0": 52808040.4, "6269000000.0": 52808122.4, "6270000000.0": 52808204.3, "6271000000.0": 52808286.3, "6272000000.0": 52808368.2, "6273000000.0": 52808450.1, "6274000000.0": 52808531.9, "6275000000.0": 52808613.8, "6276000000.0": 52808695.6, "6277000000.0": 52808777.4, "6278000000.0": 52808859.1, "6279000000.0": 52808940.8, "6280000000.0": 52809022.6, "6281000000.0": 52809104.2, "6282000000.0": 52809185.9, "6283000000.0": 52809267.5, "6284000000.0": 52809349.1, "6285000000.0": 52809430.7, "6286000000.0": 52809512.2, "6287000000.0": 52809593.8, "6288000000.0": 52809675.3, "6289000000.0": 52809756.7, "6290000000.0": 52809838.2, "6291000000.0": 52809919.6, "6292000000.0": 52810001.0, "6293000000.0": 52810082.4, "6294000000.0": 52810163.7, "6295000000.0": 52810245.1, "6296000000.0": 52810326.3, "6297000000.0": 52810407.6, "6298000000.0": 52810488.9, "6299000000.0": 52810570.1, "6300000000.0": 52810651.3, "6301000000.0": 52810732.4, "6302000000.0": 52810813.6, "6303000000.0": 52810894.7, "6304000000.0": 52810975.8, "6305000000.0": 52811056.8, "6306000000.0": 52811137.9, "6307000000.0": 52811218.9, "6308000000.0": 52811299.9, "6309000000.0": 52811380.9, "6310000000.0": 52811461.8, "6311000000.0": 52811542.7, "6312000000.0": 52811623.6, "6313000000.0": 52811704.5, "6314000000.0": 52811785.3, "6315000000.0": 52811866.1, "6316000000.0": 52811946.9, "6317000000.0": 52812027.6, "6318000000.0": 52812108.4, "6319000000.0": 52812189.1, "6320000000.0": 52812269.8, "6321000000.0": 52812350.4, "6322000000.0": 52812431.1, "6323000000.0": 52812511.7, "6324000000.0": 52812592.3, "6325000000.0": 52812672.8, "6326000000.0": 52812753.4, "6327000000.0": 52812833.9, "6328000000.0": 52812914.3, "6329000000.0": 52812994.8, "6330000000.0": 52813075.2, "6331000000.0": 52813155.6, "6332000000.0": 52813236.0, "6333000000.0": 52813316.4, "6334000000.0": 52813396.7, "6335000000.0": 52813477.0, "6336000000.0": 52813557.3, "6337000000.0": 52813637.6, "6338000000.0": 52813717.8, "6339000000.0": 52813798.0, "6340000000.0": 52813878.2, "6341000000.0": 52813958.3, "6342000000.0": 52814038.5, "6343000000.0": 52814118.6, "6344000000.0": 52814198.6, "6345000000.0": 52814278.7, "6346000000.0": 52814358.7, "6347000000.0": 52814438.7, "6348000000.0": 52814518.7, "6349000000.0": 52814598.7, "6350000000.0": 52814678.6, "6351000000.0": 52814758.5, "6352000000.0": 52814838.4, "6353000000.0": 52814918.3, "6354000000.0": 52814998.1, "6355000000.0": 52815077.9, "6356000000.0": 52815157.7, "6357000000.0": 52815237.4, "6358000000.0": 52815317.2, "6359000000.0": 52815396.9, "6360000000.0": 52815476.6, "6361000000.0": 52815556.2, "6362000000.0": 52815635.8, "6363000000.0": 52815715.5, "6364000000.0": 52815795.0, "6365000000.0": 52815874.6, "6366000000.0": 52815954.1, "6367000000.0": 52816033.6, "6368000000.0": 52816113.1, "6369000000.0": 52816192.6, "6370000000.0": 52816272.0, "6371000000.0": 52816351.4, "6372000000.0": 52816430.8, "6373000000.0": 52816510.2, "6374000000.0": 52816589.5, "6375000000.0": 52816668.8, "6376000000.0": 52816748.1, "6377000000.0": 52816827.4, "6378000000.0": 52816906.6, "6379000000.0": 52816985.8, "6380000000.0": 52817065.0, "6381000000.0": 52817144.2, "6382000000.0": 52817223.3, "6383000000.0": 52817302.4, "6384000000.0": 52817381.5, "6385000000.0": 52817460.6, "6386000000.0": 52817539.6, "6387000000.0": 52817618.6, "6388000000.0": 52817697.6, "6389000000.0": 52817776.6, "6390000000.0": 52817855.5, "6391000000.0": 52817934.5, "6392000000.0": 52818013.4, "6393000000.0": 52818092.2, "6394000000.0": 52818171.1, "6395000000.0": 52818249.9, "6396000000.0": 52818328.7, "6397000000.0": 52818407.5, "6398000000.0": 52818486.2, "6399000000.0": 52818564.9, "6400000000.0": 52818643.6, "6401000000.0": 52818722.3, "6402000000.0": 52818801.0, "6403000000.0": 52818879.6, "6404000000.0": 52818958.2, "6405000000.0": 52819036.8, "6406000000.0": 52819115.3, "6407000000.0": 52819193.9, "6408000000.0": 52819272.4, "6409000000.0": 52819350.8, "6410000000.0": 52819429.3, "6411000000.0": 52819507.7, "6412000000.0": 52819586.1, "6413000000.0": 52819664.5, "6414000000.0": 52819742.9, "6415000000.0": 52819821.2, "6416000000.0": 52819899.5, "6417000000.0": 52819977.8, "6418000000.0": 52820056.1, "6419000000.0": 52820134.3, "6420000000.0": 52820212.5, "6421000000.0": 52820290.7, "6422000000.0": 52820368.9, "6423000000.0": 52820447.0, "6424000000.0": 52820525.1, "6425000000.0": 52820603.2, "6426000000.0": 52820681.3, "6427000000.0": 52820759.3, "6428000000.0": 52820837.4, "6429000000.0": 52820915.4, "6430000000.0": 52820993.3, "6431000000.0": 52821071.3, "6432000000.0": 52821149.2, "6433000000.0": 52821227.1, "6434000000.0": 52821305.0, "6435000000.0": 52821382.9, "6436000000.0": 52821460.7, "6437000000.0": 52821538.5, "6438000000.0": 52821616.3, "6439000000.0": 52821694.0, "6440000000.0": 52821771.8, "6441000000.0": 52821849.5, "6442000000.0": 52821927.2, "6443000000.0": 52822004.8, "6444000000.0": 52822082.5, "6445000000.0": 52822160.1, "6446000000.0": 52822237.7, "6447000000.0": 52822315.2, "6448000000.0": 52822392.8, "6449000000.0": 52822470.3, "6450000000.0": 52822547.8, "6451000000.0": 52822625.3, "6452000000.0": 52822702.7, "6453000000.0": 52822780.1, "6454000000.0": 52822857.5, "6455000000.0": 52822934.9, "6456000000.0": 52823012.3, "6457000000.0": 52823089.6, "6458000000.0": 52823166.9, "6459000000.0": 52823244.2, "6460000000.0": 52823321.4, "6461000000.0": 52823398.7, "6462000000.0": 52823475.9, "6463000000.0": 52823553.1, "6464000000.0": 52823630.2, "6465000000.0": 52823707.4, "6466000000.0": 52823784.5, "6467000000.0": 52823861.6, "6468000000.0": 52823938.6, "6469000000.0": 52824015.7, "6470000000.0": 52824092.7, "6471000000.0": 52824169.7, "6472000000.0": 52824246.7, "6473000000.0": 52824323.6, "6474000000.0": 52824400.6, "6475000000.0": 52824477.5, "6476000000.0": 52824554.3, "6477000000.0": 52824631.2, "6478000000.0": 52824708.0, "6479000000.0": 52824784.8, "6480000000.0": 52824861.6, "6481000000.0": 52824938.4, "6482000000.0": 52825015.1, "6483000000.0": 52825091.9, "6484000000.0": 52825168.5, "6485000000.0": 52825245.2, "6486000000.0": 52825321.9, "6487000000.0": 52825398.5, "6488000000.0": 52825475.1, "6489000000.0": 52825551.7, "6490000000.0": 52825628.2, "6491000000.0": 52825704.7, "6492000000.0": 52825781.2, "6493000000.0": 52825857.7, "6494000000.0": 52825934.2, "6495000000.0": 52826010.6, "6496000000.0": 52826087.0, "6497000000.0": 52826163.4, "6498000000.0": 52826239.8, "6499000000.0": 52826316.1, "6500000000.0": 52826392.5, "6501000000.0": 52826468.7, "6502000000.0": 52826545.0, "6503000000.0": 52826621.3, "6504000000.0": 52826697.5, "6505000000.0": 52826773.7, "6506000000.0": 52826849.9, "6507000000.0": 52826926.0, "6508000000.0": 52827002.2, "6509000000.0": 52827078.3, "6510000000.0": 52827154.4, "6511000000.0": 52827230.4, "6512000000.0": 52827306.5, "6513000000.0": 52827382.5, "6514000000.0": 52827458.5, "6515000000.0": 52827534.5, "6516000000.0": 52827610.4, "6517000000.0": 52827686.3, "6518000000.0": 52827762.2, "6519000000.0": 52827838.1, "6520000000.0": 52827914.0, "6521000000.0": 52827989.8, "6522000000.0": 52828065.6, "6523000000.0": 52828141.4, "6524000000.0": 52828217.2, "6525000000.0": 52828292.9, "6526000000.0": 52828368.6, "6527000000.0": 52828444.3, "6528000000.0": 52828520.0, "6529000000.0": 52828595.6, "6530000000.0": 52828671.3, "6531000000.0": 52828746.9, "6532000000.0": 52828822.4, "6533000000.0": 52828898.0, "6534000000.0": 52828973.5, "6535000000.0": 52829049.0, "6536000000.0": 52829124.5, "6537000000.0": 52829200.0, "6538000000.0": 52829275.4, "6539000000.0": 52829350.9, "6540000000.0": 52829426.3, "6541000000.0": 52829501.6, "6542000000.0": 52829577.0, "6543000000.0": 52829652.3, "6544000000.0": 52829727.6, "6545000000.0": 52829802.9, "6546000000.0": 52829878.2, "6547000000.0": 52829953.4, "6548000000.0": 52830028.6, "6549000000.0": 52830103.8, "6550000000.0": 52830179.0, "6551000000.0": 52830254.1, "6552000000.0": 52830329.2, "6553000000.0": 52830404.3, "6554000000.0": 52830479.4, "6555000000.0": 52830554.5, "6556000000.0": 52830629.5, "6557000000.0": 52830704.5, "6558000000.0": 52830779.5, "6559000000.0": 52830854.5, "6560000000.0": 52830929.4, "6561000000.0": 52831004.3, "6562000000.0": 52831079.2, "6563000000.0": 52831154.1, "6564000000.0": 52831229.0, "6565000000.0": 52831303.8, "6566000000.0": 52831378.6, "6567000000.0": 52831453.4, "6568000000.0": 52831528.1, "6569000000.0": 52831602.9, "6570000000.0": 52831677.6, "6571000000.0": 52831752.3, "6572000000.0": 52831827.0, "6573000000.0": 52831901.6, "6574000000.0": 52831976.2, "6575000000.0": 52832050.9, "6576000000.0": 52832125.4, "6577000000.0": 52832200.0, "6578000000.0": 52832274.5, "6579000000.0": 52832349.0, "6580000000.0": 52832423.5, "6581000000.0": 52832498.0, "6582000000.0": 52832572.5, "6583000000.0": 52832646.9, "6584000000.0": 52832721.3, "6585000000.0": 52832795.7, "6586000000.0": 52832870.0, "6587000000.0": 52832944.3, "6588000000.0": 52833018.7, "6589000000.0": 52833093.0, "6590000000.0": 52833167.2, "6591000000.0": 52833241.5, "6592000000.0": 52833315.7, "6593000000.0": 52833389.9, "6594000000.0": 52833464.1, "6595000000.0": 52833538.2, "6596000000.0": 52833612.4, "6597000000.0": 52833686.5, "6598000000.0": 52833760.6, "6599000000.0": 52833834.6, "6600000000.0": 52833908.7, "6601000000.0": 52833982.7, "6602000000.0": 52834056.7, "6603000000.0": 52834130.7, "6604000000.0": 52834204.6, "6605000000.0": 52834278.6, "6606000000.0": 52834352.5, "6607000000.0": 52834426.4, "6608000000.0": 52834500.2, "6609000000.0": 52834574.1, "6610000000.0": 52834647.9, "6611000000.0": 52834721.7, "6612000000.0": 52834795.5, "6613000000.0": 52834869.2, "6614000000.0": 52834943.0, "6615000000.0": 52835016.7, "6616000000.0": 52835090.4, "6617000000.0": 52835164.1, "6618000000.0": 52835237.7, "6619000000.0": 52835311.3, "6620000000.0": 52835384.9, "6621000000.0": 52835458.5, "6622000000.0": 52835532.1, "6623000000.0": 52835605.6, "6624000000.0": 52835679.1, "6625000000.0": 52835752.6, "6626000000.0": 52835826.1, "6627000000.0": 52835899.5, "6628000000.0": 52835973.0, "6629000000.0": 52836046.4, "6630000000.0": 52836119.7, "6631000000.0": 52836193.1, "6632000000.0": 52836266.4, "6633000000.0": 52836339.8, "6634000000.0": 52836413.1, "6635000000.0": 52836486.3, "6636000000.0": 52836559.6, "6637000000.0": 52836632.8, "6638000000.0": 52836706.0, "6639000000.0": 52836779.2, "6640000000.0": 52836852.4, "6641000000.0": 52836925.5, "6642000000.0": 52836998.6, "6643000000.0": 52837071.7, "6644000000.0": 52837144.8, "6645000000.0": 52837217.9, "6646000000.0": 52837290.9, "6647000000.0": 52837363.9, "6648000000.0": 52837436.9, "6649000000.0": 52837509.9, "6650000000.0": 52837582.8, "6651000000.0": 52837655.7, "6652000000.0": 52837728.6, "6653000000.0": 52837801.5, "6654000000.0": 52837874.4, "6655000000.0": 52837947.2, "6656000000.0": 52838020.0, "6657000000.0": 52838092.8, "6658000000.0": 52838165.6, "6659000000.0": 52838238.4, "6660000000.0": 52838311.1, "6661000000.0": 52838383.8, "6662000000.0": 52838456.5, "6663000000.0": 52838529.1, "6664000000.0": 52838601.8, "6665000000.0": 52838674.4, "6666000000.0": 52838747.0, "6667000000.0": 52838819.6, "6668000000.0": 52838892.1, "6669000000.0": 52838964.7, "6670000000.0": 52839037.2, "6671000000.0": 52839109.7, "6672000000.0": 52839182.2, "6673000000.0": 52839254.6, "6674000000.0": 52839327.0, "6675000000.0": 52839399.4, "6676000000.0": 52839471.8, "6677000000.0": 52839544.2, "6678000000.0": 52839616.5, "6679000000.0": 52839688.8, "6680000000.0": 52839761.1, "6681000000.0": 52839833.4, "6682000000.0": 52839905.7, "6683000000.0": 52839977.9, "6684000000.0": 52840050.1, "6685000000.0": 52840122.3, "6686000000.0": 52840194.5, "6687000000.0": 52840266.6, "6688000000.0": 52840338.8, "6689000000.0": 52840410.9, "6690000000.0": 52840483.0, "6691000000.0": 52840555.0, "6692000000.0": 52840627.1, "6693000000.0": 52840699.1, "6694000000.0": 52840771.1, "6695000000.0": 52840843.1, "6696000000.0": 52840915.0, "6697000000.0": 52840987.0, "6698000000.0": 52841058.9, "6699000000.0": 52841130.8, "6700000000.0": 52841202.6, "6701000000.0": 52841274.5, "6702000000.0": 52841346.3, "6703000000.0": 52841418.1, "6704000000.0": 52841489.9, "6705000000.0": 52841561.7, "6706000000.0": 52841633.4, "6707000000.0": 52841705.1, "6708000000.0": 52841776.8, "6709000000.0": 52841848.5, "6710000000.0": 52841920.2, "6711000000.0": 52841991.8, "6712000000.0": 52842063.4, "6713000000.0": 52842135.0, "6714000000.0": 52842206.6, "6715000000.0": 52842278.2, "6716000000.0": 52842349.7, "6717000000.0": 52842421.2, "6718000000.0": 52842492.7, "6719000000.0": 52842564.2, "6720000000.0": 52842635.6, "6721000000.0": 52842707.0, "6722000000.0": 52842778.4, "6723000000.0": 52842849.8, "6724000000.0": 52842921.2, "6725000000.0": 52842992.5, "6726000000.0": 52843063.9, "6727000000.0": 52843135.2, "6728000000.0": 52843206.4, "6729000000.0": 52843277.7, "6730000000.0": 52843348.9, "6731000000.0": 52843420.2, "6732000000.0": 52843491.4, "6733000000.0": 52843562.5, "6734000000.0": 52843633.7, "6735000000.0": 52843704.8, "6736000000.0": 52843775.9, "6737000000.0": 52843847.0, "6738000000.0": 52843918.1, "6739000000.0": 52843989.1, "6740000000.0": 52844060.2, "6741000000.0": 52844131.2, "6742000000.0": 52844202.2, "6743000000.0": 52844273.1, "6744000000.0": 52844344.1, "6745000000.0": 52844415.0, "6746000000.0": 52844485.9, "6747000000.0": 52844556.8, "6748000000.0": 52844627.7, "6749000000.0": 52844698.5, "6750000000.0": 52844769.3, "6751000000.0": 52844840.1, "6752000000.0": 52844910.9, "6753000000.0": 52844981.7, "6754000000.0": 52845052.4, "6755000000.0": 52845123.1, "6756000000.0": 52845193.8, "6757000000.0": 52845264.5, "6758000000.0": 52845335.1, "6759000000.0": 52845405.8, "6760000000.0": 52845476.4, "6761000000.0": 52845547.0, "6762000000.0": 52845617.5, "6763000000.0": 52845688.1, "6764000000.0": 52845758.6, "6765000000.0": 52845829.1, "6766000000.0": 52845899.6, "6767000000.0": 52845970.1, "6768000000.0": 52846040.5, "6769000000.0": 52846111.0, "6770000000.0": 52846181.4, "6771000000.0": 52846251.8, "6772000000.0": 52846322.1, "6773000000.0": 52846392.5, "6774000000.0": 52846462.8, "6775000000.0": 52846533.1, "6776000000.0": 52846603.4, "6777000000.0": 52846673.6, "6778000000.0": 52846743.9, "6779000000.0": 52846814.1, "6780000000.0": 52846884.3, "6781000000.0": 52846954.5, "6782000000.0": 52847024.6, "6783000000.0": 52847094.8, "6784000000.0": 52847164.9, "6785000000.0": 52847235.0, "6786000000.0": 52847305.1, "6787000000.0": 52847375.1, "6788000000.0": 52847445.2, "6789000000.0": 52847515.2, "6790000000.0": 52847585.2, "6791000000.0": 52847655.2, "6792000000.0": 52847725.1, "6793000000.0": 52847795.1, "6794000000.0": 52847865.0, "6795000000.0": 52847934.9, "6796000000.0": 52848004.7, "6797000000.0": 52848074.6, "6798000000.0": 52848144.4, "6799000000.0": 52848214.2, "6800000000.0": 52848284.0, "6801000000.0": 52848353.8, "6802000000.0": 52848423.6, "6803000000.0": 52848493.3, "6804000000.0": 52848563.0, "6805000000.0": 52848632.7, "6806000000.0": 52848702.4, "6807000000.0": 52848772.0, "6808000000.0": 52848841.6, "6809000000.0": 52848911.2, "6810000000.0": 52848980.8, "6811000000.0": 52849050.4, "6812000000.0": 52849120.0, "6813000000.0": 52849189.5, "6814000000.0": 52849259.0, "6815000000.0": 52849328.5, "6816000000.0": 52849398.0, "6817000000.0": 52849467.4, "6818000000.0": 52849536.8, "6819000000.0": 52849606.2, "6820000000.0": 52849675.6, "6821000000.0": 52849745.0, "6822000000.0": 52849814.3, "6823000000.0": 52849883.7, "6824000000.0": 52849953.0, "6825000000.0": 52850022.3, "6826000000.0": 52850091.5, "6827000000.0": 52850160.8, "6828000000.0": 52850230.0, "6829000000.0": 52850299.2, "6830000000.0": 52850368.4, "6831000000.0": 52850437.6, "6832000000.0": 52850506.7, "6833000000.0": 52850575.8, "6834000000.0": 52850644.9, "6835000000.0": 52850714.0, "6836000000.0": 52850783.1, "6837000000.0": 52850852.1, "6838000000.0": 52850921.2, "6839000000.0": 52850990.2, "6840000000.0": 52851059.1, "6841000000.0": 52851128.1, "6842000000.0": 52851197.1, "6843000000.0": 52851266.0, "6844000000.0": 52851334.9, "6845000000.0": 52851403.8, "6846000000.0": 52851472.6, "6847000000.0": 52851541.5, "6848000000.0": 52851610.3, "6849000000.0": 52851679.1, "6850000000.0": 52851747.9, "6851000000.0": 52851816.7, "6852000000.0": 52851885.4, "6853000000.0": 52851954.1, "6854000000.0": 52852022.9, "6855000000.0": 52852091.5, "6856000000.0": 52852160.2, "6857000000.0": 52852228.9, "6858000000.0": 52852297.5, "6859000000.0": 52852366.1, "6860000000.0": 52852434.7, "6861000000.0": 52852503.2, "6862000000.0": 52852571.8, "6863000000.0": 52852640.3, "6864000000.0": 52852708.8, "6865000000.0": 52852777.3, "6866000000.0": 52852845.8, "6867000000.0": 52852914.2, "6868000000.0": 52852982.7, "6869000000.0": 52853051.1, "6870000000.0": 52853119.5, "6871000000.0": 52853187.8, "6872000000.0": 52853256.2, "6873000000.0": 52853324.5, "6874000000.0": 52853392.8, "6875000000.0": 52853461.1, "6876000000.0": 52853529.4, "6877000000.0": 52853597.6, "6878000000.0": 52853665.9, "6879000000.0": 52853734.1, "6880000000.0": 52853802.3, "6881000000.0": 52853870.5, "6882000000.0": 52853938.6, "6883000000.0": 52854006.7, "6884000000.0": 52854074.9, "6885000000.0": 52854143.0, "6886000000.0": 52854211.0, "6887000000.0": 52854279.1, "6888000000.0": 52854347.1, "6889000000.0": 52854415.1, "6890000000.0": 52854483.1, "6891000000.0": 52854551.1, "6892000000.0": 52854619.1, "6893000000.0": 52854687.0, "6894000000.0": 52854754.9, "6895000000.0": 52854822.8, "6896000000.0": 52854890.7, "6897000000.0": 52854958.6, "6898000000.0": 52855026.4, "6899000000.0": 52855094.2, "6900000000.0": 52855162.0, "6901000000.0": 52855229.8, "6902000000.0": 52855297.6, "6903000000.0": 52855365.3, "6904000000.0": 52855433.0, "6905000000.0": 52855500.8, "6906000000.0": 52855568.4, "6907000000.0": 52855636.1, "6908000000.0": 52855703.8, "6909000000.0": 52855771.4, "6910000000.0": 52855839.0, "6911000000.0": 52855906.6, "6912000000.0": 52855974.1, "6913000000.0": 52856041.7, "6914000000.0": 52856109.2, "6915000000.0": 52856176.7, "6916000000.0": 52856244.2, "6917000000.0": 52856311.7, "6918000000.0": 52856379.1, "6919000000.0": 52856446.6, "6920000000.0": 52856514.0, "6921000000.0": 52856581.4, "6922000000.0": 52856648.8, "6923000000.0": 52856716.1, "6924000000.0": 52856783.5, "6925000000.0": 52856850.8, "6926000000.0": 52856918.1, "6927000000.0": 52856985.4, "6928000000.0": 52857052.6, "6929000000.0": 52857119.9, "6930000000.0": 52857187.1, "6931000000.0": 52857254.3, "6932000000.0": 52857321.5, "6933000000.0": 52857388.6, "6934000000.0": 52857455.8, "6935000000.0": 52857522.9, "6936000000.0": 52857590.0, "6937000000.0": 52857657.1, "6938000000.0": 52857724.2, "6939000000.0": 52857791.2, "6940000000.0": 52857858.2, "6941000000.0": 52857925.2, "6942000000.0": 52857992.2, "6943000000.0": 52858059.2, "6944000000.0": 52858126.2, "6945000000.0": 52858193.1, "6946000000.0": 52858260.0, "6947000000.0": 52858326.9, "6948000000.0": 52858393.8, "6949000000.0": 52858460.6, "6950000000.0": 52858527.5, "6951000000.0": 52858594.3, "6952000000.0": 52858661.1, "6953000000.0": 52858727.9, "6954000000.0": 52858794.6, "6955000000.0": 52858861.4, "6956000000.0": 52858928.1, "6957000000.0": 52858994.8, "6958000000.0": 52859061.5, "6959000000.0": 52859128.2, "6960000000.0": 52859194.8, "6961000000.0": 52859261.4, "6962000000.0": 52859328.1, "6963000000.0": 52859394.7, "6964000000.0": 52859461.2, "6965000000.0": 52859527.8, "6966000000.0": 52859594.3, "6967000000.0": 52859660.8, "6968000000.0": 52859727.3, "6969000000.0": 52859793.8, "6970000000.0": 52859860.3, "6971000000.0": 52859926.7, "6972000000.0": 52859993.1, "6973000000.0": 52860059.5, "6974000000.0": 52860125.9, "6975000000.0": 52860192.3, "6976000000.0": 52860258.6, "6977000000.0": 52860324.9, "6978000000.0": 52860391.3, "6979000000.0": 52860457.5, "6980000000.0": 52860523.8, "6981000000.0": 52860590.1, "6982000000.0": 52860656.3, "6983000000.0": 52860722.5, "6984000000.0": 52860788.7, "6985000000.0": 52860854.9, "6986000000.0": 52860921.0, "6987000000.0": 52860987.2, "6988000000.0": 52861053.3, "6989000000.0": 52861119.4, "6990000000.0": 52861185.5, "6991000000.0": 52861251.5, "6992000000.0": 52861317.6, "6993000000.0": 52861383.6, "6994000000.0": 52861449.6, "6995000000.0": 52861515.6, "6996000000.0": 52861581.6, "6997000000.0": 52861647.5, "6998000000.0": 52861713.5, "6999000000.0": 52861779.4, "7000000000.0": 52861845.3, "7001000000.0": 52861911.2, "7002000000.0": 52861977.0, "7003000000.0": 52862042.9, "7004000000.0": 52862108.7, "7005000000.0": 52862174.5, "7006000000.0": 52862240.3, "7007000000.0": 52862306.0, "7008000000.0": 52862371.8, "7009000000.0": 52862437.5, "7010000000.0": 52862503.2, "7011000000.0": 52862568.9, "7012000000.0": 52862634.6, "7013000000.0": 52862700.2, "7014000000.0": 52862765.9, "7015000000.0": 52862831.5, "7016000000.0": 52862897.1, "7017000000.0": 52862962.7, "7018000000.0": 52863028.2, "7019000000.0": 52863093.8, "7020000000.0": 52863159.3, "7021000000.0": 52863224.8, "7022000000.0": 52863290.3, "7023000000.0": 52863355.7, "7024000000.0": 52863421.2, "7025000000.0": 52863486.6, "7026000000.0": 52863552.0, "7027000000.0": 52863617.4, "7028000000.0": 52863682.8, "7029000000.0": 52863748.2, "7030000000.0": 52863813.5, "7031000000.0": 52863878.8, "7032000000.0": 52863944.1, "7033000000.0": 52864009.4, "7034000000.0": 52864074.7, "7035000000.0": 52864139.9, "7036000000.0": 52864205.2, "7037000000.0": 52864270.4, "7038000000.0": 52864335.6, "7039000000.0": 52864400.7, "7040000000.0": 52864465.9, "7041000000.0": 52864531.0, "7042000000.0": 52864596.1, "7043000000.0": 52864661.2, "7044000000.0": 52864726.3, "7045000000.0": 52864791.4, "7046000000.0": 52864856.4, "7047000000.0": 52864921.5, "7048000000.0": 52864986.5, "7049000000.0": 52865051.5, "7050000000.0": 52865116.4, "7051000000.0": 52865181.4, "7052000000.0": 52865246.3, "7053000000.0": 52865311.2, "7054000000.0": 52865376.1, "7055000000.0": 52865441.0, "7056000000.0": 52865505.9, "7057000000.0": 52865570.7, "7058000000.0": 52865635.6, "7059000000.0": 52865700.4, "7060000000.0": 52865765.2, "7061000000.0": 52865829.9, "7062000000.0": 52865894.7, "7063000000.0": 52865959.4, "7064000000.0": 52866024.1, "7065000000.0": 52866088.8, "7066000000.0": 52866153.5, "7067000000.0": 52866218.2, "7068000000.0": 52866282.8, "7069000000.0": 52866347.4, "7070000000.0": 52866412.1, "7071000000.0": 52866476.6, "7072000000.0": 52866541.2, "7073000000.0": 52866605.8, "7074000000.0": 52866670.3, "7075000000.0": 52866734.8, "7076000000.0": 52866799.3, "7077000000.0": 52866863.8, "7078000000.0": 52866928.3, "7079000000.0": 52866992.7, "7080000000.0": 52867057.1, "7081000000.0": 52867121.6, "7082000000.0": 52867185.9, "7083000000.0": 52867250.3, "7084000000.0": 52867314.7, "7085000000.0": 52867379.0, "7086000000.0": 52867443.3, "7087000000.0": 52867507.6, "7088000000.0": 52867571.9, "7089000000.0": 52867636.2, "7090000000.0": 52867700.4, "7091000000.0": 52867764.7, "7092000000.0": 52867828.9, "7093000000.0": 52867893.1, "7094000000.0": 52867957.2, "7095000000.0": 52868021.4, "7096000000.0": 52868085.5, "7097000000.0": 52868149.7, "7098000000.0": 52868213.8, "7099000000.0": 52868277.9, "7100000000.0": 52868341.9, "7101000000.0": 52868406.0, "7102000000.0": 52868470.0, "7103000000.0": 52868534.0, "7104000000.0": 52868598.0, "7105000000.0": 52868662.0, "7106000000.0": 52868726.0, "7107000000.0": 52868789.9, "7108000000.0": 52868853.8, "7109000000.0": 52868917.7, "7110000000.0": 52868981.6, "7111000000.0": 52869045.5, "7112000000.0": 52869109.4, "7113000000.0": 52869173.2, "7114000000.0": 52869237.0, "7115000000.0": 52869300.8, "7116000000.0": 52869364.6, "7117000000.0": 52869428.4, "7118000000.0": 52869492.1, "7119000000.0": 52869555.8, "7120000000.0": 52869619.5, "7121000000.0": 52869683.2, "7122000000.0": 52869746.9, "7123000000.0": 52869810.6, "7124000000.0": 52869874.2, "7125000000.0": 52869937.8, "7126000000.0": 52870001.4, "7127000000.0": 52870065.0, "7128000000.0": 52870128.6, "7129000000.0": 52870192.2, "7130000000.0": 52870255.7, "7131000000.0": 52870319.2, "7132000000.0": 52870382.7, "7133000000.0": 52870446.2, "7134000000.0": 52870509.7, "7135000000.0": 52870573.1, "7136000000.0": 52870636.5, "7137000000.0": 52870699.9, "7138000000.0": 52870763.3, "7139000000.0": 52870826.7, "7140000000.0": 52870890.1, "7141000000.0": 52870953.4, "7142000000.0": 52871016.7, "7143000000.0": 52871080.0, "7144000000.0": 52871143.3, "7145000000.0": 52871206.6, "7146000000.0": 52871269.9, "7147000000.0": 52871333.1, "7148000000.0": 52871396.3, "7149000000.0": 52871459.5, "7150000000.0": 52871522.7, "7151000000.0": 52871585.9, "7152000000.0": 52871649.0, "7153000000.0": 52871712.1, "7154000000.0": 52871775.3, "7155000000.0": 52871838.3, "7156000000.0": 52871901.4, "7157000000.0": 52871964.5, "7158000000.0": 52872027.5, "7159000000.0": 52872090.6, "7160000000.0": 52872153.6, "7161000000.0": 52872216.6, "7162000000.0": 52872279.5, "7163000000.0": 52872342.5, "7164000000.0": 52872405.4, "7165000000.0": 52872468.3, "7166000000.0": 52872531.2, "7167000000.0": 52872594.1, "7168000000.0": 52872657.0, "7169000000.0": 52872719.9, "7170000000.0": 52872782.7, "7171000000.0": 52872845.5, "7172000000.0": 52872908.3, "7173000000.0": 52872971.1, "7174000000.0": 52873033.9, "7175000000.0": 52873096.6, "7176000000.0": 52873159.3, "7177000000.0": 52873222.0, "7178000000.0": 52873284.7, "7179000000.0": 52873347.4, "7180000000.0": 52873410.1, "7181000000.0": 52873472.7, "7182000000.0": 52873535.3, "7183000000.0": 52873598.0, "7184000000.0": 52873660.5, "7185000000.0": 52873723.1, "7186000000.0": 52873785.7, "7187000000.0": 52873848.2, "7188000000.0": 52873910.7, "7189000000.0": 52873973.2, "7190000000.0": 52874035.7, "7191000000.0": 52874098.2, "7192000000.0": 52874160.7, "7193000000.0": 52874223.1, "7194000000.0": 52874285.5, "7195000000.0": 52874347.9, "7196000000.0": 52874410.3, "7197000000.0": 52874472.7, "7198000000.0": 52874535.0, "7199000000.0": 52874597.4, "7200000000.0": 52874659.7, "7201000000.0": 52874722.0, "7202000000.0": 52874784.3, "7203000000.0": 52874846.5, "7204000000.0": 52874908.8, "7205000000.0": 52874971.0, "7206000000.0": 52875033.2, "7207000000.0": 52875095.4, "7208000000.0": 52875157.6, "7209000000.0": 52875219.7, "7210000000.0": 52875281.9, "7211000000.0": 52875344.0, "7212000000.0": 52875406.1, "7213000000.0": 52875468.2, "7214000000.0": 52875530.3, "7215000000.0": 52875592.4, "7216000000.0": 52875654.4, "7217000000.0": 52875716.4, "7218000000.0": 52875778.4, "7219000000.0": 52875840.4, "7220000000.0": 52875902.4, "7221000000.0": 52875964.4, "7222000000.0": 52876026.3, "7223000000.0": 52876088.2, "7224000000.0": 52876150.1, "7225000000.0": 52876212.0, "7226000000.0": 52876273.9, "7227000000.0": 52876335.7, "7228000000.0": 52876397.6, "7229000000.0": 52876459.4, "7230000000.0": 52876521.2, "7231000000.0": 52876583.0, "7232000000.0": 52876644.8, "7233000000.0": 52876706.5, "7234000000.0": 52876768.3, "7235000000.0": 52876830.0, "7236000000.0": 52876891.7, "7237000000.0": 52876953.4, "7238000000.0": 52877015.0, "7239000000.0": 52877076.7, "7240000000.0": 52877138.3, "7241000000.0": 52877199.9, "7242000000.0": 52877261.5, "7243000000.0": 52877323.1, "7244000000.0": 52877384.7, "7245000000.0": 52877446.3, "7246000000.0": 52877507.8, "7247000000.0": 52877569.3, "7248000000.0": 52877630.8, "7249000000.0": 52877692.3, "7250000000.0": 52877753.8, "7251000000.0": 52877815.2, "7252000000.0": 52877876.6, "7253000000.0": 52877938.1, "7254000000.0": 52877999.5, "7255000000.0": 52878060.8, "7256000000.0": 52878122.2, "7257000000.0": 52878183.6, "7258000000.0": 52878244.9, "7259000000.0": 52878306.2, "7260000000.0": 52878367.5, "7261000000.0": 52878428.8, "7262000000.0": 52878490.1, "7263000000.0": 52878551.3, "7264000000.0": 52878612.5, "7265000000.0": 52878673.7, "7266000000.0": 52878734.9, "7267000000.0": 52878796.1, "7268000000.0": 52878857.3, "7269000000.0": 52878918.4, "7270000000.0": 52878979.6, "7271000000.0": 52879040.7, "7272000000.0": 52879101.8, "7273000000.0": 52879162.9, "7274000000.0": 52879223.9, "7275000000.0": 52879285.0, "7276000000.0": 52879346.0, "7277000000.0": 52879407.0, "7278000000.0": 52879468.0, "7279000000.0": 52879529.0, "7280000000.0": 52879590.0, "7281000000.0": 52879650.9, "7282000000.0": 52879711.9, "7283000000.0": 52879772.8, "7284000000.0": 52879833.7, "7285000000.0": 52879894.6, "7286000000.0": 52879955.4, "7287000000.0": 52880016.3, "7288000000.0": 52880077.1, "7289000000.0": 52880137.9, "7290000000.0": 52880198.7, "7291000000.0": 52880259.5, "7292000000.0": 52880320.3, "7293000000.0": 52880381.0, "7294000000.0": 52880441.8, "7295000000.0": 52880502.5, "7296000000.0": 52880563.2, "7297000000.0": 52880623.9, "7298000000.0": 52880684.5, "7299000000.0": 52880745.2, "7300000000.0": 52880805.8, "7301000000.0": 52880866.4, "7302000000.0": 52880927.0, "7303000000.0": 52880987.6, "7304000000.0": 52881048.2, "7305000000.0": 52881108.7, "7306000000.0": 52881169.3, "7307000000.0": 52881229.8, "7308000000.0": 52881290.3, "7309000000.0": 52881350.8, "7310000000.0": 52881411.3, "7311000000.0": 52881471.7, "7312000000.0": 52881532.2, "7313000000.0": 52881592.6, "7314000000.0": 52881653.0, "7315000000.0": 52881713.4, "7316000000.0": 52881773.7, "7317000000.0": 52881834.1, "7318000000.0": 52881894.4, "7319000000.0": 52881954.8, "7320000000.0": 52882015.1, "7321000000.0": 52882075.4, "7322000000.0": 52882135.6, "7323000000.0": 52882195.9, "7324000000.0": 52882256.1, "7325000000.0": 52882316.4, "7326000000.0": 52882376.6, "7327000000.0": 52882436.8, "7328000000.0": 52882496.9, "7329000000.0": 52882557.1, "7330000000.0": 52882617.2, "7331000000.0": 52882677.4, "7332000000.0": 52882737.5, "7333000000.0": 52882797.6, "7334000000.0": 52882857.7, "7335000000.0": 52882917.7, "7336000000.0": 52882977.8, "7337000000.0": 52883037.8, "7338000000.0": 52883097.8, "7339000000.0": 52883157.8, "7340000000.0": 52883217.8, "7341000000.0": 52883277.7, "7342000000.0": 52883337.7, "7343000000.0": 52883397.6, "7344000000.0": 52883457.5, "7345000000.0": 52883517.4, "7346000000.0": 52883577.3, "7347000000.0": 52883637.2, "7348000000.0": 52883697.1, "7349000000.0": 52883756.9, "7350000000.0": 52883816.7, "7351000000.0": 52883876.5, "7352000000.0": 52883936.3, "7353000000.0": 52883996.1, "7354000000.0": 52884055.8, "7355000000.0": 52884115.6, "7356000000.0": 52884175.3, "7357000000.0": 52884235.0, "7358000000.0": 52884294.7, "7359000000.0": 52884354.4, "7360000000.0": 52884414.0, "7361000000.0": 52884473.7, "7362000000.0": 52884533.3, "7363000000.0": 52884592.9, "7364000000.0": 52884652.5, "7365000000.0": 52884712.1, "7366000000.0": 52884771.6, "7367000000.0": 52884831.2, "7368000000.0": 52884890.7, "7369000000.0": 52884950.2, "7370000000.0": 52885009.7, "7371000000.0": 52885069.2, "7372000000.0": 52885128.7, "7373000000.0": 52885188.1, "7374000000.0": 52885247.6, "7375000000.0": 52885307.0, "7376000000.0": 52885366.4, "7377000000.0": 52885425.8, "7378000000.0": 52885485.1, "7379000000.0": 52885544.5, "7380000000.0": 52885603.8, "7381000000.0": 52885663.1, "7382000000.0": 52885722.5, "7383000000.0": 52885781.7, "7384000000.0": 52885841.0, "7385000000.0": 52885900.3, "7386000000.0": 52885959.5, "7387000000.0": 52886018.7, "7388000000.0": 52886078.0, "7389000000.0": 52886137.2, "7390000000.0": 52886196.3, "7391000000.0": 52886255.5, "7392000000.0": 52886314.6, "7393000000.0": 52886373.8, "7394000000.0": 52886432.9, "7395000000.0": 52886492.0, "7396000000.0": 52886551.1, "7397000000.0": 52886610.1, "7398000000.0": 52886669.2, "7399000000.0": 52886728.2, "7400000000.0": 52886787.3, "7401000000.0": 52886846.3, "7402000000.0": 52886905.3, "7403000000.0": 52886964.2, "7404000000.0": 52887023.2, "7405000000.0": 52887082.1, "7406000000.0": 52887141.0, "7407000000.0": 52887200.0, "7408000000.0": 52887258.9, "7409000000.0": 52887317.7, "7410000000.0": 52887376.6, "7411000000.0": 52887435.4, "7412000000.0": 52887494.3, "7413000000.0": 52887553.1, "7414000000.0": 52887611.9, "7415000000.0": 52887670.7, "7416000000.0": 52887729.4, "7417000000.0": 52887788.2, "7418000000.0": 52887846.9, "7419000000.0": 52887905.7, "7420000000.0": 52887964.4, "7421000000.0": 52888023.0, "7422000000.0": 52888081.7, "7423000000.0": 52888140.4, "7424000000.0": 52888199.0, "7425000000.0": 52888257.7, "7426000000.0": 52888316.3, "7427000000.0": 52888374.9, "7428000000.0": 52888433.4, "7429000000.0": 52888492.0, "7430000000.0": 52888550.6, "7431000000.0": 52888609.1, "7432000000.0": 52888667.6, "7433000000.0": 52888726.1, "7434000000.0": 52888784.6, "7435000000.0": 52888843.1, "7436000000.0": 52888901.5, "7437000000.0": 52888960.0, "7438000000.0": 52889018.4, "7439000000.0": 52889076.8, "7440000000.0": 52889135.2, "7441000000.0": 52889193.6, "7442000000.0": 52889251.9, "7443000000.0": 52889310.3, "7444000000.0": 52889368.6, "7445000000.0": 52889426.9, "7446000000.0": 52889485.2, "7447000000.0": 52889543.5, "7448000000.0": 52889601.8, "7449000000.0": 52889660.0, "7450000000.0": 52889718.3, "7451000000.0": 52889776.5, "7452000000.0": 52889834.7, "7453000000.0": 52889892.9, "7454000000.0": 52889951.1, "7455000000.0": 52890009.2, "7456000000.0": 52890067.4, "7457000000.0": 52890125.5, "7458000000.0": 52890183.6, "7459000000.0": 52890241.7, "7460000000.0": 52890299.8, "7461000000.0": 52890357.9, "7462000000.0": 52890415.9, "7463000000.0": 52890473.9, "7464000000.0": 52890532.0, "7465000000.0": 52890590.0, "7466000000.0": 52890648.0, "7467000000.0": 52890705.9, "7468000000.0": 52890763.9, "7469000000.0": 52890821.8, "7470000000.0": 52890879.8, "7471000000.0": 52890937.7, "7472000000.0": 52890995.6, "7473000000.0": 52891053.5, "7474000000.0": 52891111.3, "7475000000.0": 52891169.2, "7476000000.0": 52891227.0, "7477000000.0": 52891284.8, "7478000000.0": 52891342.7, "7479000000.0": 52891400.4, "7480000000.0": 52891458.2, "7481000000.0": 52891516.0, "7482000000.0": 52891573.7, "7483000000.0": 52891631.5, "7484000000.0": 52891689.2, "7485000000.0": 52891746.9, "7486000000.0": 52891804.6, "7487000000.0": 52891862.2, "7488000000.0": 52891919.9, "7489000000.0": 52891977.5, "7490000000.0": 52892035.1, "7491000000.0": 52892092.7, "7492000000.0": 52892150.3, "7493000000.0": 52892207.9, "7494000000.0": 52892265.5, "7495000000.0": 52892323.0, "7496000000.0": 52892380.5, "7497000000.0": 52892438.1, "7498000000.0": 52892495.6, "7499000000.0": 52892553.0, "7500000000.0": 52892610.5, "7501000000.0": 52892668.0, "7502000000.0": 52892725.4, "7503000000.0": 52892782.8, "7504000000.0": 52892840.2, "7505000000.0": 52892897.6, "7506000000.0": 52892955.0, "7507000000.0": 52893012.4, "7508000000.0": 52893069.7, "7509000000.0": 52893127.1, "7510000000.0": 52893184.4, "7511000000.0": 52893241.7, "7512000000.0": 52893299.0, "7513000000.0": 52893356.3, "7514000000.0": 52893413.5, "7515000000.0": 52893470.8, "7516000000.0": 52893528.0, "7517000000.0": 52893585.2, "7518000000.0": 52893642.4, "7519000000.0": 52893699.6, "7520000000.0": 52893756.7, "7521000000.0": 52893813.9, "7522000000.0": 52893871.0, "7523000000.0": 52893928.2, "7524000000.0": 52893985.3, "7525000000.0": 52894042.4, "7526000000.0": 52894099.4, "7527000000.0": 52894156.5, "7528000000.0": 52894213.5, "7529000000.0": 52894270.6, "7530000000.0": 52894327.6, "7531000000.0": 52894384.6, "7532000000.0": 52894441.6, "7533000000.0": 52894498.6, "7534000000.0": 52894555.5, "7535000000.0": 52894612.4, "7536000000.0": 52894669.4, "7537000000.0": 52894726.3, "7538000000.0": 52894783.2, "7539000000.0": 52894840.1, "7540000000.0": 52894896.9, "7541000000.0": 52894953.8, "7542000000.0": 52895010.6, "7543000000.0": 52895067.4, "7544000000.0": 52895124.3, "7545000000.0": 52895181.0, "7546000000.0": 52895237.8, "7547000000.0": 52895294.6, "7548000000.0": 52895351.3, "7549000000.0": 52895408.1, "7550000000.0": 52895464.8, "7551000000.0": 52895521.5, "7552000000.0": 52895578.2, "7553000000.0": 52895634.8, "7554000000.0": 52895691.5, "7555000000.0": 52895748.2, "7556000000.0": 52895804.8, "7557000000.0": 52895861.4, "7558000000.0": 52895918.0, "7559000000.0": 52895974.6, "7560000000.0": 52896031.1, "7561000000.0": 52896087.7, "7562000000.0": 52896144.2, "7563000000.0": 52896200.8, "7564000000.0": 52896257.3, "7565000000.0": 52896313.8, "7566000000.0": 52896370.2, "7567000000.0": 52896426.7, "7568000000.0": 52896483.2, "7569000000.0": 52896539.6, "7570000000.0": 52896596.0, "7571000000.0": 52896652.4, "7572000000.0": 52896708.8, "7573000000.0": 52896765.2, "7574000000.0": 52896821.6, "7575000000.0": 52896877.9, "7576000000.0": 52896934.2, "7577000000.0": 52896990.6, "7578000000.0": 52897046.9, "7579000000.0": 52897103.1, "7580000000.0": 52897159.4, "7581000000.0": 52897215.7, "7582000000.0": 52897271.9, "7583000000.0": 52897328.2, "7584000000.0": 52897384.4, "7585000000.0": 52897440.6, "7586000000.0": 52897496.7, "7587000000.0": 52897552.9, "7588000000.0": 52897609.1, "7589000000.0": 52897665.2, "7590000000.0": 52897721.3, "7591000000.0": 52897777.5, "7592000000.0": 52897833.6, "7593000000.0": 52897889.6, "7594000000.0": 52897945.7, "7595000000.0": 52898001.8, "7596000000.0": 52898057.8, "7597000000.0": 52898113.8, "7598000000.0": 52898169.8, "7599000000.0": 52898225.8, "7600000000.0": 52898281.8, "7601000000.0": 52898337.8, "7602000000.0": 52898393.7, "7603000000.0": 52898449.7, "7604000000.0": 52898505.6, "7605000000.0": 52898561.5, "7606000000.0": 52898617.4, "7607000000.0": 52898673.3, "7608000000.0": 52898729.1, "7609000000.0": 52898785.0, "7610000000.0": 52898840.8, "7611000000.0": 52898896.6, "7612000000.0": 52898952.4, "7613000000.0": 52899008.2, "7614000000.0": 52899064.0, "7615000000.0": 52899119.8, "7616000000.0": 52899175.5, "7617000000.0": 52899231.2, "7618000000.0": 52899287.0, "7619000000.0": 52899342.7, "7620000000.0": 52899398.3, "7621000000.0": 52899454.0, "7622000000.0": 52899509.7, "7623000000.0": 52899565.3, "7624000000.0": 52899621.0, "7625000000.0": 52899676.6, "7626000000.0": 52899732.2, "7627000000.0": 52899787.8, "7628000000.0": 52899843.3, "7629000000.0": 52899898.9, "7630000000.0": 52899954.4, "7631000000.0": 52900010.0, "7632000000.0": 52900065.5, "7633000000.0": 52900121.0, "7634000000.0": 52900176.5, "7635000000.0": 52900231.9, "7636000000.0": 52900287.4, "7637000000.0": 52900342.8, "7638000000.0": 52900398.3, "7639000000.0": 52900453.7, "7640000000.0": 52900509.1, "7641000000.0": 52900564.5, "7642000000.0": 52900619.8, "7643000000.0": 52900675.2, "7644000000.0": 52900730.5, "7645000000.0": 52900785.9, "7646000000.0": 52900841.2, "7647000000.0": 52900896.5, "7648000000.0": 52900951.8, "7649000000.0": 52901007.0, "7650000000.0": 52901062.3, "7651000000.0": 52901117.5, "7652000000.0": 52901172.8, "7653000000.0": 52901228.0, "7654000000.0": 52901283.2, "7655000000.0": 52901338.4, "7656000000.0": 52901393.5, "7657000000.0": 52901448.7, "7658000000.0": 52901503.8, "7659000000.0": 52901559.0, "7660000000.0": 52901614.1, "7661000000.0": 52901669.2, "7662000000.0": 52901724.3, "7663000000.0": 52901779.3, "7664000000.0": 52901834.4, "7665000000.0": 52901889.4, "7666000000.0": 52901944.5, "7667000000.0": 52901999.5, "7668000000.0": 52902054.5, "7669000000.0": 52902109.5, "7670000000.0": 52902164.4, "7671000000.0": 52902219.4, "7672000000.0": 52902274.3, "7673000000.0": 52902329.3, "7674000000.0": 52902384.2, "7675000000.0": 52902439.1, "7676000000.0": 52902494.0, "7677000000.0": 52902548.8, "7678000000.0": 52902603.7, "7679000000.0": 52902658.5, "7680000000.0": 52902713.4, "7681000000.0": 52902768.2, "7682000000.0": 52902823.0, "7683000000.0": 52902877.8, "7684000000.0": 52902932.5, "7685000000.0": 52902987.3, "7686000000.0": 52903042.0, "7687000000.0": 52903096.8, "7688000000.0": 52903151.5, "7689000000.0": 52903206.2, "7690000000.0": 52903260.9, "7691000000.0": 52903315.5, "7692000000.0": 52903370.2, "7693000000.0": 52903424.9, "7694000000.0": 52903479.5, "7695000000.0": 52903534.1, "7696000000.0": 52903588.7, "7697000000.0": 52903643.3, "7698000000.0": 52903697.9, "7699000000.0": 52903752.4, "7700000000.0": 52903807.0, "7701000000.0": 52903861.5, "7702000000.0": 52903916.0, "7703000000.0": 52903970.5, "7704000000.0": 52904025.0, "7705000000.0": 52904079.5, "7706000000.0": 52904134.0, "7707000000.0": 52904188.4, "7708000000.0": 52904242.8, "7709000000.0": 52904297.3, "7710000000.0": 52904351.7, "7711000000.0": 52904406.1, "7712000000.0": 52904460.4, "7713000000.0": 52904514.8, "7714000000.0": 52904569.2, "7715000000.0": 52904623.5, "7716000000.0": 52904677.8, "7717000000.0": 52904732.1, "7718000000.0": 52904786.4, "7719000000.0": 52904840.7, "7720000000.0": 52904895.0, "7721000000.0": 52904949.2, "7722000000.0": 52905003.5, "7723000000.0": 52905057.7, "7724000000.0": 52905111.9, "7725000000.0": 52905166.1, "7726000000.0": 52905220.3, "7727000000.0": 52905274.5, "7728000000.0": 52905328.6, "7729000000.0": 52905382.8, "7730000000.0": 52905436.9, "7731000000.0": 52905491.0, "7732000000.0": 52905545.1, "7733000000.0": 52905599.2, "7734000000.0": 52905653.3, "7735000000.0": 52905707.3, "7736000000.0": 52905761.4, "7737000000.0": 52905815.4, "7738000000.0": 52905869.4, "7739000000.0": 52905923.4, "7740000000.0": 52905977.4, "7741000000.0": 52906031.4, "7742000000.0": 52906085.3, "7743000000.0": 52906139.3, "7744000000.0": 52906193.2, "7745000000.0": 52906247.1, "7746000000.0": 52906301.0, "7747000000.0": 52906354.9, "7748000000.0": 52906408.8, "7749000000.0": 52906462.7, "7750000000.0": 52906516.5, "7751000000.0": 52906570.4, "7752000000.0": 52906624.2, "7753000000.0": 52906678.0, "7754000000.0": 52906731.8, "7755000000.0": 52906785.6, "7756000000.0": 52906839.3, "7757000000.0": 52906893.1, "7758000000.0": 52906946.8, "7759000000.0": 52907000.6, "7760000000.0": 52907054.3, "7761000000.0": 52907108.0, "7762000000.0": 52907161.7, "7763000000.0": 52907215.3, "7764000000.0": 52907269.0, "7765000000.0": 52907322.6, "7766000000.0": 52907376.3, "7767000000.0": 52907429.9, "7768000000.0": 52907483.5, "7769000000.0": 52907537.1, "7770000000.0": 52907590.7, "7771000000.0": 52907644.2, "7772000000.0": 52907697.8, "7773000000.0": 52907751.3, "7774000000.0": 52907804.8, "7775000000.0": 52907858.3, "7776000000.0": 52907911.8, "7777000000.0": 52907965.3, "7778000000.0": 52908018.8, "7779000000.0": 52908072.2, "7780000000.0": 52908125.7, "7781000000.0": 52908179.1, "7782000000.0": 52908232.5, "7783000000.0": 52908285.9, "7784000000.0": 52908339.3, "7785000000.0": 52908392.7, "7786000000.0": 52908446.0, "7787000000.0": 52908499.4, "7788000000.0": 52908552.7, "7789000000.0": 52908606.0, "7790000000.0": 52908659.3, "7791000000.0": 52908712.6, "7792000000.0": 52908765.9, "7793000000.0": 52908819.2, "7794000000.0": 52908872.4, "7795000000.0": 52908925.6, "7796000000.0": 52908978.9, "7797000000.0": 52909032.1, "7798000000.0": 52909085.3, "7799000000.0": 52909138.4, "7800000000.0": 52909191.6, "7801000000.0": 52909244.8, "7802000000.0": 52909297.9, "7803000000.0": 52909351.0, "7804000000.0": 52909404.2, "7805000000.0": 52909457.3, "7806000000.0": 52909510.3, "7807000000.0": 52909563.4, "7808000000.0": 52909616.5, "7809000000.0": 52909669.5, "7810000000.0": 52909722.6, "7811000000.0": 52909775.6, "7812000000.0": 52909828.6, "7813000000.0": 52909881.6, "7814000000.0": 52909934.6, "7815000000.0": 52909987.5, "7816000000.0": 52910040.5, "7817000000.0": 52910093.4, "7818000000.0": 52910146.3, "7819000000.0": 52910199.3, "7820000000.0": 52910252.2, "7821000000.0": 52910305.0, "7822000000.0": 52910357.9, "7823000000.0": 52910410.8, "7824000000.0": 52910463.6, "7825000000.0": 52910516.4, "7826000000.0": 52910569.3, "7827000000.0": 52910622.1, "7828000000.0": 52910674.9, "7829000000.0": 52910727.6, "7830000000.0": 52910780.4, "7831000000.0": 52910833.2, "7832000000.0": 52910885.9, "7833000000.0": 52910938.6, "7834000000.0": 52910991.3, "7835000000.0": 52911044.0, "7836000000.0": 52911096.7, "7837000000.0": 52911149.4, "7838000000.0": 52911202.0, "7839000000.0": 52911254.7, "7840000000.0": 52911307.3, "7841000000.0": 52911359.9, "7842000000.0": 52911412.5, "7843000000.0": 52911465.1, "7844000000.0": 52911517.7, "7845000000.0": 52911570.3, "7846000000.0": 52911622.8, "7847000000.0": 52911675.4, "7848000000.0": 52911727.9, "7849000000.0": 52911780.4, "7850000000.0": 52911832.9, "7851000000.0": 52911885.4, "7852000000.0": 52911937.9, "7853000000.0": 52911990.3, "7854000000.0": 52912042.8, "7855000000.0": 52912095.2, "7856000000.0": 52912147.6, "7857000000.0": 52912200.0, "7858000000.0": 52912252.4, "7859000000.0": 52912304.8, "7860000000.0": 52912357.2, "7861000000.0": 52912409.5, "7862000000.0": 52912461.9, "7863000000.0": 52912514.2, "7864000000.0": 52912566.5, "7865000000.0": 52912618.8, "7866000000.0": 52912671.1, "7867000000.0": 52912723.4, "7868000000.0": 52912775.6, "7869000000.0": 52912827.9, "7870000000.0": 52912880.1, "7871000000.0": 52912932.3, "7872000000.0": 52912984.5, "7873000000.0": 52913036.7, "7874000000.0": 52913088.9, "7875000000.0": 52913141.1, "7876000000.0": 52913193.2, "7877000000.0": 52913245.4, "7878000000.0": 52913297.5, "7879000000.0": 52913349.6, "7880000000.0": 52913401.7, "7881000000.0": 52913453.8, "7882000000.0": 52913505.9, "7883000000.0": 52913557.9, "7884000000.0": 52913610.0, "7885000000.0": 52913662.0, "7886000000.0": 52913714.1, "7887000000.0": 52913766.1, "7888000000.0": 52913818.1, "7889000000.0": 52913870.0, "7890000000.0": 52913922.0, "7891000000.0": 52913974.0, "7892000000.0": 52914025.9, "7893000000.0": 52914077.9, "7894000000.0": 52914129.8, "7895000000.0": 52914181.7, "7896000000.0": 52914233.6, "7897000000.0": 52914285.5, "7898000000.0": 52914337.3, "7899000000.0": 52914389.2, "7900000000.0": 52914441.0, "7901000000.0": 52914492.8, "7902000000.0": 52914544.7, "7903000000.0": 52914596.5, "7904000000.0": 52914648.3, "7905000000.0": 52914700.0, "7906000000.0": 52914751.8, "7907000000.0": 52914803.5, "7908000000.0": 52914855.3, "7909000000.0": 52914907.0, "7910000000.0": 52914958.7, "7911000000.0": 52915010.4, "7912000000.0": 52915062.1, "7913000000.0": 52915113.8, "7914000000.0": 52915165.4, "7915000000.0": 52915217.1, "7916000000.0": 52915268.7, "7917000000.0": 52915320.3, "7918000000.0": 52915371.9, "7919000000.0": 52915423.5, "7920000000.0": 52915475.1, "7921000000.0": 52915526.7, "7922000000.0": 52915578.2, "7923000000.0": 52915629.8, "7924000000.0": 52915681.3, "7925000000.0": 52915732.8, "7926000000.0": 52915784.3, "7927000000.0": 52915835.8, "7928000000.0": 52915887.3, "7929000000.0": 52915938.8, "7930000000.0": 52915990.2, "7931000000.0": 52916041.7, "7932000000.0": 52916093.1, "7933000000.0": 52916144.5, "7934000000.0": 52916195.9, "7935000000.0": 52916247.3, "7936000000.0": 52916298.7, "7937000000.0": 52916350.0, "7938000000.0": 52916401.4, "7939000000.0": 52916452.7, "7940000000.0": 52916504.0, "7941000000.0": 52916555.4, "7942000000.0": 52916606.7, "7943000000.0": 52916657.9, "7944000000.0": 52916709.2, "7945000000.0": 52916760.5, "7946000000.0": 52916811.7, "7947000000.0": 52916863.0, "7948000000.0": 52916914.2, "7949000000.0": 52916965.4, "7950000000.0": 52917016.6, "7951000000.0": 52917067.8, "7952000000.0": 52917118.9, "7953000000.0": 52917170.1, "7954000000.0": 52917221.2, "7955000000.0": 52917272.4, "7956000000.0": 52917323.5, "7957000000.0": 52917374.6, "7958000000.0": 52917425.7, "7959000000.0": 52917476.8, "7960000000.0": 52917527.8, "7961000000.0": 52917578.9, "7962000000.0": 52917629.9, "7963000000.0": 52917681.0, "7964000000.0": 52917732.0, "7965000000.0": 52917783.0, "7966000000.0": 52917834.0, "7967000000.0": 52917885.0, "7968000000.0": 52917935.9, "7969000000.0": 52917986.9, "7970000000.0": 52918037.8, "7971000000.0": 52918088.8, "7972000000.0": 52918139.7, "7973000000.0": 52918190.6, "7974000000.0": 52918241.5, "7975000000.0": 52918292.4, "7976000000.0": 52918343.2, "7977000000.0": 52918394.1, "7978000000.0": 52918444.9, "7979000000.0": 52918495.7, "7980000000.0": 52918546.6, "7981000000.0": 52918597.4, "7982000000.0": 52918648.2, "7983000000.0": 52918698.9, "7984000000.0": 52918749.7, "7985000000.0": 52918800.4, "7986000000.0": 52918851.2, "7987000000.0": 52918901.9, "7988000000.0": 52918952.6, "7989000000.0": 52919003.3, "7990000000.0": 52919054.0, "7991000000.0": 52919104.7, "7992000000.0": 52919155.4, "7993000000.0": 52919206.0, "7994000000.0": 52919256.6, "7995000000.0": 52919307.3, "7996000000.0": 52919357.9, "7997000000.0": 52919408.5, "7998000000.0": 52919459.1, "7999000000.0": 52919509.6, "8000000000.0": 52919560.2, "8001000000.0": 52919610.8, "8002000000.0": 52919661.3, "8003000000.0": 52919711.8, "8004000000.0": 52919762.3, "8005000000.0": 52919812.8, "8006000000.0": 52919863.3, "8007000000.0": 52919913.8, "8008000000.0": 52919964.3, "8009000000.0": 52920014.7, "8010000000.0": 52920065.2, "8011000000.0": 52920115.6, "8012000000.0": 52920166.0, "8013000000.0": 52920216.4, "8014000000.0": 52920266.8, "8015000000.0": 52920317.2, "8016000000.0": 52920367.5, "8017000000.0": 52920417.9, "8018000000.0": 52920468.2, "8019000000.0": 52920518.5, "8020000000.0": 52920568.9, "8021000000.0": 52920619.2, "8022000000.0": 52920669.4, "8023000000.0": 52920719.7, "8024000000.0": 52920770.0, "8025000000.0": 52920820.2, "8026000000.0": 52920870.5, "8027000000.0": 52920920.7, "8028000000.0": 52920970.9, "8029000000.0": 52921021.1, "8030000000.0": 52921071.3, "8031000000.0": 52921121.5, "8032000000.0": 52921171.6, "8033000000.0": 52921221.8, "8034000000.0": 52921271.9, "8035000000.0": 52921322.1, "8036000000.0": 52921372.2, "8037000000.0": 52921422.3, "8038000000.0": 52921472.4, "8039000000.0": 52921522.4, "8040000000.0": 52921572.5, "8041000000.0": 52921622.6, "8042000000.0": 52921672.6, "8043000000.0": 52921722.6, "8044000000.0": 52921772.6, "8045000000.0": 52921822.7, "8046000000.0": 52921872.6, "8047000000.0": 52921922.6, "8048000000.0": 52921972.6, "8049000000.0": 52922022.5, "8050000000.0": 52922072.5, "8051000000.0": 52922122.4, "8052000000.0": 52922172.3, "8053000000.0": 52922222.2, "8054000000.0": 52922272.1, "8055000000.0": 52922322.0, "8056000000.0": 52922371.9, "8057000000.0": 52922421.7, "8058000000.0": 52922471.6, "8059000000.0": 52922521.4, "8060000000.0": 52922571.2, "8061000000.0": 52922621.0, "8062000000.0": 52922670.8, "8063000000.0": 52922720.6, "8064000000.0": 52922770.4, "8065000000.0": 52922820.1, "8066000000.0": 52922869.9, "8067000000.0": 52922919.6, "8068000000.0": 52922969.3, "8069000000.0": 52923019.1, "8070000000.0": 52923068.7, "8071000000.0": 52923118.4, "8072000000.0": 52923168.1, "8073000000.0": 52923217.8, "8074000000.0": 52923267.4, "8075000000.0": 52923317.0, "8076000000.0": 52923366.7, "8077000000.0": 52923416.3, "8078000000.0": 52923465.9, "8079000000.0": 52923515.5, "8080000000.0": 52923565.0, "8081000000.0": 52923614.6, "8082000000.0": 52923664.2, "8083000000.0": 52923713.7, "8084000000.0": 52923763.2, "8085000000.0": 52923812.7, "8086000000.0": 52923862.2, "8087000000.0": 52923911.7, "8088000000.0": 52923961.2, "8089000000.0": 52924010.7, "8090000000.0": 52924060.1, "8091000000.0": 52924109.6, "8092000000.0": 52924159.0, "8093000000.0": 52924208.4, "8094000000.0": 52924257.8, "8095000000.0": 52924307.2, "8096000000.0": 52924356.6, "8097000000.0": 52924406.0, "8098000000.0": 52924455.3, "8099000000.0": 52924504.7, "8100000000.0": 52924554.0, "8101000000.0": 52924603.3, "8102000000.0": 52924652.6, "8103000000.0": 52924701.9, "8104000000.0": 52924751.2, "8105000000.0": 52924800.5, "8106000000.0": 52924849.7, "8107000000.0": 52924899.0, "8108000000.0": 52924948.2, "8109000000.0": 52924997.4, "8110000000.0": 52925046.6, "8111000000.0": 52925095.8, "8112000000.0": 52925145.0, "8113000000.0": 52925194.2, "8114000000.0": 52925243.4, "8115000000.0": 52925292.5, "8116000000.0": 52925341.7, "8117000000.0": 52925390.8, "8118000000.0": 52925439.9, "8119000000.0": 52925489.0, "8120000000.0": 52925538.1, "8121000000.0": 52925587.2, "8122000000.0": 52925636.2, "8123000000.0": 52925685.3, "8124000000.0": 52925734.3, "8125000000.0": 52925783.4, "8126000000.0": 52925832.4, "8127000000.0": 52925881.4, "8128000000.0": 52925930.4, "8129000000.0": 52925979.4, "8130000000.0": 52926028.3, "8131000000.0": 52926077.3, "8132000000.0": 52926126.3, "8133000000.0": 52926175.2, "8134000000.0": 52926224.1, "8135000000.0": 52926273.0, "8136000000.0": 52926321.9, "8137000000.0": 52926370.8, "8138000000.0": 52926419.7, "8139000000.0": 52926468.6, "8140000000.0": 52926517.4, "8141000000.0": 52926566.2, "8142000000.0": 52926615.1, "8143000000.0": 52926663.9, "8144000000.0": 52926712.7, "8145000000.0": 52926761.5, "8146000000.0": 52926810.3, "8147000000.0": 52926859.0, "8148000000.0": 52926907.8, "8149000000.0": 52926956.5, "8150000000.0": 52927005.3, "8151000000.0": 52927054.0, "8152000000.0": 52927102.7, "8153000000.0": 52927151.4, "8154000000.0": 52927200.1, "8155000000.0": 52927248.8, "8156000000.0": 52927297.4, "8157000000.0": 52927346.1, "8158000000.0": 52927394.7, "8159000000.0": 52927443.3, "8160000000.0": 52927491.9, "8161000000.0": 52927540.6, "8162000000.0": 52927589.1, "8163000000.0": 52927637.7, "8164000000.0": 52927686.3, "8165000000.0": 52927734.8, "8166000000.0": 52927783.4, "8167000000.0": 52927831.9, "8168000000.0": 52927880.4, "8169000000.0": 52927928.9, "8170000000.0": 52927977.4, "8171000000.0": 52928025.9, "8172000000.0": 52928074.4, "8173000000.0": 52928122.9, "8174000000.0": 52928171.3, "8175000000.0": 52928219.8, "8176000000.0": 52928268.2, "8177000000.0": 52928316.6, "8178000000.0": 52928365.0, "8179000000.0": 52928413.4, "8180000000.0": 52928461.8, "8181000000.0": 52928510.1, "8182000000.0": 52928558.5, "8183000000.0": 52928606.8, "8184000000.0": 52928655.2, "8185000000.0": 52928703.5, "8186000000.0": 52928751.8, "8187000000.0": 52928800.1, "8188000000.0": 52928848.4, "8189000000.0": 52928896.6, "8190000000.0": 52928944.9, "8191000000.0": 52928993.2, "8192000000.0": 52929041.4, "8193000000.0": 52929089.6, "8194000000.0": 52929137.8, "8195000000.0": 52929186.0, "8196000000.0": 52929234.2, "8197000000.0": 52929282.4, "8198000000.0": 52929330.6, "8199000000.0": 52929378.7, "8200000000.0": 52929426.9, "8201000000.0": 52929475.0, "8202000000.0": 52929523.1, "8203000000.0": 52929571.3, "8204000000.0": 52929619.4, "8205000000.0": 52929667.4, "8206000000.0": 52929715.5, "8207000000.0": 52929763.6, "8208000000.0": 52929811.6, "8209000000.0": 52929859.7, "8210000000.0": 52929907.7, "8211000000.0": 52929955.7, "8212000000.0": 52930003.7, "8213000000.0": 52930051.7, "8214000000.0": 52930099.7, "8215000000.0": 52930147.7, "8216000000.0": 52930195.6, "8217000000.0": 52930243.6, "8218000000.0": 52930291.5, "8219000000.0": 52930339.4, "8220000000.0": 52930387.3, "8221000000.0": 52930435.2, "8222000000.0": 52930483.1, "8223000000.0": 52930531.0, "8224000000.0": 52930578.9, "8225000000.0": 52930626.7, "8226000000.0": 52930674.6, "8227000000.0": 52930722.4, "8228000000.0": 52930770.2, "8229000000.0": 52930818.0, "8230000000.0": 52930865.8, "8231000000.0": 52930913.6, "8232000000.0": 52930961.4, "8233000000.0": 52931009.2, "8234000000.0": 52931056.9, "8235000000.0": 52931104.7, "8236000000.0": 52931152.4, "8237000000.0": 52931200.1, "8238000000.0": 52931247.8, "8239000000.0": 52931295.5, "8240000000.0": 52931343.2, "8241000000.0": 52931390.9, "8242000000.0": 52931438.5, "8243000000.0": 52931486.2, "8244000000.0": 52931533.8, "8245000000.0": 52931581.4, "8246000000.0": 52931629.0, "8247000000.0": 52931676.6, "8248000000.0": 52931724.2, "8249000000.0": 52931771.8, "8250000000.0": 52931819.4, "8251000000.0": 52931866.9, "8252000000.0": 52931914.5, "8253000000.0": 52931962.0, "8254000000.0": 52932009.5, "8255000000.0": 52932057.0, "8256000000.0": 52932104.5, "8257000000.0": 52932152.0, "8258000000.0": 52932199.5, "8259000000.0": 52932247.0, "8260000000.0": 52932294.4, "8261000000.0": 52932341.9, "8262000000.0": 52932389.3, "8263000000.0": 52932436.7, "8264000000.0": 52932484.1, "8265000000.0": 52932531.5, "8266000000.0": 52932578.9, "8267000000.0": 52932626.3, "8268000000.0": 52932673.6, "8269000000.0": 52932721.0, "8270000000.0": 52932768.3, "8271000000.0": 52932815.7, "8272000000.0": 52932863.0, "8273000000.0": 52932910.3, "8274000000.0": 52932957.6, "8275000000.0": 52933004.9, "8276000000.0": 52933052.1, "8277000000.0": 52933099.4, "8278000000.0": 52933146.6, "8279000000.0": 52933193.9, "8280000000.0": 52933241.1, "8281000000.0": 52933288.3, "8282000000.0": 52933335.5, "8283000000.0": 52933382.7, "8284000000.0": 52933429.9, "8285000000.0": 52933477.1, "8286000000.0": 52933524.2, "8287000000.0": 52933571.4, "8288000000.0": 52933618.5, "8289000000.0": 52933665.6, "8290000000.0": 52933712.7, "8291000000.0": 52933759.8, "8292000000.0": 52933806.9, "8293000000.0": 52933854.0, "8294000000.0": 52933901.1, "8295000000.0": 52933948.1, "8296000000.0": 52933995.2, "8297000000.0": 52934042.2, "8298000000.0": 52934089.2, "8299000000.0": 52934136.3, "8300000000.0": 52934183.3, "8301000000.0": 52934230.2, "8302000000.0": 52934277.2, "8303000000.0": 52934324.2, "8304000000.0": 52934371.1, "8305000000.0": 52934418.1, "8306000000.0": 52934465.0, "8307000000.0": 52934511.9, "8308000000.0": 52934558.9, "8309000000.0": 52934605.8, "8310000000.0": 52934652.6, "8311000000.0": 52934699.5, "8312000000.0": 52934746.4, "8313000000.0": 52934793.2, "8314000000.0": 52934840.1, "8315000000.0": 52934886.9, "8316000000.0": 52934933.7, "8317000000.0": 52934980.6, "8318000000.0": 52935027.3, "8319000000.0": 52935074.1, "8320000000.0": 52935120.9, "8321000000.0": 52935167.7, "8322000000.0": 52935214.4, "8323000000.0": 52935261.2, "8324000000.0": 52935307.9, "8325000000.0": 52935354.6, "8326000000.0": 52935401.3, "8327000000.0": 52935448.0, "8328000000.0": 52935494.7, "8329000000.0": 52935541.4, "8330000000.0": 52935588.1, "8331000000.0": 52935634.7, "8332000000.0": 52935681.4, "8333000000.0": 52935728.0, "8334000000.0": 52935774.6, "8335000000.0": 52935821.2, "8336000000.0": 52935867.8, "8337000000.0": 52935914.4, "8338000000.0": 52935961.0, "8339000000.0": 52936007.6, "8340000000.0": 52936054.1, "8341000000.0": 52936100.7, "8342000000.0": 52936147.2, "8343000000.0": 52936193.7, "8344000000.0": 52936240.2, "8345000000.0": 52936286.7, "8346000000.0": 52936333.2, "8347000000.0": 52936379.7, "8348000000.0": 52936426.1, "8349000000.0": 52936472.6, "8350000000.0": 52936519.0, "8351000000.0": 52936565.5, "8352000000.0": 52936611.9, "8353000000.0": 52936658.3, "8354000000.0": 52936704.7, "8355000000.0": 52936751.1, "8356000000.0": 52936797.5, "8357000000.0": 52936843.8, "8358000000.0": 52936890.2, "8359000000.0": 52936936.5, "8360000000.0": 52936982.9, "8361000000.0": 52937029.2, "8362000000.0": 52937075.5, "8363000000.0": 52937121.8, "8364000000.0": 52937168.1, "8365000000.0": 52937214.4, "8366000000.0": 52937260.6, "8367000000.0": 52937306.9, "8368000000.0": 52937353.1, "8369000000.0": 52937399.4, "8370000000.0": 52937445.6, "8371000000.0": 52937491.8, "8372000000.0": 52937538.0, "8373000000.0": 52937584.2, "8374000000.0": 52937630.4, "8375000000.0": 52937676.6, "8376000000.0": 52937722.7, "8377000000.0": 52937768.9, "8378000000.0": 52937815.0, "8379000000.0": 52937861.1, "8380000000.0": 52937907.2, "8381000000.0": 52937953.3, "8382000000.0": 52937999.4, "8383000000.0": 52938045.5, "8384000000.0": 52938091.6, "8385000000.0": 52938137.6, "8386000000.0": 52938183.7, "8387000000.0": 52938229.7, "8388000000.0": 52938275.8, "8389000000.0": 52938321.8, "8390000000.0": 52938367.8, "8391000000.0": 52938413.8, "8392000000.0": 52938459.7, "8393000000.0": 52938505.7, "8394000000.0": 52938551.7, "8395000000.0": 52938597.6, "8396000000.0": 52938643.6, "8397000000.0": 52938689.5, "8398000000.0": 52938735.4, "8399000000.0": 52938781.3, "8400000000.0": 52938827.2, "8401000000.0": 52938873.1, "8402000000.0": 52938919.0, "8403000000.0": 52938964.8, "8404000000.0": 52939010.7, "8405000000.0": 52939056.5, "8406000000.0": 52939102.4, "8407000000.0": 52939148.2, "8408000000.0": 52939194.0, "8409000000.0": 52939239.8, "8410000000.0": 52939285.6, "8411000000.0": 52939331.4, "8412000000.0": 52939377.1, "8413000000.0": 52939422.9, "8414000000.0": 52939468.6, "8415000000.0": 52939514.4, "8416000000.0": 52939560.1, "8417000000.0": 52939605.8, "8418000000.0": 52939651.5, "8419000000.0": 52939697.2, "8420000000.0": 52939742.9, "8421000000.0": 52939788.5, "8422000000.0": 52939834.2, "8423000000.0": 52939879.9, "8424000000.0": 52939925.5, "8425000000.0": 52939971.1, "8426000000.0": 52940016.7, "8427000000.0": 52940062.3, "8428000000.0": 52940107.9, "8429000000.0": 52940153.5, "8430000000.0": 52940199.1, "8431000000.0": 52940244.7, "8432000000.0": 52940290.2, "8433000000.0": 52940335.7, "8434000000.0": 52940381.3, "8435000000.0": 52940426.8, "8436000000.0": 52940472.3, "8437000000.0": 52940517.8, "8438000000.0": 52940563.3, "8439000000.0": 52940608.8, "8440000000.0": 52940654.2, "8441000000.0": 52940699.7, "8442000000.0": 52940745.1, "8443000000.0": 52940790.6, "8444000000.0": 52940836.0, "8445000000.0": 52940881.4, "8446000000.0": 52940926.8, "8447000000.0": 52940972.2, "8448000000.0": 52941017.6, "8449000000.0": 52941062.9, "8450000000.0": 52941108.3, "8451000000.0": 52941153.6, "8452000000.0": 52941199.0, "8453000000.0": 52941244.3, "8454000000.0": 52941289.6, "8455000000.0": 52941334.9, "8456000000.0": 52941380.2, "8457000000.0": 52941425.5, "8458000000.0": 52941470.8, "8459000000.0": 52941516.0, "8460000000.0": 52941561.3, "8461000000.0": 52941606.5, "8462000000.0": 52941651.8, "8463000000.0": 52941697.0, "8464000000.0": 52941742.2, "8465000000.0": 52941787.4, "8466000000.0": 52941832.6, "8467000000.0": 52941877.8, "8468000000.0": 52941922.9, "8469000000.0": 52941968.1, "8470000000.0": 52942013.2, "8471000000.0": 52942058.4, "8472000000.0": 52942103.5, "8473000000.0": 52942148.6, "8474000000.0": 52942193.7, "8475000000.0": 52942238.8, "8476000000.0": 52942283.9, "8477000000.0": 52942329.0, "8478000000.0": 52942374.0, "8479000000.0": 52942419.1, "8480000000.0": 52942464.1, "8481000000.0": 52942509.2, "8482000000.0": 52942554.2, "8483000000.0": 52942599.2, "8484000000.0": 52942644.2, "8485000000.0": 52942689.2, "8486000000.0": 52942734.1, "8487000000.0": 52942779.1, "8488000000.0": 52942824.1, "8489000000.0": 52942869.0, "8490000000.0": 52942913.9, "8491000000.0": 52942958.9, "8492000000.0": 52943003.8, "8493000000.0": 52943048.7, "8494000000.0": 52943093.6, "8495000000.0": 52943138.5, "8496000000.0": 52943183.3, "8497000000.0": 52943228.2, "8498000000.0": 52943273.1, "8499000000.0": 52943317.9, "8500000000.0": 52943362.7, "8501000000.0": 52943407.5, "8502000000.0": 52943452.4, "8503000000.0": 52943497.2, "8504000000.0": 52943541.9, "8505000000.0": 52943586.7, "8506000000.0": 52943631.5, "8507000000.0": 52943676.2, "8508000000.0": 52943721.0, "8509000000.0": 52943765.7, "8510000000.0": 52943810.5, "8511000000.0": 52943855.2, "8512000000.0": 52943899.9, "8513000000.0": 52943944.6, "8514000000.0": 52943989.3, "8515000000.0": 52944033.9, "8516000000.0": 52944078.6, "8517000000.0": 52944123.2, "8518000000.0": 52944167.9, "8519000000.0": 52944212.5, "8520000000.0": 52944257.1, "8521000000.0": 52944301.8, "8522000000.0": 52944346.4, "8523000000.0": 52944390.9, "8524000000.0": 52944435.5, "8525000000.0": 52944480.1, "8526000000.0": 52944524.7, "8527000000.0": 52944569.2, "8528000000.0": 52944613.7, "8529000000.0": 52944658.3, "8530000000.0": 52944702.8, "8531000000.0": 52944747.3, "8532000000.0": 52944791.8, "8533000000.0": 52944836.3, "8534000000.0": 52944880.8, "8535000000.0": 52944925.2, "8536000000.0": 52944969.7, "8537000000.0": 52945014.1, "8538000000.0": 52945058.6, "8539000000.0": 52945103.0, "8540000000.0": 52945147.4, "8541000000.0": 52945191.8, "8542000000.0": 52945236.2, "8543000000.0": 52945280.6, "8544000000.0": 52945325.0, "8545000000.0": 52945369.3, "8546000000.0": 52945413.7, "8547000000.0": 52945458.0, "8548000000.0": 52945502.4, "8549000000.0": 52945546.7, "8550000000.0": 52945591.0, "8551000000.0": 52945635.3, "8552000000.0": 52945679.6, "8553000000.0": 52945723.9, "8554000000.0": 52945768.1, "8555000000.0": 52945812.4, "8556000000.0": 52945856.6, "8557000000.0": 52945900.9, "8558000000.0": 52945945.1, "8559000000.0": 52945989.3, "8560000000.0": 52946033.5, "8561000000.0": 52946077.7, "8562000000.0": 52946121.9, "8563000000.0": 52946166.1, "8564000000.0": 52946210.3, "8565000000.0": 52946254.4, "8566000000.0": 52946298.6, "8567000000.0": 52946342.7, "8568000000.0": 52946386.8, "8569000000.0": 52946431.0, "8570000000.0": 52946475.1, "8571000000.0": 52946519.2, "8572000000.0": 52946563.2, "8573000000.0": 52946607.3, "8574000000.0": 52946651.4, "8575000000.0": 52946695.4, "8576000000.0": 52946739.5, "8577000000.0": 52946783.5, "8578000000.0": 52946827.5, "8579000000.0": 52946871.6, "8580000000.0": 52946915.6, "8581000000.0": 52946959.6, "8582000000.0": 52947003.5, "8583000000.0": 52947047.5, "8584000000.0": 52947091.5, "8585000000.0": 52947135.4, "8586000000.0": 52947179.4, "8587000000.0": 52947223.3, "8588000000.0": 52947267.2, "8589000000.0": 52947311.1, "8590000000.0": 52947355.1, "8591000000.0": 52947398.9, "8592000000.0": 52947442.8, "8593000000.0": 52947486.7, "8594000000.0": 52947530.6, "8595000000.0": 52947574.4, "8596000000.0": 52947618.3, "8597000000.0": 52947662.1, "8598000000.0": 52947705.9, "8599000000.0": 52947749.7, "8600000000.0": 52947793.5, "8601000000.0": 52947837.3, "8602000000.0": 52947881.1, "8603000000.0": 52947924.9, "8604000000.0": 52947968.6, "8605000000.0": 52948012.4, "8606000000.0": 52948056.1, "8607000000.0": 52948099.8, "8608000000.0": 52948143.6, "8609000000.0": 52948187.3, "8610000000.0": 52948231.0, "8611000000.0": 52948274.7, "8612000000.0": 52948318.4, "8613000000.0": 52948362.0, "8614000000.0": 52948405.7, "8615000000.0": 52948449.3, "8616000000.0": 52948493.0, "8617000000.0": 52948536.6, "8618000000.0": 52948580.2, "8619000000.0": 52948623.8, "8620000000.0": 52948667.4, "8621000000.0": 52948711.0, "8622000000.0": 52948754.6, "8623000000.0": 52948798.2, "8624000000.0": 52948841.7, "8625000000.0": 52948885.3, "8626000000.0": 52948928.8, "8627000000.0": 52948972.4, "8628000000.0": 52949015.9, "8629000000.0": 52949059.4, "8630000000.0": 52949102.9, "8631000000.0": 52949146.4, "8632000000.0": 52949189.9, "8633000000.0": 52949233.3, "8634000000.0": 52949276.8, "8635000000.0": 52949320.2, "8636000000.0": 52949363.7, "8637000000.0": 52949407.1, "8638000000.0": 52949450.5, "8639000000.0": 52949493.9, "8640000000.0": 52949537.3, "8641000000.0": 52949580.7, "8642000000.0": 52949624.1, "8643000000.0": 52949667.5, "8644000000.0": 52949710.8, "8645000000.0": 52949754.2, "8646000000.0": 52949797.5, "8647000000.0": 52949840.8, "8648000000.0": 52949884.2, "8649000000.0": 52949927.5, "8650000000.0": 52949970.8, "8651000000.0": 52950014.1, "8652000000.0": 52950057.4, "8653000000.0": 52950100.6, "8654000000.0": 52950143.9, "8655000000.0": 52950187.1, "8656000000.0": 52950230.4, "8657000000.0": 52950273.6, "8658000000.0": 52950316.8, "8659000000.0": 52950360.0, "8660000000.0": 52950403.2, "8661000000.0": 52950446.4, "8662000000.0": 52950489.6, "8663000000.0": 52950532.8, "8664000000.0": 52950575.9, "8665000000.0": 52950619.1, "8666000000.0": 52950662.2, "8667000000.0": 52950705.4, "8668000000.0": 52950748.5, "8669000000.0": 52950791.6, "8670000000.0": 52950834.7, "8671000000.0": 52950877.8, "8672000000.0": 52950920.9, "8673000000.0": 52950964.0, "8674000000.0": 52951007.0, "8675000000.0": 52951050.1, "8676000000.0": 52951093.1, "8677000000.0": 52951136.1, "8678000000.0": 52951179.2, "8679000000.0": 52951222.2, "8680000000.0": 52951265.2, "8681000000.0": 52951308.2, "8682000000.0": 52951351.2, "8683000000.0": 52951394.1, "8684000000.0": 52951437.1, "8685000000.0": 52951480.1, "8686000000.0": 52951523.0, "8687000000.0": 52951565.9, "8688000000.0": 52951608.9, "8689000000.0": 52951651.8, "8690000000.0": 52951694.7, "8691000000.0": 52951737.6, "8692000000.0": 52951780.5, "8693000000.0": 52951823.3, "8694000000.0": 52951866.2, "8695000000.0": 52951909.1, "8696000000.0": 52951951.9, "8697000000.0": 52951994.7, "8698000000.0": 52952037.6, "8699000000.0": 52952080.4, "8700000000.0": 52952123.2, "8701000000.0": 52952166.0, "8702000000.0": 52952208.8, "8703000000.0": 52952251.6, "8704000000.0": 52952294.3, "8705000000.0": 52952337.1, "8706000000.0": 52952379.8, "8707000000.0": 52952422.6, "8708000000.0": 52952465.3, "8709000000.0": 52952508.0, "8710000000.0": 52952550.7, "8711000000.0": 52952593.4, "8712000000.0": 52952636.1, "8713000000.0": 52952678.8, "8714000000.0": 52952721.5, "8715000000.0": 52952764.1, "8716000000.0": 52952806.8, "8717000000.0": 52952849.4, "8718000000.0": 52952892.1, "8719000000.0": 52952934.7, "8720000000.0": 52952977.3, "8721000000.0": 52953019.9, "8722000000.0": 52953062.5, "8723000000.0": 52953105.1, "8724000000.0": 52953147.7, "8725000000.0": 52953190.2, "8726000000.0": 52953232.8, "8727000000.0": 52953275.3, "8728000000.0": 52953317.8, "8729000000.0": 52953360.4, "8730000000.0": 52953402.9, "8731000000.0": 52953445.4, "8732000000.0": 52953487.9, "8733000000.0": 52953530.4, "8734000000.0": 52953572.9, "8735000000.0": 52953615.3, "8736000000.0": 52953657.8, "8737000000.0": 52953700.2, "8738000000.0": 52953742.7, "8739000000.0": 52953785.1, "8740000000.0": 52953827.5, "8741000000.0": 52953869.9, "8742000000.0": 52953912.3, "8743000000.0": 52953954.7, "8744000000.0": 52953997.1, "8745000000.0": 52954039.5, "8746000000.0": 52954081.8, "8747000000.0": 52954124.2, "8748000000.0": 52954166.5, "8749000000.0": 52954208.9, "8750000000.0": 52954251.2, "8751000000.0": 52954293.5, "8752000000.0": 52954335.8, "8753000000.0": 52954378.1, "8754000000.0": 52954420.4, "8755000000.0": 52954462.7, "8756000000.0": 52954504.9, "8757000000.0": 52954547.2, "8758000000.0": 52954589.4, "8759000000.0": 52954631.7, "8760000000.0": 52954673.9, "8761000000.0": 52954716.1, "8762000000.0": 52954758.3, "8763000000.0": 52954800.5, "8764000000.0": 52954842.7, "8765000000.0": 52954884.9, "8766000000.0": 52954927.0, "8767000000.0": 52954969.2, "8768000000.0": 52955011.4, "8769000000.0": 52955053.5, "8770000000.0": 52955095.6, "8771000000.0": 52955137.8, "8772000000.0": 52955179.9, "8773000000.0": 52955222.0, "8774000000.0": 52955264.1, "8775000000.0": 52955306.1, "8776000000.0": 52955348.2, "8777000000.0": 52955390.3, "8778000000.0": 52955432.3, "8779000000.0": 52955474.4, "8780000000.0": 52955516.4, "8781000000.0": 52955558.5, "8782000000.0": 52955600.5, "8783000000.0": 52955642.5, "8784000000.0": 52955684.5, "8785000000.0": 52955726.5, "8786000000.0": 52955768.4, "8787000000.0": 52955810.4, "8788000000.0": 52955852.4, "8789000000.0": 52955894.3, "8790000000.0": 52955936.3, "8791000000.0": 52955978.2, "8792000000.0": 52956020.1, "8793000000.0": 52956062.0, "8794000000.0": 52956103.9, "8795000000.0": 52956145.8, "8796000000.0": 52956187.7, "8797000000.0": 52956229.6, "8798000000.0": 52956271.5, "8799000000.0": 52956313.3, "8800000000.0": 52956355.2, "8801000000.0": 52956397.0, "8802000000.0": 52956438.8, "8803000000.0": 52956480.6, "8804000000.0": 52956522.5, "8805000000.0": 52956564.3, "8806000000.0": 52956606.0, "8807000000.0": 52956647.8, "8808000000.0": 52956689.6, "8809000000.0": 52956731.4, "8810000000.0": 52956773.1, "8811000000.0": 52956814.9, "8812000000.0": 52956856.6, "8813000000.0": 52956898.3, "8814000000.0": 52956940.0, "8815000000.0": 52956981.7, "8816000000.0": 52957023.4, "8817000000.0": 52957065.1, "8818000000.0": 52957106.8, "8819000000.0": 52957148.5, "8820000000.0": 52957190.1, "8821000000.0": 52957231.8, "8822000000.0": 52957273.4, "8823000000.0": 52957315.0, "8824000000.0": 52957356.7, "8825000000.0": 52957398.3, "8826000000.0": 52957439.9, "8827000000.0": 52957481.5, "8828000000.0": 52957523.1, "8829000000.0": 52957564.6, "8830000000.0": 52957606.2, "8831000000.0": 52957647.8, "8832000000.0": 52957689.3, "8833000000.0": 52957730.8, "8834000000.0": 52957772.4, "8835000000.0": 52957813.9, "8836000000.0": 52957855.4, "8837000000.0": 52957896.9, "8838000000.0": 52957938.4, "8839000000.0": 52957979.9, "8840000000.0": 52958021.3, "8841000000.0": 52958062.8, "8842000000.0": 52958104.2, "8843000000.0": 52958145.7, "8844000000.0": 52958187.1, "8845000000.0": 52958228.6, "8846000000.0": 52958270.0, "8847000000.0": 52958311.4, "8848000000.0": 52958352.8, "8849000000.0": 52958394.2, "8850000000.0": 52958435.5, "8851000000.0": 52958476.9, "8852000000.0": 52958518.3, "8853000000.0": 52958559.6, "8854000000.0": 52958601.0, "8855000000.0": 52958642.3, "8856000000.0": 52958683.6, "8857000000.0": 52958724.9, "8858000000.0": 52958766.2, "8859000000.0": 52958807.5, "8860000000.0": 52958848.8, "8861000000.0": 52958890.1, "8862000000.0": 52958931.4, "8863000000.0": 52958972.6, "8864000000.0": 52959013.9, "8865000000.0": 52959055.1, "8866000000.0": 52959096.3, "8867000000.0": 52959137.6, "8868000000.0": 52959178.8, "8869000000.0": 52959220.0, "8870000000.0": 52959261.2, "8871000000.0": 52959302.4, "8872000000.0": 52959343.5, "8873000000.0": 52959384.7, "8874000000.0": 52959425.9, "8875000000.0": 52959467.0, "8876000000.0": 52959508.1, "8877000000.0": 52959549.3, "8878000000.0": 52959590.4, "8879000000.0": 52959631.5, "8880000000.0": 52959672.6, "8881000000.0": 52959713.7, "8882000000.0": 52959754.8, "8883000000.0": 52959795.8, "8884000000.0": 52959836.9, "8885000000.0": 52959878.0, "8886000000.0": 52959919.0, "8887000000.0": 52959960.1, "8888000000.0": 52960001.1, "8889000000.0": 52960042.1, "8890000000.0": 52960083.1, "8891000000.0": 52960124.1, "8892000000.0": 52960165.1, "8893000000.0": 52960206.1, "8894000000.0": 52960247.1, "8895000000.0": 52960288.0, "8896000000.0": 52960329.0, "8897000000.0": 52960369.9, "8898000000.0": 52960410.9, "8899000000.0": 52960451.8, "8900000000.0": 52960492.7, "8901000000.0": 52960533.6, "8902000000.0": 52960574.5, "8903000000.0": 52960615.4, "8904000000.0": 52960656.3, "8905000000.0": 52960697.2, "8906000000.0": 52960738.0, "8907000000.0": 52960778.9, "8908000000.0": 52960819.7, "8909000000.0": 52960860.6, "8910000000.0": 52960901.4, "8911000000.0": 52960942.2, "8912000000.0": 52960983.0, "8913000000.0": 52961023.8, "8914000000.0": 52961064.6, "8915000000.0": 52961105.4, "8916000000.0": 52961146.2, "8917000000.0": 52961186.9, "8918000000.0": 52961227.7, "8919000000.0": 52961268.4, "8920000000.0": 52961309.2, "8921000000.0": 52961349.9, "8922000000.0": 52961390.6, "8923000000.0": 52961431.3, "8924000000.0": 52961472.0, "8925000000.0": 52961512.7, "8926000000.0": 52961553.4, "8927000000.0": 52961594.1, "8928000000.0": 52961634.7, "8929000000.0": 52961675.4, "8930000000.0": 52961716.0, "8931000000.0": 52961756.7, "8932000000.0": 52961797.3, "8933000000.0": 52961837.9, "8934000000.0": 52961878.5, "8935000000.0": 52961919.1, "8936000000.0": 52961959.7, "8937000000.0": 52962000.3, "8938000000.0": 52962040.9, "8939000000.0": 52962081.4, "8940000000.0": 52962122.0, "8941000000.0": 52962162.5, "8942000000.0": 52962203.1, "8943000000.0": 52962243.6, "8944000000.0": 52962284.1, "8945000000.0": 52962324.6, "8946000000.0": 52962365.1, "8947000000.0": 52962405.6, "8948000000.0": 52962446.1, "8949000000.0": 52962486.6, "8950000000.0": 52962527.0, "8951000000.0": 52962567.5, "8952000000.0": 52962607.9, "8953000000.0": 52962648.4, "8954000000.0": 52962688.8, "8955000000.0": 52962729.2, "8956000000.0": 52962769.6, "8957000000.0": 52962810.1, "8958000000.0": 52962850.4, "8959000000.0": 52962890.8, "8960000000.0": 52962931.2, "8961000000.0": 52962971.6, "8962000000.0": 52963011.9, "8963000000.0": 52963052.3, "8964000000.0": 52963092.6, "8965000000.0": 52963133.0, "8966000000.0": 52963173.3, "8967000000.0": 52963213.6, "8968000000.0": 52963253.9, "8969000000.0": 52963294.2, "8970000000.0": 52963334.5, "8971000000.0": 52963374.8, "8972000000.0": 52963415.0, "8973000000.0": 52963455.3, "8974000000.0": 52963495.5, "8975000000.0": 52963535.8, "8976000000.0": 52963576.0, "8977000000.0": 52963616.2, "8978000000.0": 52963656.4, "8979000000.0": 52963696.7, "8980000000.0": 52963736.9, "8981000000.0": 52963777.0, "8982000000.0": 52963817.2, "8983000000.0": 52963857.4, "8984000000.0": 52963897.6, "8985000000.0": 52963937.7, "8986000000.0": 52963977.8, "8987000000.0": 52964018.0, "8988000000.0": 52964058.1, "8989000000.0": 52964098.2, "8990000000.0": 52964138.3, "8991000000.0": 52964178.4, "8992000000.0": 52964218.5, "8993000000.0": 52964258.6, "8994000000.0": 52964298.7, "8995000000.0": 52964338.7, "8996000000.0": 52964378.8, "8997000000.0": 52964418.9, "8998000000.0": 52964458.9, "8999000000.0": 52964498.9, "9000000000.0": 52964538.9, "9001000000.0": 52964579.0, "9002000000.0": 52964619.0, "9003000000.0": 52964658.9, "9004000000.0": 52964698.9, "9005000000.0": 52964738.9, "9006000000.0": 52964778.9, "9007000000.0": 52964818.8, "9008000000.0": 52964858.8, "9009000000.0": 52964898.7, "9010000000.0": 52964938.7, "9011000000.0": 52964978.6, "9012000000.0": 52965018.5, "9013000000.0": 52965058.4, "9014000000.0": 52965098.3, "9015000000.0": 52965138.2, "9016000000.0": 52965178.1, "9017000000.0": 52965217.9, "9018000000.0": 52965257.8, "9019000000.0": 52965297.7, "9020000000.0": 52965337.5, "9021000000.0": 52965377.3, "9022000000.0": 52965417.2, "9023000000.0": 52965457.0, "9024000000.0": 52965496.8, "9025000000.0": 52965536.6, "9026000000.0": 52965576.4, "9027000000.0": 52965616.2, "9028000000.0": 52965655.9, "9029000000.0": 52965695.7, "9030000000.0": 52965735.5, "9031000000.0": 52965775.2, "9032000000.0": 52965814.9, "9033000000.0": 52965854.7, "9034000000.0": 52965894.4, "9035000000.0": 52965934.1, "9036000000.0": 52965973.8, "9037000000.0": 52966013.5, "9038000000.0": 52966053.2, "9039000000.0": 52966092.9, "9040000000.0": 52966132.5, "9041000000.0": 52966172.2, "9042000000.0": 52966211.9, "9043000000.0": 52966251.5, "9044000000.0": 52966291.1, "9045000000.0": 52966330.8, "9046000000.0": 52966370.4, "9047000000.0": 52966410.0, "9048000000.0": 52966449.6, "9049000000.0": 52966489.2, "9050000000.0": 52966528.8, "9051000000.0": 52966568.3, "9052000000.0": 52966607.9, "9053000000.0": 52966647.5, "9054000000.0": 52966687.0, "9055000000.0": 52966726.5, "9056000000.0": 52966766.1, "9057000000.0": 52966805.6, "9058000000.0": 52966845.1, "9059000000.0": 52966884.6, "9060000000.0": 52966924.1, "9061000000.0": 52966963.6, "9062000000.0": 52967003.1, "9063000000.0": 52967042.5, "9064000000.0": 52967082.0, "9065000000.0": 52967121.5, "9066000000.0": 52967160.9, "9067000000.0": 52967200.3, "9068000000.0": 52967239.8, "9069000000.0": 52967279.2, "9070000000.0": 52967318.6, "9071000000.0": 52967358.0, "9072000000.0": 52967397.4, "9073000000.0": 52967436.8, "9074000000.0": 52967476.1, "9075000000.0": 52967515.5, "9076000000.0": 52967554.9, "9077000000.0": 52967594.2, "9078000000.0": 52967633.5, "9079000000.0": 52967672.9, "9080000000.0": 52967712.2, "9081000000.0": 52967751.5, "9082000000.0": 52967790.8, "9083000000.0": 52967830.1, "9084000000.0": 52967869.4, "9085000000.0": 52967908.7, "9086000000.0": 52967948.0, "9087000000.0": 52967987.2, "9088000000.0": 52968026.5, "9089000000.0": 52968065.7, "9090000000.0": 52968105.0, "9091000000.0": 52968144.2, "9092000000.0": 52968183.4, "9093000000.0": 52968222.6, "9094000000.0": 52968261.8, "9095000000.0": 52968301.0, "9096000000.0": 52968340.2, "9097000000.0": 52968379.4, "9098000000.0": 52968418.5, "9099000000.0": 52968457.7, "9100000000.0": 52968496.9, "9101000000.0": 52968536.0, "9102000000.0": 52968575.1, "9103000000.0": 52968614.3, "9104000000.0": 52968653.4, "9105000000.0": 52968692.5, "9106000000.0": 52968731.6, "9107000000.0": 52968770.7, "9108000000.0": 52968809.8, "9109000000.0": 52968848.8, "9110000000.0": 52968887.9, "9111000000.0": 52968927.0, "9112000000.0": 52968966.0, "9113000000.0": 52969005.1, "9114000000.0": 52969044.1, "9115000000.0": 52969083.1, "9116000000.0": 52969122.1, "9117000000.0": 52969161.1, "9118000000.0": 52969200.1, "9119000000.0": 52969239.1, "9120000000.0": 52969278.1, "9121000000.0": 52969317.1, "9122000000.0": 52969356.0, "9123000000.0": 52969395.0, "9124000000.0": 52969433.9, "9125000000.0": 52969472.9, "9126000000.0": 52969511.8, "9127000000.0": 52969550.7, "9128000000.0": 52969589.6, "9129000000.0": 52969628.5, "9130000000.0": 52969667.4, "9131000000.0": 52969706.3, "9132000000.0": 52969745.2, "9133000000.0": 52969784.1, "9134000000.0": 52969822.9, "9135000000.0": 52969861.8, "9136000000.0": 52969900.6, "9137000000.0": 52969939.5, "9138000000.0": 52969978.3, "9139000000.0": 52970017.1, "9140000000.0": 52970055.9, "9141000000.0": 52970094.7, "9142000000.0": 52970133.5, "9143000000.0": 52970172.3, "9144000000.0": 52970211.1, "9145000000.0": 52970249.9, "9146000000.0": 52970288.6, "9147000000.0": 52970327.4, "9148000000.0": 52970366.1, "9149000000.0": 52970404.9, "9150000000.0": 52970443.6, "9151000000.0": 52970482.3, "9152000000.0": 52970521.0, "9153000000.0": 52970559.7, "9154000000.0": 52970598.4, "9155000000.0": 52970637.1, "9156000000.0": 52970675.8, "9157000000.0": 52970714.5, "9158000000.0": 52970753.1, "9159000000.0": 52970791.8, "9160000000.0": 52970830.4, "9161000000.0": 52970869.0, "9162000000.0": 52970907.7, "9163000000.0": 52970946.3, "9164000000.0": 52970984.9, "9165000000.0": 52971023.5, "9166000000.0": 52971062.1, "9167000000.0": 52971100.7, "9168000000.0": 52971139.3, "9169000000.0": 52971177.8, "9170000000.0": 52971216.4, "9171000000.0": 52971254.9, "9172000000.0": 52971293.5, "9173000000.0": 52971332.0, "9174000000.0": 52971370.5, "9175000000.0": 52971409.1, "9176000000.0": 52971447.6, "9177000000.0": 52971486.1, "9178000000.0": 52971524.6, "9179000000.0": 52971563.1, "9180000000.0": 52971601.5, "9181000000.0": 52971640.0, "9182000000.0": 52971678.5, "9183000000.0": 52971716.9, "9184000000.0": 52971755.4, "9185000000.0": 52971793.8, "9186000000.0": 52971832.2, "9187000000.0": 52971870.6, "9188000000.0": 52971909.0, "9189000000.0": 52971947.4, "9190000000.0": 52971985.8, "9191000000.0": 52972024.2, "9192000000.0": 52972062.6, "9193000000.0": 52972101.0, "9194000000.0": 52972139.3, "9195000000.0": 52972177.7, "9196000000.0": 52972216.0, "9197000000.0": 52972254.4, "9198000000.0": 52972292.7, "9199000000.0": 52972331.0, "9200000000.0": 52972369.3, "9201000000.0": 52972407.6, "9202000000.0": 52972445.9, "9203000000.0": 52972484.2, "9204000000.0": 52972522.5, "9205000000.0": 52972560.8, "9206000000.0": 52972599.0, "9207000000.0": 52972637.3, "9208000000.0": 52972675.5, "9209000000.0": 52972713.7, "9210000000.0": 52972752.0, "9211000000.0": 52972790.2, "9212000000.0": 52972828.4, "9213000000.0": 52972866.6, "9214000000.0": 52972904.8, "9215000000.0": 52972943.0, "9216000000.0": 52972981.2, "9217000000.0": 52973019.3, "9218000000.0": 52973057.5, "9219000000.0": 52973095.7, "9220000000.0": 52973133.8, "9221000000.0": 52973171.9, "9222000000.0": 52973210.1, "9223000000.0": 52973248.2, "9224000000.0": 52973286.3, "9225000000.0": 52973324.4, "9226000000.0": 52973362.5, "9227000000.0": 52973400.6, "9228000000.0": 52973438.7, "9229000000.0": 52973476.7, "9230000000.0": 52973514.8, "9231000000.0": 52973552.9, "9232000000.0": 52973590.9, "9233000000.0": 52973629.0, "9234000000.0": 52973667.0, "9235000000.0": 52973705.0, "9236000000.0": 52973743.0, "9237000000.0": 52973781.0, "9238000000.0": 52973819.0, "9239000000.0": 52973857.0, "9240000000.0": 52973895.0, "9241000000.0": 52973933.0, "9242000000.0": 52973970.9, "9243000000.0": 52974008.9, "9244000000.0": 52974046.8, "9245000000.0": 52974084.8, "9246000000.0": 52974122.7, "9247000000.0": 52974160.6, "9248000000.0": 52974198.6, "9249000000.0": 52974236.5, "9250000000.0": 52974274.4, "9251000000.0": 52974312.3, "9252000000.0": 52974350.1, "9253000000.0": 52974388.0, "9254000000.0": 52974425.9, "9255000000.0": 52974463.7, "9256000000.0": 52974501.6, "9257000000.0": 52974539.4, "9258000000.0": 52974577.3, "9259000000.0": 52974615.1, "9260000000.0": 52974652.9, "9261000000.0": 52974690.7, "9262000000.0": 52974728.5, "9263000000.0": 52974766.3, "9264000000.0": 52974804.1, "9265000000.0": 52974841.9, "9266000000.0": 52974879.7, "9267000000.0": 52974917.4, "9268000000.0": 52974955.2, "9269000000.0": 52974992.9, "9270000000.0": 52975030.7, "9271000000.0": 52975068.4, "9272000000.0": 52975106.1, "9273000000.0": 52975143.8, "9274000000.0": 52975181.5, "9275000000.0": 52975219.2, "9276000000.0": 52975256.9, "9277000000.0": 52975294.6, "9278000000.0": 52975332.3, "9279000000.0": 52975370.0, "9280000000.0": 52975407.6, "9281000000.0": 52975445.3, "9282000000.0": 52975482.9, "9283000000.0": 52975520.5, "9284000000.0": 52975558.2, "9285000000.0": 52975595.8, "9286000000.0": 52975633.4, "9287000000.0": 52975671.0, "9288000000.0": 52975708.6, "9289000000.0": 52975746.2, "9290000000.0": 52975783.7, "9291000000.0": 52975821.3, "9292000000.0": 52975858.9, "9293000000.0": 52975896.4, "9294000000.0": 52975934.0, "9295000000.0": 52975971.5, "9296000000.0": 52976009.0, "9297000000.0": 52976046.6, "9298000000.0": 52976084.1, "9299000000.0": 52976121.6, "9300000000.0": 52976159.1, "9301000000.0": 52976196.6, "9302000000.0": 52976234.0, "9303000000.0": 52976271.5, "9304000000.0": 52976309.0, "9305000000.0": 52976346.4, "9306000000.0": 52976383.9, "9307000000.0": 52976421.3, "9308000000.0": 52976458.8, "9309000000.0": 52976496.2, "9310000000.0": 52976533.6, "9311000000.0": 52976571.0, "9312000000.0": 52976608.4, "9313000000.0": 52976645.8, "9314000000.0": 52976683.2, "9315000000.0": 52976720.6, "9316000000.0": 52976757.9, "9317000000.0": 52976795.3, "9318000000.0": 52976832.6, "9319000000.0": 52976870.0, "9320000000.0": 52976907.3, "9321000000.0": 52976944.7, "9322000000.0": 52976982.0, "9323000000.0": 52977019.3, "9324000000.0": 52977056.6, "9325000000.0": 52977093.9, "9326000000.0": 52977131.2, "9327000000.0": 52977168.5, "9328000000.0": 52977205.7, "9329000000.0": 52977243.0, "9330000000.0": 52977280.3, "9331000000.0": 52977317.5, "9332000000.0": 52977354.7, "9333000000.0": 52977392.0, "9334000000.0": 52977429.2, "9335000000.0": 52977466.4, "9336000000.0": 52977503.6, "9337000000.0": 52977540.8, "9338000000.0": 52977578.0, "9339000000.0": 52977615.2, "9340000000.0": 52977652.4, "9341000000.0": 52977689.6, "9342000000.0": 52977726.7, "9343000000.0": 52977763.9, "9344000000.0": 52977801.0, "9345000000.0": 52977838.2, "9346000000.0": 52977875.3, "9347000000.0": 52977912.4, "9348000000.0": 52977949.5, "9349000000.0": 52977986.6, "9350000000.0": 52978023.7, "9351000000.0": 52978060.8, "9352000000.0": 52978097.9, "9353000000.0": 52978135.0, "9354000000.0": 52978172.1, "9355000000.0": 52978209.1, "9356000000.0": 52978246.2, "9357000000.0": 52978283.2, "9358000000.0": 52978320.3, "9359000000.0": 52978357.3, "9360000000.0": 52978394.3, "9361000000.0": 52978431.3, "9362000000.0": 52978468.3, "9363000000.0": 52978505.3, "9364000000.0": 52978542.3, "9365000000.0": 52978579.3, "9366000000.0": 52978616.3, "9367000000.0": 52978653.2, "9368000000.0": 52978690.2, "9369000000.0": 52978727.1, "9370000000.0": 52978764.1, "9371000000.0": 52978801.0, "9372000000.0": 52978837.9, "9373000000.0": 52978874.9, "9374000000.0": 52978911.8, "9375000000.0": 52978948.7, "9376000000.0": 52978985.6, "9377000000.0": 52979022.5, "9378000000.0": 52979059.3, "9379000000.0": 52979096.2, "9380000000.0": 52979133.1, "9381000000.0": 52979169.9, "9382000000.0": 52979206.8, "9383000000.0": 52979243.6, "9384000000.0": 52979280.5, "9385000000.0": 52979317.3, "9386000000.0": 52979354.1, "9387000000.0": 52979390.9, "9388000000.0": 52979427.7, "9389000000.0": 52979464.5, "9390000000.0": 52979501.3, "9391000000.0": 52979538.1, "9392000000.0": 52979574.8, "9393000000.0": 52979611.6, "9394000000.0": 52979648.4, "9395000000.0": 52979685.1, "9396000000.0": 52979721.8, "9397000000.0": 52979758.6, "9398000000.0": 52979795.3, "9399000000.0": 52979832.0, "9400000000.0": 52979868.7, "9401000000.0": 52979905.4, "9402000000.0": 52979942.1, "9403000000.0": 52979978.8, "9404000000.0": 52980015.5, "9405000000.0": 52980052.1, "9406000000.0": 52980088.8, "9407000000.0": 52980125.5, "9408000000.0": 52980162.1, "9409000000.0": 52980198.7, "9410000000.0": 52980235.4, "9411000000.0": 52980272.0, "9412000000.0": 52980308.6, "9413000000.0": 52980345.2, "9414000000.0": 52980381.8, "9415000000.0": 52980418.4, "9416000000.0": 52980455.0, "9417000000.0": 52980491.6, "9418000000.0": 52980528.1, "9419000000.0": 52980564.7, "9420000000.0": 52980601.3, "9421000000.0": 52980637.8, "9422000000.0": 52980674.3, "9423000000.0": 52980710.9, "9424000000.0": 52980747.4, "9425000000.0": 52980783.9, "9426000000.0": 52980820.4, "9427000000.0": 52980856.9, "9428000000.0": 52980893.4, "9429000000.0": 52980929.9, "9430000000.0": 52980966.4, "9431000000.0": 52981002.8, "9432000000.0": 52981039.3, "9433000000.0": 52981075.8, "9434000000.0": 52981112.2, "9435000000.0": 52981148.6, "9436000000.0": 52981185.1, "9437000000.0": 52981221.5, "9438000000.0": 52981257.9, "9439000000.0": 52981294.3, "9440000000.0": 52981330.7, "9441000000.0": 52981367.1, "9442000000.0": 52981403.5, "9443000000.0": 52981439.9, "9444000000.0": 52981476.2, "9445000000.0": 52981512.6, "9446000000.0": 52981549.0, "9447000000.0": 52981585.3, "9448000000.0": 52981621.6, "9449000000.0": 52981658.0, "9450000000.0": 52981694.3, "9451000000.0": 52981730.6, "9452000000.0": 52981766.9, "9453000000.0": 52981803.2, "9454000000.0": 52981839.5, "9455000000.0": 52981875.8, "9456000000.0": 52981912.1, "9457000000.0": 52981948.4, "9458000000.0": 52981984.6, "9459000000.0": 52982020.9, "9460000000.0": 52982057.1, "9461000000.0": 52982093.4, "9462000000.0": 52982129.6, "9463000000.0": 52982165.8, "9464000000.0": 52982202.0, "9465000000.0": 52982238.2, "9466000000.0": 52982274.4, "9467000000.0": 52982310.6, "9468000000.0": 52982346.8, "9469000000.0": 52982383.0, "9470000000.0": 52982419.2, "9471000000.0": 52982455.3, "9472000000.0": 52982491.5, "9473000000.0": 52982527.6, "9474000000.0": 52982563.8, "9475000000.0": 52982599.9, "9476000000.0": 52982636.0, "9477000000.0": 52982672.2, "9478000000.0": 52982708.3, "9479000000.0": 52982744.4, "9480000000.0": 52982780.5, "9481000000.0": 52982816.6, "9482000000.0": 52982852.6, "9483000000.0": 52982888.7, "9484000000.0": 52982924.8, "9485000000.0": 52982960.8, "9486000000.0": 52982996.9, "9487000000.0": 52983032.9, "9488000000.0": 52983069.0, "9489000000.0": 52983105.0, "9490000000.0": 52983141.0, "9491000000.0": 52983177.0, "9492000000.0": 52983213.0, "9493000000.0": 52983249.0, "9494000000.0": 52983285.0, "9495000000.0": 52983321.0, "9496000000.0": 52983357.0, "9497000000.0": 52983392.9, "9498000000.0": 52983428.9, "9499000000.0": 52983464.8, "9500000000.0": 52983500.8, "9501000000.0": 52983536.7, "9502000000.0": 52983572.7, "9503000000.0": 52983608.6, "9504000000.0": 52983644.5, "9505000000.0": 52983680.4, "9506000000.0": 52983716.3, "9507000000.0": 52983752.2, "9508000000.0": 52983788.1, "9509000000.0": 52983824.0, "9510000000.0": 52983859.8, "9511000000.0": 52983895.7, "9512000000.0": 52983931.5, "9513000000.0": 52983967.4, "9514000000.0": 52984003.2, "9515000000.0": 52984039.1, "9516000000.0": 52984074.9, "9517000000.0": 52984110.7, "9518000000.0": 52984146.5, "9519000000.0": 52984182.3, "9520000000.0": 52984218.1, "9521000000.0": 52984253.9, "9522000000.0": 52984289.7, "9523000000.0": 52984325.4, "9524000000.0": 52984361.2, "9525000000.0": 52984397.0, "9526000000.0": 52984432.7, "9527000000.0": 52984468.5, "9528000000.0": 52984504.2, "9529000000.0": 52984539.9, "9530000000.0": 52984575.6, "9531000000.0": 52984611.4, "9532000000.0": 52984647.1, "9533000000.0": 52984682.8, "9534000000.0": 52984718.5, "9535000000.0": 52984754.1, "9536000000.0": 52984789.8, "9537000000.0": 52984825.5, "9538000000.0": 52984861.1, "9539000000.0": 52984896.8, "9540000000.0": 52984932.4, "9541000000.0": 52984968.1, "9542000000.0": 52985003.7, "9543000000.0": 52985039.3, "9544000000.0": 52985074.9, "9545000000.0": 52985110.6, "9546000000.0": 52985146.2, "9547000000.0": 52985181.8, "9548000000.0": 52985217.3, "9549000000.0": 52985252.9, "9550000000.0": 52985288.5, "9551000000.0": 52985324.1, "9552000000.0": 52985359.6, "9553000000.0": 52985395.2, "9554000000.0": 52985430.7, "9555000000.0": 52985466.2, "9556000000.0": 52985501.8, "9557000000.0": 52985537.3, "9558000000.0": 52985572.8, "9559000000.0": 52985608.3, "9560000000.0": 52985643.8, "9561000000.0": 52985679.3, "9562000000.0": 52985714.8, "9563000000.0": 52985750.2, "9564000000.0": 52985785.7, "9565000000.0": 52985821.2, "9566000000.0": 52985856.6, "9567000000.0": 52985892.1, "9568000000.0": 52985927.5, "9569000000.0": 52985962.9, "9570000000.0": 52985998.4, "9571000000.0": 52986033.8, "9572000000.0": 52986069.2, "9573000000.0": 52986104.6, "9574000000.0": 52986140.0, "9575000000.0": 52986175.4, "9576000000.0": 52986210.8, "9577000000.0": 52986246.1, "9578000000.0": 52986281.5, "9579000000.0": 52986316.9, "9580000000.0": 52986352.2, "9581000000.0": 52986387.6, "9582000000.0": 52986422.9, "9583000000.0": 52986458.2, "9584000000.0": 52986493.5, "9585000000.0": 52986528.9, "9586000000.0": 52986564.2, "9587000000.0": 52986599.5, "9588000000.0": 52986634.8, "9589000000.0": 52986670.0, "9590000000.0": 52986705.3, "9591000000.0": 52986740.6, "9592000000.0": 52986775.8, "9593000000.0": 52986811.1, "9594000000.0": 52986846.3, "9595000000.0": 52986881.6, "9596000000.0": 52986916.8, "9597000000.0": 52986952.1, "9598000000.0": 52986987.3, "9599000000.0": 52987022.5, "9600000000.0": 52987057.7, "9601000000.0": 52987092.9, "9602000000.0": 52987128.1, "9603000000.0": 52987163.3, "9604000000.0": 52987198.4, "9605000000.0": 52987233.6, "9606000000.0": 52987268.8, "9607000000.0": 52987303.9, "9608000000.0": 52987339.1, "9609000000.0": 52987374.2, "9610000000.0": 52987409.3, "9611000000.0": 52987444.5, "9612000000.0": 52987479.6, "9613000000.0": 52987514.7, "9614000000.0": 52987549.8, "9615000000.0": 52987584.9, "9616000000.0": 52987620.0, "9617000000.0": 52987655.0, "9618000000.0": 52987690.1, "9619000000.0": 52987725.2, "9620000000.0": 52987760.2, "9621000000.0": 52987795.3, "9622000000.0": 52987830.3, "9623000000.0": 52987865.4, "9624000000.0": 52987900.4, "9625000000.0": 52987935.4, "9626000000.0": 52987970.5, "9627000000.0": 52988005.5, "9628000000.0": 52988040.5, "9629000000.0": 52988075.5, "9630000000.0": 52988110.4, "9631000000.0": 52988145.4, "9632000000.0": 52988180.4, "9633000000.0": 52988215.4, "9634000000.0": 52988250.3, "9635000000.0": 52988285.3, "9636000000.0": 52988320.2, "9637000000.0": 52988355.1, "9638000000.0": 52988390.1, "9639000000.0": 52988425.0, "9640000000.0": 52988459.9, "9641000000.0": 52988494.8, "9642000000.0": 52988529.7, "9643000000.0": 52988564.6, "9644000000.0": 52988599.5, "9645000000.0": 52988634.4, "9646000000.0": 52988669.3, "9647000000.0": 52988704.1, "9648000000.0": 52988739.0, "9649000000.0": 52988773.8, "9650000000.0": 52988808.7, "9651000000.0": 52988843.5, "9652000000.0": 52988878.3, "9653000000.0": 52988913.2, "9654000000.0": 52988948.0, "9655000000.0": 52988982.8, "9656000000.0": 52989017.6, "9657000000.0": 52989052.4, "9658000000.0": 52989087.2, "9659000000.0": 52989121.9, "9660000000.0": 52989156.7, "9661000000.0": 52989191.5, "9662000000.0": 52989226.2, "9663000000.0": 52989261.0, "9664000000.0": 52989295.7, "9665000000.0": 52989330.5, "9666000000.0": 52989365.2, "9667000000.0": 52989399.9, "9668000000.0": 52989434.6, "9669000000.0": 52989469.3, "9670000000.0": 52989504.0, "9671000000.0": 52989538.7, "9672000000.0": 52989573.4, "9673000000.0": 52989608.1, "9674000000.0": 52989642.8, "9675000000.0": 52989677.4, "9676000000.0": 52989712.1, "9677000000.0": 52989746.7, "9678000000.0": 52989781.4, "9679000000.0": 52989816.0, "9680000000.0": 52989850.6, "9681000000.0": 52989885.3, "9682000000.0": 52989919.9, "9683000000.0": 52989954.5, "9684000000.0": 52989989.1, "9685000000.0": 52990023.7, "9686000000.0": 52990058.3, "9687000000.0": 52990092.8, "9688000000.0": 52990127.4, "9689000000.0": 52990162.0, "9690000000.0": 52990196.5, "9691000000.0": 52990231.1, "9692000000.0": 52990265.6, "9693000000.0": 52990300.2, "9694000000.0": 52990334.7, "9695000000.0": 52990369.2, "9696000000.0": 52990403.7, "9697000000.0": 52990438.2, "9698000000.0": 52990472.7, "9699000000.0": 52990507.2, "9700000000.0": 52990541.7, "9701000000.0": 52990576.2, "9702000000.0": 52990610.7, "9703000000.0": 52990645.1, "9704000000.0": 52990679.6, "9705000000.0": 52990714.0, "9706000000.0": 52990748.5, "9707000000.0": 52990782.9, "9708000000.0": 52990817.4, "9709000000.0": 52990851.8, "9710000000.0": 52990886.2, "9711000000.0": 52990920.6, "9712000000.0": 52990955.0, "9713000000.0": 52990989.4, "9714000000.0": 52991023.8, "9715000000.0": 52991058.2, "9716000000.0": 52991092.6, "9717000000.0": 52991126.9, "9718000000.0": 52991161.3, "9719000000.0": 52991195.6, "9720000000.0": 52991230.0, "9721000000.0": 52991264.3, "9722000000.0": 52991298.6, "9723000000.0": 52991333.0, "9724000000.0": 52991367.3, "9725000000.0": 52991401.6, "9726000000.0": 52991435.9, "9727000000.0": 52991470.2, "9728000000.0": 52991504.5, "9729000000.0": 52991538.8, "9730000000.0": 52991573.1, "9731000000.0": 52991607.3, "9732000000.0": 52991641.6, "9733000000.0": 52991675.8, "9734000000.0": 52991710.1, "9735000000.0": 52991744.3, "9736000000.0": 52991778.6, "9737000000.0": 52991812.8, "9738000000.0": 52991847.0, "9739000000.0": 52991881.2, "9740000000.0": 52991915.4, "9741000000.0": 52991949.6, "9742000000.0": 52991983.8, "9743000000.0": 52992018.0, "9744000000.0": 52992052.2, "9745000000.0": 52992086.4, "9746000000.0": 52992120.5, "9747000000.0": 52992154.7, "9748000000.0": 52992188.8, "9749000000.0": 52992223.0, "9750000000.0": 52992257.1, "9751000000.0": 52992291.2, "9752000000.0": 52992325.4, "9753000000.0": 52992359.5, "9754000000.0": 52992393.6, "9755000000.0": 52992427.7, "9756000000.0": 52992461.8, "9757000000.0": 52992495.9, "9758000000.0": 52992529.9, "9759000000.0": 52992564.0, "9760000000.0": 52992598.1, "9761000000.0": 52992632.1, "9762000000.0": 52992666.2, "9763000000.0": 52992700.2, "9764000000.0": 52992734.3, "9765000000.0": 52992768.3, "9766000000.0": 52992802.3, "9767000000.0": 52992836.4, "9768000000.0": 52992870.4, "9769000000.0": 52992904.4, "9770000000.0": 52992938.4, "9771000000.0": 52992972.4, "9772000000.0": 52993006.4, "9773000000.0": 52993040.3, "9774000000.0": 52993074.3, "9775000000.0": 52993108.3, "9776000000.0": 52993142.2, "9777000000.0": 52993176.2, "9778000000.0": 52993210.1, "9779000000.0": 52993244.0, "9780000000.0": 52993278.0, "9781000000.0": 52993311.9, "9782000000.0": 52993345.8, "9783000000.0": 52993379.7, "9784000000.0": 52993413.6, "9785000000.0": 52993447.5, "9786000000.0": 52993481.4, "9787000000.0": 52993515.3, "9788000000.0": 52993549.2, "9789000000.0": 52993583.0, "9790000000.0": 52993616.9, "9791000000.0": 52993650.7, "9792000000.0": 52993684.6, "9793000000.0": 52993718.4, "9794000000.0": 52993752.3, "9795000000.0": 52993786.1, "9796000000.0": 52993819.9, "9797000000.0": 52993853.7, "9798000000.0": 52993887.5, "9799000000.0": 52993921.3, "9800000000.0": 52993955.1, "9801000000.0": 52993988.9, "9802000000.0": 52994022.7, "9803000000.0": 52994056.4, "9804000000.0": 52994090.2, "9805000000.0": 52994124.0, "9806000000.0": 52994157.7, "9807000000.0": 52994191.4, "9808000000.0": 52994225.2, "9809000000.0": 52994258.9, "9810000000.0": 52994292.6, "9811000000.0": 52994326.4, "9812000000.0": 52994360.1, "9813000000.0": 52994393.8, "9814000000.0": 52994427.5, "9815000000.0": 52994461.1, "9816000000.0": 52994494.8, "9817000000.0": 52994528.5, "9818000000.0": 52994562.2, "9819000000.0": 52994595.8, "9820000000.0": 52994629.5, "9821000000.0": 52994663.1, "9822000000.0": 52994696.8, "9823000000.0": 52994730.4, "9824000000.0": 52994764.0, "9825000000.0": 52994797.7, "9826000000.0": 52994831.3, "9827000000.0": 52994864.9, "9828000000.0": 52994898.5, "9829000000.0": 52994932.1, "9830000000.0": 52994965.7, "9831000000.0": 52994999.2, "9832000000.0": 52995032.8, "9833000000.0": 52995066.4, "9834000000.0": 52995099.9, "9835000000.0": 52995133.5, "9836000000.0": 52995167.0, "9837000000.0": 52995200.6, "9838000000.0": 52995234.1, "9839000000.0": 52995267.6, "9840000000.0": 52995301.2, "9841000000.0": 52995334.7, "9842000000.0": 52995368.2, "9843000000.0": 52995401.7, "9844000000.0": 52995435.2, "9845000000.0": 52995468.6, "9846000000.0": 52995502.1, "9847000000.0": 52995535.6, "9848000000.0": 52995569.1, "9849000000.0": 52995602.5, "9850000000.0": 52995636.0, "9851000000.0": 52995669.4, "9852000000.0": 52995702.9, "9853000000.0": 52995736.3, "9854000000.0": 52995769.7, "9855000000.0": 52995803.1, "9856000000.0": 52995836.5, "9857000000.0": 52995869.9, "9858000000.0": 52995903.3, "9859000000.0": 52995936.7, "9860000000.0": 52995970.1, "9861000000.0": 52996003.5, "9862000000.0": 52996036.9, "9863000000.0": 52996070.2, "9864000000.0": 52996103.6, "9865000000.0": 52996136.9, "9866000000.0": 52996170.3, "9867000000.0": 52996203.6, "9868000000.0": 52996236.9, "9869000000.0": 52996270.3, "9870000000.0": 52996303.6, "9871000000.0": 52996336.9, "9872000000.0": 52996370.2, "9873000000.0": 52996403.5, "9874000000.0": 52996436.8, "9875000000.0": 52996470.1, "9876000000.0": 52996503.3, "9877000000.0": 52996536.6, "9878000000.0": 52996569.9, "9879000000.0": 52996603.1, "9880000000.0": 52996636.4, "9881000000.0": 52996669.6, "9882000000.0": 52996702.9, "9883000000.0": 52996736.1, "9884000000.0": 52996769.3, "9885000000.0": 52996802.5, "9886000000.0": 52996835.7, "9887000000.0": 52996868.9, "9888000000.0": 52996902.1, "9889000000.0": 52996935.3, "9890000000.0": 52996968.5, "9891000000.0": 52997001.7, "9892000000.0": 52997034.8, "9893000000.0": 52997068.0, "9894000000.0": 52997101.2, "9895000000.0": 52997134.3, "9896000000.0": 52997167.5, "9897000000.0": 52997200.6, "9898000000.0": 52997233.7, "9899000000.0": 52997266.8, "9900000000.0": 52997300.0, "9901000000.0": 52997333.1, "9902000000.0": 52997366.2, "9903000000.0": 52997399.3, "9904000000.0": 52997432.4, "9905000000.0": 52997465.4, "9906000000.0": 52997498.5, "9907000000.0": 52997531.6, "9908000000.0": 52997564.7, "9909000000.0": 52997597.7, "9910000000.0": 52997630.8, "9911000000.0": 52997663.8, "9912000000.0": 52997696.8, "9913000000.0": 52997729.9, "9914000000.0": 52997762.9, "9915000000.0": 52997795.9, "9916000000.0": 52997828.9, "9917000000.0": 52997861.9, "9918000000.0": 52997894.9, "9919000000.0": 52997927.9, "9920000000.0": 52997960.9, "9921000000.0": 52997993.9, "9922000000.0": 52998026.8, "9923000000.0": 52998059.8, "9924000000.0": 52998092.8, "9925000000.0": 52998125.7, "9926000000.0": 52998158.7, "9927000000.0": 52998191.6, "9928000000.0": 52998224.5, "9929000000.0": 52998257.5, "9930000000.0": 52998290.4, "9931000000.0": 52998323.3, "9932000000.0": 52998356.2, "9933000000.0": 52998389.1, "9934000000.0": 52998422.0, "9935000000.0": 52998454.9, "9936000000.0": 52998487.7, "9937000000.0": 52998520.6, "9938000000.0": 52998553.5, "9939000000.0": 52998586.3, "9940000000.0": 52998619.2, "9941000000.0": 52998652.0, "9942000000.0": 52998684.9, "9943000000.0": 52998717.7, "9944000000.0": 52998750.5, "9945000000.0": 52998783.3, "9946000000.0": 52998816.2, "9947000000.0": 52998849.0, "9948000000.0": 52998881.8, "9949000000.0": 52998914.6, "9950000000.0": 52998947.3, "9951000000.0": 52998980.1, "9952000000.0": 52999012.9, "9953000000.0": 52999045.7, "9954000000.0": 52999078.4, "9955000000.0": 52999111.2, "9956000000.0": 52999143.9, "9957000000.0": 52999176.7, "9958000000.0": 52999209.4, "9959000000.0": 52999242.1, "9960000000.0": 52999274.8, "9961000000.0": 52999307.6, "9962000000.0": 52999340.3, "9963000000.0": 52999373.0, "9964000000.0": 52999405.7, "9965000000.0": 52999438.4, "9966000000.0": 52999471.0, "9967000000.0": 52999503.7, "9968000000.0": 52999536.4, "9969000000.0": 52999569.0, "9970000000.0": 52999601.7, "9971000000.0": 52999634.3, "9972000000.0": 52999667.0, "9973000000.0": 52999699.6, "9974000000.0": 52999732.3, "9975000000.0": 52999764.9, "9976000000.0": 52999797.5, "9977000000.0": 52999830.1, "9978000000.0": 52999862.7, "9979000000.0": 52999895.3, "9980000000.0": 52999927.9, "9981000000.0": 52999960.5, "9982000000.0": 52999993.1, "9983000000.0": 53000025.6, "9984000000.0": 53000058.2, "9985000000.0": 53000090.8, "9986000000.0": 53000123.3, "9987000000.0": 53000155.9, "9988000000.0": 53000188.4, "9989000000.0": 53000220.9, "9990000000.0": 53000253.4, "9991000000.0": 53000286.0, "9992000000.0": 53000318.5, "9993000000.0": 53000351.0, "9994000000.0": 53000383.5, "9995000000.0": 53000416.0, "9996000000.0": 53000448.5, "9997000000.0": 53000480.9, "9998000000.0": 53000513.4, "9999000000.0": 53000545.9 } }, "multiqc_rseqc_read_distribution": { "rna_s1200_S21": { "total_reads": 19858288, "total_tags": 32030003, "total_assigned_tags": 31966496, "cds_exons_total_bases": 111612535, "cds_exons_tag_count": 30972808, "cds_exons_tags_kb": 277.5, "5_utr_exons_total_bases": 6635204, "5_utr_exons_tag_count": 221695, "5_utr_exons_tags_kb": 33.41, "3_utr_exons_total_bases": 33086090, "3_utr_exons_tag_count": 208436, "3_utr_exons_tags_kb": 6.3, "introns_total_bases": 1590620055, "introns_tag_count": 551523, "introns_tags_kb": 0.35, "tss_up_1kb_total_bases": 29236783, "tss_up_1kb_tag_count": 2592, "tss_up_1kb_tags_kb": 0.09, "tss_up_5kb_tags_kb": 0.04, "tss_up_10kb_tags_kb": 0.03, "tes_down_1kb_total_bases": 31571234, "tes_down_1kb_tag_count": 2432, "tes_down_1kb_tags_kb": 0.08, "tes_down_5kb_tags_kb": 0.03, "tes_down_10kb_tags_kb": 0.02, "other_intergenic_tag_count": 63507, "cds_exons_tag_pct": 96.69936028416856, "5_utr_exons_tag_pct": 0.6921479214347872, "3_utr_exons_tag_pct": 0.6507523586557267, "introns_tag_pct": 1.7218949370688477, "tss_up_1kb_tag_pct": 0.00809241260451958, "tss_up_5kb_tag_pct": 0.015182639851766483, "tss_up_10kb_tag_pct": 0.02373711922537129, "tes_down_1kb_tag_pct": 0.007592880962265286, "tes_down_5kb_tag_pct": 0.011773336393380919, "tes_down_10kb_tag_pct": 0.013833904417679885, "other_intergenic_tag_pct": 0.198273475029022, "tss_up_5kb-10kb_total_bases": 101353510, "tss_up_1kb-5kb_total_bases": 100685489, "tss_up_5kb-10kb_tag_count": 2740, "tss_up_1kb-5kb_tag_count": 2271, "tes_down_5kb-10kb_total_bases": 101876388, "tes_down_1kb-5kb_total_bases": 104266808, "tes_down_5kb-10kb_tag_count": 660, "tes_down_1kb-5kb_tag_count": 1339 }, "rna_s1221_S42": { "total_reads": 19856025, "total_tags": 31522500, "total_assigned_tags": 31286245, "cds_exons_total_bases": 111612535, "cds_exons_tag_count": 30188954, "cds_exons_tags_kb": 270.48, "5_utr_exons_total_bases": 6635204, "5_utr_exons_tag_count": 219647, "5_utr_exons_tags_kb": 33.1, "3_utr_exons_total_bases": 33086090, "3_utr_exons_tag_count": 200962, "3_utr_exons_tags_kb": 6.07, "introns_total_bases": 1590620055, "introns_tag_count": 662649, "introns_tags_kb": 0.42, "tss_up_1kb_total_bases": 29236783, "tss_up_1kb_tag_count": 2778, "tss_up_1kb_tags_kb": 0.1, "tss_up_5kb_tags_kb": 0.04, "tss_up_10kb_tags_kb": 0.03, "tes_down_1kb_total_bases": 31571234, "tes_down_1kb_tag_count": 2422, "tes_down_1kb_tags_kb": 0.08, "tes_down_5kb_tags_kb": 0.04, "tes_down_10kb_tags_kb": 0.03, "other_intergenic_tag_count": 236255, "cds_exons_tag_pct": 95.7695423903561, "5_utr_exons_tag_pct": 0.6967943532397494, "3_utr_exons_tag_pct": 0.6375192322943929, "introns_tag_pct": 2.1021460861289554, "tss_up_1kb_tag_pct": 0.008812752795622174, "tss_up_5kb_tag_pct": 0.015230390990562297, "tss_up_10kb_tag_pct": 0.024147830914426203, "tes_down_1kb_tag_pct": 0.0076834007454992465, "tes_down_5kb_tag_pct": 0.01843445158220319, "tes_down_10kb_tag_pct": 0.020369577286065508, "other_intergenic_tag_pct": 0.7494805297803157, "tss_up_5kb-10kb_total_bases": 101353510, "tss_up_1kb-5kb_total_bases": 100685489, "tss_up_5kb-10kb_tag_count": 2811, "tss_up_1kb-5kb_tag_count": 2023, "tes_down_5kb-10kb_total_bases": 101876388, "tes_down_1kb-5kb_total_bases": 104266808, "tes_down_5kb-10kb_tag_count": 610, "tes_down_1kb-5kb_tag_count": 3389 } }, "rseqc_inner_distance": { "rna_s1200_S21": { "-247.5": 0.0, "-242.5": 0.0, "-237.5": 0.0, "-232.5": 0.0, "-227.5": 0.0, "-222.5": 0.0, "-217.5": 0.0, "-212.5": 0.0, "-207.5": 0.0, "-202.5": 0.0, "-197.5": 0.0, "-192.5": 0.0, "-187.5": 0.0, "-182.5": 0.0, "-177.5": 0.0, "-172.5": 0.0, "-167.5": 0.0, "-162.5": 0.0, "-157.5": 0.0, "-152.5": 5634.0, "-147.5": 59131.0, "-142.5": 62494.0, "-137.5": 62358.0, "-132.5": 61106.0, "-127.5": 59172.0, "-122.5": 56093.0, "-117.5": 54668.0, "-112.5": 49941.0, "-107.5": 47216.0, "-102.5": 42115.0, "-97.5": 38389.0, "-92.5": 33529.0, "-87.5": 30303.0, "-82.5": 26252.0, "-77.5": 23370.0, "-72.5": 20757.0, "-67.5": 18780.0, "-62.5": 17315.0, "-57.5": 16131.0, "-52.5": 15216.0, "-47.5": 13742.0, "-42.5": 13380.0, "-37.5": 12359.0, "-32.5": 11796.0, "-27.5": 10900.0, "-22.5": 10380.0, "-17.5": 9703.0, "-12.5": 8805.0, "-7.5": 7819.0, "-2.5": 7286.0, "2.5": 7367.0, "7.5": 6585.0, "12.5": 6023.0, "17.5": 5504.0, "22.5": 5145.0, "27.5": 4706.0, "32.5": 4174.0, "37.5": 3853.0, "42.5": 3490.0, "47.5": 3321.0, "52.5": 2853.0, "57.5": 2568.0, "62.5": 2250.0, "67.5": 2191.0, "72.5": 2012.0, "77.5": 1816.0, "82.5": 1598.0, "87.5": 1581.0, "92.5": 1340.0, "97.5": 1267.0, "102.5": 1165.0, "107.5": 978.0, "112.5": 961.0, "117.5": 830.0, "122.5": 783.0, "127.5": 694.0, "132.5": 665.0, "137.5": 658.0, "142.5": 593.0, "147.5": 494.0, "152.5": 469.0, "157.5": 434.0, "162.5": 423.0, "167.5": 346.0, "172.5": 335.0, "177.5": 312.0, "182.5": 270.0, "187.5": 277.0, "192.5": 232.0, "197.5": 231.0, "202.5": 274.0, "207.5": 228.0, "212.5": 227.0, "217.5": 191.0, "222.5": 189.0, "227.5": 202.0, "232.5": 194.0, "237.5": 159.0, "242.5": 156.0, "247.5": 153.0 }, "rna_s1221_S42": { "-247.5": 0.0, "-242.5": 0.0, "-237.5": 0.0, "-232.5": 0.0, "-227.5": 0.0, "-222.5": 0.0, "-217.5": 0.0, "-212.5": 0.0, "-207.5": 0.0, "-202.5": 0.0, "-197.5": 0.0, "-192.5": 0.0, "-187.5": 0.0, "-182.5": 0.0, "-177.5": 0.0, "-172.5": 0.0, "-167.5": 0.0, "-162.5": 0.0, "-157.5": 0.0, "-152.5": 5554.0, "-147.5": 59686.0, "-142.5": 62667.0, "-137.5": 62535.0, "-132.5": 61101.0, "-127.5": 59846.0, "-122.5": 57310.0, "-117.5": 56139.0, "-112.5": 51847.0, "-107.5": 49780.0, "-102.5": 45006.0, "-97.5": 40488.0, "-92.5": 36117.0, "-87.5": 31737.0, "-82.5": 27864.0, "-77.5": 23912.0, "-72.5": 20787.0, "-67.5": 17992.0, "-62.5": 15957.0, "-57.5": 14757.0, "-52.5": 13830.0, "-47.5": 12853.0, "-42.5": 12201.0, "-37.5": 11178.0, "-32.5": 10499.0, "-27.5": 9874.0, "-22.5": 9531.0, "-17.5": 8787.0, "-12.5": 8043.0, "-7.5": 6903.0, "-2.5": 6751.0, "2.5": 6759.0, "7.5": 6092.0, "12.5": 5415.0, "17.5": 5291.0, "22.5": 4581.0, "27.5": 4224.0, "32.5": 3900.0, "37.5": 3560.0, "42.5": 3192.0, "47.5": 2998.0, "52.5": 2707.0, "57.5": 2461.0, "62.5": 2262.0, "67.5": 2017.0, "72.5": 1896.0, "77.5": 1789.0, "82.5": 1595.0, "87.5": 1464.0, "92.5": 1304.0, "97.5": 1324.0, "102.5": 1143.0, "107.5": 1031.0, "112.5": 949.0, "117.5": 892.0, "122.5": 769.0, "127.5": 740.0, "132.5": 667.0, "137.5": 649.0, "142.5": 585.0, "147.5": 549.0, "152.5": 532.0, "157.5": 475.0, "162.5": 459.0, "167.5": 388.0, "172.5": 333.0, "177.5": 332.0, "182.5": 327.0, "187.5": 300.0, "192.5": 269.0, "197.5": 279.0, "202.5": 244.0, "207.5": 254.0, "212.5": 254.0, "217.5": 211.0, "222.5": 186.0, "227.5": 199.0, "232.5": 187.0, "237.5": 188.0, "242.5": 149.0, "247.5": 187.0 } }, "rseqc_read_dups": { "rna_s1221_S42": { "1": 3518947, "2": 3407472, "3": 417925, "4": 512661, "5": 113292, "6": 127555, "7": 46029, "8": 49661, "9": 23655, "10": 25303, "11": 13477, "12": 14865, "13": 8729, "14": 9556, "15": 6025, "16": 6753, "17": 4346, "18": 4755, "19": 3246, "20": 3556, "21": 2468, "22": 2752, "23": 1882, "24": 2160, "25": 1615, "26": 1888, "27": 1322, "28": 1460, "29": 1063, "30": 1151, "31": 863, "32": 1043, "33": 712, "34": 886, "35": 645, "36": 681, "37": 563, "38": 662, "39": 478, "40": 559, "41": 444, "42": 465, "43": 373, "44": 464, "45": 366, "46": 394, "47": 306, "48": 341, "49": 254, "50": 312, "51": 242, "52": 291, "53": 231, "54": 236, "55": 245, "56": 199, "57": 194, "58": 228, "59": 195, "60": 188, "61": 169, "62": 178, "63": 139, "64": 151, "65": 137, "66": 137, "67": 125, "68": 114, "69": 117, "70": 115, "71": 98, "72": 115, "73": 115, "74": 111, "75": 92, "76": 116, "77": 85, "78": 102, "79": 73, "80": 70, "81": 70, "82": 89, "83": 84, "84": 80, "85": 69, "86": 59, "87": 70, "88": 68, "89": 69, "90": 65, "91": 52, "92": 50, "93": 48, "94": 57, "95": 41, "96": 57, "97": 42, "98": 44, "99": 42, "100": 42, "101": 41, "102": 44, "103": 47, "104": 37, "105": 38, "106": 36, "107": 26, "108": 52, "109": 45, "110": 41, "111": 29, "112": 37, "113": 26, "114": 27, "115": 22, "116": 28, "117": 23, "118": 36, "119": 22, "120": 23, "121": 19, "122": 28, "123": 25, "124": 30, "125": 22, "126": 36, "127": 20, "128": 20, "129": 15, "130": 19, "131": 25, "132": 23, "133": 23, "134": 18, "135": 17, "136": 22, "137": 15, "138": 22, "139": 16, "140": 17, "141": 17, "142": 14, "143": 20, "144": 16, "145": 24, "146": 15, "147": 16, "148": 11, "149": 16, "150": 19, "151": 8, "152": 10, "153": 8, "154": 15, "155": 12, "156": 13, "157": 17, "158": 9, "159": 14, "160": 17, "161": 5, "162": 5, "163": 5, "164": 7, "165": 15, "166": 9, "167": 14, "168": 7, "169": 11, "170": 11, "171": 12, "172": 16, "173": 4, "174": 11, "175": 6, "176": 9, "177": 8, "178": 10, "179": 7, "180": 13, "181": 7, "182": 12, "183": 9, "184": 6, "185": 6, "186": 12, "187": 5, "188": 4, "189": 11, "190": 7, "191": 2, "192": 7, "193": 4, "194": 6, "195": 9, "196": 7, "197": 8, "198": 5, "199": 4, "200": 13, "201": 6, "202": 9, "203": 1, "204": 6, "205": 5, "206": 3, "207": 4, "208": 6, "209": 2, "210": 5, "211": 5, "212": 4, "213": 4, "214": 3, "215": 5, "216": 3, "217": 10, "218": 4, "219": 3, "220": 3, "221": 3, "222": 8, "223": 7, "224": 2, "225": 1, "226": 4, "227": 2, "228": 2, "229": 1, "230": 3, "231": 3, "232": 4, "233": 4, "234": 5, "235": 1, "236": 7, "237": 6, "238": 6, "239": 6, "240": 3, "241": 6, "242": 2, "243": 3, "245": 2, "246": 4, "247": 4, "248": 2, "250": 5, "251": 2, "253": 2, "254": 4, "255": 5, "256": 4, "257": 2, "258": 1, "259": 4, "260": 1, "261": 3, "262": 3, "263": 3, "264": 2, "265": 6, "267": 3, "268": 2, "269": 3, "270": 2, "271": 3, "272": 2, "273": 2, "274": 1, "275": 1, "276": 2, "277": 5, "278": 2, "280": 2, "281": 5, "282": 8, "283": 1, "284": 2, "285": 2, "286": 1, "287": 1, "289": 2, "290": 6, "293": 3, "294": 1, "297": 1, "298": 2, "301": 1, "302": 3, "306": 1, "307": 1, "308": 3, "309": 1, "310": 2, "311": 3, "312": 4, "313": 3, "314": 4, "316": 2, "317": 2, "318": 1, "320": 3, "321": 1, "322": 5, "323": 1, "324": 4, "325": 3, "326": 2, "327": 2, "328": 1, "330": 4, "331": 1, "333": 1, "335": 1, "336": 3, "338": 1, "339": 1, "341": 2, "342": 1, "344": 2, "349": 2, "350": 2, "351": 2, "352": 2, "355": 1, "356": 1, "357": 1, "358": 1, "359": 2, "360": 2, "363": 2, "365": 1, "366": 2, "368": 1, "369": 1, "371": 2, "372": 1, "373": 1, "374": 1, "376": 1, "377": 2, "378": 1, "380": 1, "382": 1, "383": 1, "384": 2, "386": 1, "392": 1, "394": 2, "395": 1, "397": 1, "398": 1, "399": 1, "401": 2, "403": 1, "404": 1, "405": 1, "407": 1, "408": 1, "412": 3, "413": 1, "415": 1, "416": 2, "418": 1, "419": 1, "421": 1, "422": 1, "428": 1, "438": 1, "440": 1, "441": 1, "446": 1, "447": 1, "452": 1, "454": 1, "461": 1, "468": 1, "470": 1, "475": 1, "477": 3, "479": 1, "481": 1, "484": 2, "486": 1, "490": 1 }, "rna_s1200_S21": { "1": 3835018, "2": 3357152, "3": 451631, "4": 497856, "5": 122769, "6": 123212, "7": 49780, "8": 48060, "9": 25084, "10": 24506, "11": 14630, "12": 14503, "13": 9119, "14": 9319, "15": 6183, "16": 6300, "17": 4524, "18": 4512, "19": 3433, "20": 3473, "21": 2557, "22": 2669, "23": 2016, "24": 2116, "25": 1684, "26": 1734, "27": 1340, "28": 1421, "29": 1090, "30": 1141, "31": 913, "32": 964, "33": 808, "34": 898, "35": 701, "36": 655, "37": 641, "38": 593, "39": 531, "40": 589, "41": 436, "42": 492, "43": 430, "44": 452, "45": 356, "46": 355, "47": 362, "48": 325, "49": 289, "50": 298, "51": 286, "52": 290, "53": 269, "54": 273, "55": 220, "56": 208, "57": 201, "58": 192, "59": 186, "60": 190, "61": 163, "62": 139, "63": 143, "64": 156, "65": 157, "66": 145, "67": 141, "68": 126, "69": 138, "70": 123, "71": 126, "72": 122, "73": 95, "74": 94, "75": 116, "76": 113, "77": 103, "78": 94, "79": 91, "80": 94, "81": 86, "82": 77, "83": 80, "84": 66, "85": 61, "86": 49, "87": 56, "88": 57, "89": 62, "90": 64, "91": 50, "92": 63, "93": 59, "94": 60, "95": 58, "96": 53, "97": 48, "98": 52, "99": 56, "100": 33, "101": 45, "102": 46, "103": 49, "104": 41, "105": 44, "106": 45, "107": 34, "108": 38, "109": 31, "110": 45, "111": 35, "112": 34, "113": 41, "114": 33, "115": 36, "116": 23, "117": 28, "118": 23, "119": 31, "120": 34, "121": 29, "122": 19, "123": 28, "124": 31, "125": 21, "126": 29, "127": 21, "128": 22, "129": 23, "130": 13, "131": 24, "132": 19, "133": 19, "134": 19, "135": 26, "136": 21, "137": 14, "138": 13, "139": 17, "140": 21, "141": 21, "142": 15, "143": 13, "144": 21, "145": 14, "146": 14, "147": 12, "148": 22, "149": 11, "150": 18, "151": 15, "152": 18, "153": 9, "154": 13, "155": 15, "156": 12, "157": 13, "158": 15, "159": 12, "160": 12, "161": 15, "162": 19, "163": 11, "164": 15, "165": 8, "166": 9, "167": 16, "168": 12, "169": 8, "170": 12, "171": 8, "172": 10, "173": 8, "174": 11, "175": 7, "176": 13, "177": 4, "178": 7, "179": 9, "180": 5, "181": 9, "182": 9, "183": 8, "184": 13, "185": 8, "186": 13, "187": 5, "188": 8, "189": 4, "190": 4, "191": 6, "192": 5, "193": 4, "194": 5, "195": 5, "196": 14, "197": 6, "198": 10, "199": 11, "200": 13, "201": 4, "202": 5, "203": 4, "204": 6, "205": 4, "206": 6, "207": 7, "208": 7, "209": 7, "210": 4, "211": 5, "212": 4, "213": 1, "214": 7, "215": 5, "216": 7, "217": 5, "218": 1, "219": 8, "220": 8, "221": 6, "222": 6, "223": 4, "224": 4, "225": 4, "226": 5, "227": 5, "228": 3, "229": 1, "230": 8, "231": 2, "232": 7, "233": 4, "234": 4, "235": 3, "236": 3, "237": 4, "238": 1, "239": 3, "240": 7, "241": 1, "242": 1, "243": 4, "244": 2, "246": 3, "247": 2, "248": 4, "249": 3, "250": 5, "251": 2, "252": 2, "253": 4, "254": 2, "255": 1, "256": 2, "257": 2, "258": 1, "259": 4, "260": 4, "261": 3, "263": 1, "264": 1, "265": 2, "266": 3, "267": 1, "268": 2, "269": 2, "270": 6, "271": 4, "272": 1, "274": 2, "276": 3, "277": 3, "278": 4, "280": 1, "281": 5, "282": 2, "283": 5, "284": 1, "285": 6, "286": 3, "288": 4, "289": 2, "290": 3, "291": 1, "292": 2, "293": 1, "294": 1, "295": 4, "296": 2, "297": 2, "299": 3, "300": 1, "301": 2, "302": 3, "303": 1, "304": 1, "305": 2, "306": 2, "307": 3, "308": 1, "309": 1, "310": 4, "311": 2, "312": 4, "313": 1, "314": 5, "315": 2, "316": 2, "317": 1, "318": 1, "319": 3, "320": 1, "321": 1, "322": 3, "323": 3, "324": 1, "326": 1, "327": 2, "328": 2, "329": 1, "332": 2, "333": 1, "335": 2, "336": 1, "337": 2, "338": 3, "339": 2, "341": 1, "342": 1, "343": 3, "345": 2, "346": 1, "348": 2, "349": 3, "352": 1, "354": 1, "355": 1, "356": 1, "358": 1, "360": 1, "364": 1, "367": 1, "369": 1, "370": 1, "374": 1, "375": 1, "376": 2, "378": 1, "380": 1, "382": 2, "383": 1, "384": 1, "388": 1, "389": 1, "390": 1, "391": 1, "393": 1, "394": 2, "396": 2, "398": 1, "399": 2, "400": 1, "404": 2, "405": 1, "406": 2, "407": 1, "412": 3, "414": 1, "417": 2, "419": 1, "421": 1, "423": 2, "426": 1, "432": 1, "433": 2, "435": 2, "441": 1, "449": 1, "450": 2, "451": 1, "461": 1, "463": 2, "466": 1, "474": 2, "481": 1, "482": 1, "483": 1, "498": 1 } }, "multiqc_rseqc_junction_annotation": { "rna_s1221_S42": { "total_splicing_events": 11219780, "known_splicing_events": 11135135, "partial_novel_splicing_events": 59248, "novel_splicing_events": 23159, "total_splicing_junctions": 175854, "known_splicing_junctions": 148597, "partial_novel_splicing_junctions": 21832, "novel_splicing_junctions": 5425, "known_splicing_events_pct": 99.24557344261652, "partial_novel_splicing_events_pct": 0.5280673952608697, "novel_splicing_events_pct": 0.20641224694245341, "known_splicing_junctions_pct": 84.50021040181059, "partial_novel_splicing_junctions_pct": 12.414844132064099, "novel_splicing_junctions_pct": 3.0849454661253084 }, "rna_s1200_S21": { "total_splicing_events": 11742011, "known_splicing_events": 11650978, "partial_novel_splicing_events": 63942, "novel_splicing_events": 24871, "total_splicing_junctions": 179703, "known_splicing_junctions": 150896, "partial_novel_splicing_junctions": 23555, "novel_splicing_junctions": 5252, "known_splicing_events_pct": 99.22472394209136, "partial_novel_splicing_events_pct": 0.5445574867882511, "novel_splicing_events_pct": 0.21181209930735034, "known_splicing_junctions_pct": 83.96966105184666, "partial_novel_splicing_junctions_pct": 13.107738880263545, "novel_splicing_junctions_pct": 2.922600067889796 } }, "rseqc_junction_saturation_all": { "rna_s1221_S42": { "5.0": 94087.0, "10.0": 112927.0, "15.0": 123669.0, "20.0": 131331.0, "25.0": 137453.0, "30.0": 142546.0, "35.0": 147037.0, "40.0": 151074.0, "45.0": 154402.0, "50.0": 157431.0, "55.0": 160158.0, "60.0": 162635.0, "65.0": 164828.0, "70.0": 166908.0, "75.0": 168771.0, "80.0": 170483.0, "85.0": 172035.0, "90.0": 173425.0, "95.0": 174698.0, "100.0": 175815.0 }, "rna_s1200_S21": { "5.0": 95835.0, "10.0": 114715.0, "15.0": 125479.0, "20.0": 133430.0, "25.0": 139704.0, "30.0": 144961.0, "35.0": 149505.0, "40.0": 153585.0, "45.0": 157124.0, "50.0": 160313.0, "55.0": 163251.0, "60.0": 165898.0, "65.0": 168320.0, "70.0": 170501.0, "75.0": 172420.0, "80.0": 174146.0, "85.0": 175741.0, "90.0": 177165.0, "95.0": 178481.0, "100.0": 179686.0 } }, "junction_saturation_known": { "rna_s1221_S42": { "5.0": 89612.0, "10.0": 104860.0, "15.0": 112553.0, "20.0": 117442.0, "25.0": 121093.0, "30.0": 123895.0, "35.0": 126246.0, "40.0": 128299.0, "45.0": 129894.0, "50.0": 131324.0, "55.0": 132571.0, "60.0": 133641.0, "65.0": 134549.0, "70.0": 135390.0, "75.0": 136154.0, "80.0": 136880.0, "85.0": 137514.0, "90.0": 138064.0, "95.0": 138546.0, "100.0": 139001.0 }, "rna_s1200_S21": { "5.0": 91163.0, "10.0": 106211.0, "15.0": 113769.0, "20.0": 118742.0, "25.0": 122387.0, "30.0": 125236.0, "35.0": 127563.0, "40.0": 129538.0, "45.0": 131245.0, "50.0": 132712.0, "55.0": 133966.0, "60.0": 135095.0, "65.0": 136078.0, "70.0": 136973.0, "75.0": 137727.0, "80.0": 138410.0, "85.0": 139063.0, "90.0": 139633.0, "95.0": 140115.0, "100.0": 140590.0 } }, "junction_saturation_novel": { "rna_s1221_S42": { "5.0": 4475.0, "10.0": 8067.0, "15.0": 11116.0, "20.0": 13889.0, "25.0": 16360.0, "30.0": 18651.0, "35.0": 20791.0, "40.0": 22775.0, "45.0": 24508.0, "50.0": 26107.0, "55.0": 27587.0, "60.0": 28994.0, "65.0": 30279.0, "70.0": 31518.0, "75.0": 32617.0, "80.0": 33603.0, "85.0": 34521.0, "90.0": 35361.0, "95.0": 36152.0, "100.0": 36814.0 }, "rna_s1200_S21": { "5.0": 4672.0, "10.0": 8504.0, "15.0": 11710.0, "20.0": 14688.0, "25.0": 17317.0, "30.0": 19725.0, "35.0": 21942.0, "40.0": 24047.0, "45.0": 25879.0, "50.0": 27601.0, "55.0": 29285.0, "60.0": 30803.0, "65.0": 32242.0, "70.0": 33528.0, "75.0": 34693.0, "80.0": 35736.0, "85.0": 36678.0, "90.0": 37532.0, "95.0": 38366.0, "100.0": 39096.0 } }, "multiqc_rseqc_infer_experiment": { "rna_s1221_S42": { "pe_sense": 0.01, "pe_antisense": 0.9584, "failed": 0.0317 }, "rna_s1200_S21": { "pe_sense": 0.0169, "pe_antisense": 0.9607, "failed": 0.0224 } }, "multiqc_rseqc_bam_stat": { "rna_s1221_S42": { "total_records": 23448462, "qc_failed": 0, "optical_pcr_duplicate": 0, "non_primary_hits": 3505214, "unmapped_reads": 87223, "mapq_lt_mapq_cut_non-unique": 991412, "mapq_gte_mapq_cut_unique": 18864613, "read_1": 9436036, "read_2": 9428577, "reads_map_to_sense": 9432352, "reads_map_to_antisense": 9432261, "non-splice_reads": 8963248, "splice_reads": 9901365, "reads_mapped_in_proper_pairs": 18817394, "proper-paired_reads_map_to_different_chrom": 0, "unique_percent": 80.45138738736894, "proper_pairs_percent": 80.25001383886074 }, "rna_s1200_S21": { "total_records": 21201423, "qc_failed": 0, "optical_pcr_duplicate": 0, "non_primary_hits": 1266553, "unmapped_reads": 76582, "mapq_lt_mapq_cut_non-unique": 658159, "mapq_gte_mapq_cut_unique": 19200129, "read_1": 9603113, "read_2": 9597016, "reads_map_to_sense": 9600541, "reads_map_to_antisense": 9599588, "non-splice_reads": 8867379, "splice_reads": 10332750, "reads_mapped_in_proper_pairs": 19152518, "proper-paired_reads_map_to_different_chrom": 0, "unique_percent": 90.56056756190375, "proper_pairs_percent": 90.33600244662823 } }, "multiqc_star": { "rna_s1200_S21": { "total_reads": 9937706.0, "avg_input_read_length": 281.0, "uniquely_mapped": 9534804.0, "uniquely_mapped_percent": 95.95, "avg_mapped_read_length": 280.54, "num_splices": 11712172.0, "num_annotated_splices": 11589231.0, "num_GTAG_splices": 11611303.0, "num_GCAG_splices": 80521.0, "num_ATAC_splices": 10119.0, "num_noncanonical_splices": 10229.0, "mismatch_rate": 0.15, "deletion_rate": 0.0, "deletion_length": 1.13, "insertion_rate": 0.0, "insertion_length": 2.11, "multimapped": 286932.0, "multimapped_percent": 2.89, "multimapped_toomany": 513.0, "multimapped_toomany_percent": 0.01, "unmapped_mismatches_percent": 0.17, "unmapped_tooshort_percent": 0.41, "unmapped_other_percent": 0.08, "unmapped_mismatches": 29739, "unmapped_tooshort": 71723, "unmapped_other": 13995 }, "rna_s1221_S42": { "total_reads": 9932006.0, "avg_input_read_length": 276.0, "uniquely_mapped": 9368114.0, "uniquely_mapped_percent": 94.32, "avg_mapped_read_length": 276.81, "num_splices": 11191802.0, "num_annotated_splices": 11077176.0, "num_GTAG_splices": 11091104.0, "num_GCAG_splices": 80198.0, "num_ATAC_splices": 10029.0, "num_noncanonical_splices": 10471.0, "mismatch_rate": 0.15, "deletion_rate": 0.0, "deletion_length": 1.14, "insertion_rate": 0.0, "insertion_length": 2.1, "multimapped": 420440.0, "multimapped_percent": 4.23, "multimapped_toomany": 918.0, "multimapped_toomany_percent": 0.01, "unmapped_mismatches_percent": 0.17, "unmapped_tooshort_percent": 0.54, "unmapped_other_percent": 0.08, "unmapped_mismatches": 30672, "unmapped_tooshort": 97428, "unmapped_other": 14434 } }, "multiqc_fastp": { "rna_s1200_S21": { "summary": { "fastp_version": "0.23.4", "sequencing": "paired end (150 cycles + 150 cycles)", "before_filtering": { "total_reads": 20000000, "total_bases": 3000000000, "q20_bases": 2973159418, "q30_bases": 2928685471, "q20_rate": 0.991053, "q30_rate": 0.976228, "read1_mean_length": 150, "read2_mean_length": 150, "gc_content": 0.534797 }, "after_filtering": { "total_reads": 19875412, "total_bases": 2793257490, "q20_bases": 2780500198, "q30_bases": 2750334612, "q20_rate": 0.995433, "q30_rate": 0.984633, "read1_mean_length": 140, "read2_mean_length": 140, "gc_content": 0.535761 } }, "filtering_result": { "passed_filter_reads": 19875412, "low_quality_reads": 124550, "too_many_N_reads": 0, "too_short_reads": 38, "too_long_reads": 0 }, "duplication": { "rate": 0.133191 }, "insert_size": { "peak": 139, "unknown": 127321, "histogram": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 2, 4, 2, 2, 5, 3, 5, 4, 5, 7, 8, 10, 8, 17, 19, 20, 14, 17, 24, 18, 22, 23, 25, 30, 31, 28, 42, 35, 62, 38, 64, 69, 94, 91, 126, 133, 168, 182, 197, 232, 271, 326, 397, 444, 520, 541, 582, 647, 750, 790, 833, 925, 971, 1074, 1221, 1331, 1398, 1544, 1611, 1629, 1857, 1942, 1927, 2079, 2275, 2346, 2491, 2687, 2742, 2813, 2901, 2975, 3078, 3249, 3378, 3637, 3657, 3708, 3890, 3924, 4027, 4022, 4002, 4204, 4281, 4372, 4685, 4773, 4766, 4792, 4916, 4709, 4744, 4866, 4874, 5025, 5174, 5226, 5222, 5238, 5228, 5241, 5309, 5145, 5135, 5312, 5373, 5398, 5547, 5361, 5362, 5403, 5264, 5297, 5329, 5197, 5123, 5342, 5240, 5393, 5464, 5245, 5273, 5258, 5077, 5106, 5203, 5091, 5017, 5150, 5050, 5203, 5173, 4936, 4742, 5032, 4981, 4773, 4875, 4894, 4859, 4914, 4788, 4652, 4582, 4617, 4624, 4765, 4574, 4504, 4595, 4568, 4631, 4446, 4505, 4398, 4405, 4324, 4205, 4208, 4301, 4164, 4130, 4116, 4125, 4117, 4087, 3969, 4003, 3903, 3914, 3860, 3821, 3713, 3782, 3831, 3595, 3683, 3600, 3571, 3500, 3589, 3598, 3546, 3444, 3303, 3357, 3351, 3342, 3267, 3298, 3192, 3120, 3151, 3113, 3121, 3082, 3009, 3095, 2955, 2875, 2892, 2981, 2782, 2883, 2710, 2804, 2736, 2723, 2574, 2661, 2633, 2650, 2621, 2550, 2419, 2379, 2471, 2347, 2350, 2332, 2263, 2255, 2355, 2182, 2156, 2184, 2198, 2150, 2140, 2079, 2049, 1966, 1989, 2025, 2014, 1928, 1916, 1868, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ] }, "adapter_cutting": { "adapter_trimmed_reads": 6547787, "adapter_trimmed_bases": 188610493, "read1_adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA", "read2_adapter_sequence": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "read1_adapter_counts": { "A": 63509, "AG": 63869, "AGA": 62352, "AGAT": 62678, "AGATC": 69236, "AGATCG": 63518, "AGATCGG": 64048, "AGATCGGA": 64569, "AGATCGGAA": 64355, "AGATCGGAAG": 64514, "AGATCGGAAGA": 64506, "AGATCGGAAGAG": 63464, "AGATCGGAAGAGC": 62861, "AGATCGGAAGAGCA": 62207, "AGATCGGAAGAGCAC": 61539, "AGATCGGAAGAGCACA": 61327, "AGATCGGAAGAGCACAC": 62479, "AGATCGGAAGAGCACACG": 61862, "AGATCGGAAGAGCACACGT": 62137, "AGATCGGAAGAGCACACGTC": 62598, "AGATCGGAAGAGCACACGTCT": 61097, "AGATCGGAAGAGCACACGTCTG": 60703, "AGATCGGAAGAGCACACGTCTGA": 60676, "AGATCGGAAGAGCACACGTCTGAA": 58260, "AGATCGGAAGAGCACACGTCTGAAC": 57708, "AGATCGGAAGAGCACACGTCTGAACT": 57554, "AGATCGGAAGAGCACACGTCTGAACTC": 55788, "AGATCGGAAGAGCACACGTCTGAACTCC": 56207, "AGATCGGAAGAGCACACGTCTGAACTCCA": 56608, "AGATCGGAAGAGCACACGTCTGAACTCCAG": 55613, "AGATCGGAAGAGCACACGTCTGAACTCCAGT": 55532, "AGATCGGAAGAGCACACGTCTGAACTCCAGTC": 54752, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA": 53277, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC": 51260, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA": 50292, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAA": 48439, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAG": 47872, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGC": 47419, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCA": 46291, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCAC": 45164, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACT": 45271, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTG": 44111, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGA": 42365, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGAT": 41384, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGATC": 38146, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGATCT": 36519, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGATCTG": 34670, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGCACTGATCTGG": 32997, "others": 612187 }, "read2_adapter_counts": { "A": 63593, "AG": 64007, "AGA": 62467, "AGAT": 62788, "AGATC": 71798, "AGATCG": 64308, "AGATCGG": 64512, "AGATCGGA": 64641, "AGATCGGAA": 64436, "AGATCGGAAG": 64576, "AGATCGGAAGA": 64631, "AGATCGGAAGAG": 63574, "AGATCGGAAGAGC": 62926, "AGATCGGAAGAGCG": 62317, "AGATCGGAAGAGCGT": 61601, "AGATCGGAAGAGCGTC": 61297, "AGATCGGAAGAGCGTCG": 62389, "AGATCGGAAGAGCGTCGT": 61830, "AGATCGGAAGAGCGTCGTG": 62191, "AGATCGGAAGAGCGTCGTGT": 62385, "AGATCGGAAGAGCGTCGTGTA": 60430, "AGATCGGAAGAGCGTCGTGTAG": 59978, "AGATCGGAAGAGCGTCGTGTAGG": 59748, "AGATCGGAAGAGCGTCGTGTAGGG": 57384, "AGATCGGAAGAGCGTCGTGTAGGGA": 56653, "AGATCGGAAGAGCGTCGTGTAGGGAA": 56504, "AGATCGGAAGAGCGTCGTGTAGGGAAA": 54747, "AGATCGGAAGAGCGTCGTGTAGGGAAAG": 55059, "AGATCGGAAGAGCGTCGTGTAGGGAAAGA": 55096, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAG": 53929, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT": 53891, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG": 52923, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT": 51446, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA": 48294, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAG": 47448, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGG": 45529, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGT": 44900, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTC": 44470, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCA": 42792, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAA": 41717, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAAC": 41053, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAACG": 39301, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAACGT": 37632, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAACGTG": 36559, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGTCAACGTGT": 34399, "others": 767848 } }, "read1_before_filtering": { "total_reads": 10000000, "total_bases": 1500000000, "q20_bases": 1488646967, "q30_bases": 1469875906, "total_cycles": 150, "quality_curves": { "A": [ 38.2941, 38.5564, 39.1914, 39.4052, 39.3479, 39.3832, 39.3787, 39.4574, 39.4355, 39.4873, 39.4743, 39.5001, 39.5481, 39.5167, 39.4531, 39.5644, 39.6976, 39.6134, 39.678, 39.7117, 39.6385, 39.7046, 39.725, 39.7238, 39.7278, 39.5824, 39.5924, 39.5997, 39.5786, 39.6003, 39.5896, 39.616, 39.6198, 39.5721, 39.6232, 39.5829, 39.6425, 39.6055, 39.6433, 39.6462, 39.6451, 39.6423, 39.6485, 39.6489, 39.6493, 39.6554, 39.6542, 39.5833, 39.6611, 39.5676, 39.6609, 39.6643, 39.6599, 39.6567, 39.6105, 39.6647, 39.6628, 39.6475, 39.6659, 39.6256, 39.6514, 39.6683, 39.6414, 39.6481, 39.6645, 39.6622, 39.6681, 39.6599, 39.6594, 39.6641, 39.6595, 39.6607, 39.6583, 39.6594, 39.6595, 39.6625, 39.635, 39.6167, 39.6388, 39.6566, 39.6522, 39.6153, 39.6407, 39.6513, 39.6355, 39.6485, 39.6454, 39.5733, 39.6517, 39.6443, 39.6468, 39.6458, 39.644, 39.6272, 39.6431, 39.6428, 39.6431, 39.6418, 39.6204, 39.64, 39.641, 39.6373, 39.6424, 39.6424, 39.6355, 39.6392, 39.6053, 39.6326, 39.6381, 39.6364, 39.6133, 39.636, 39.5858, 39.6297, 39.6298, 39.629, 39.5926, 39.6374, 39.6346, 39.6288, 39.6328, 39.6313, 39.6338, 39.6277, 39.6089, 39.5975, 39.6165, 39.5856, 39.6168, 39.6164, 39.5623, 39.6082, 39.6085, 39.6037, 39.5969, 39.5754, 39.5905, 39.5817, 39.5316, 39.5673, 39.4906, 39.4941, 39.5147, 39.464, 39.4654, 39.4856, 39.4453, 39.4534, 39.3888, 39.3925 ], "T": [ 39.2134, 39.4773, 39.5801, 39.6602, 39.6626, 39.6682, 39.6577, 39.6955, 39.7061, 39.7258, 39.7446, 39.7559, 39.7627, 39.7669, 39.7685, 39.8409, 39.8445, 39.8487, 39.853, 39.8536, 39.8542, 39.859, 39.8598, 39.8633, 39.864, 39.7351, 39.7366, 39.7415, 39.7477, 39.7518, 39.7545, 39.7614, 39.7621, 39.7651, 39.77, 39.7739, 39.7778, 39.7801, 39.7809, 39.7837, 39.7857, 39.7892, 39.7902, 39.7921, 39.7944, 39.7959, 39.7987, 39.7962, 39.7996, 39.8019, 39.8043, 39.803, 39.8025, 39.8044, 39.803, 39.8055, 39.8065, 39.8047, 39.8096, 39.8075, 39.8091, 39.8071, 39.8089, 39.8081, 39.8095, 39.8106, 39.8091, 39.8094, 39.8092, 39.8107, 39.8084, 39.8075, 39.8086, 39.8085, 39.8099, 39.8093, 39.8092, 39.8098, 39.8103, 39.8107, 39.8074, 39.809, 39.8087, 39.8084, 39.8051, 39.8087, 39.8074, 39.8072, 39.8085, 39.8069, 39.8062, 39.8054, 39.8064, 39.8037, 39.803, 39.8044, 39.8036, 39.8011, 39.8009, 39.799, 39.7976, 39.7957, 39.7941, 39.7958, 39.7899, 39.7916, 39.7918, 39.7851, 39.783, 39.7801, 39.7766, 39.7703, 39.7693, 39.7666, 39.7567, 39.7526, 39.7448, 39.7329, 39.7246, 39.7118, 39.6938, 39.6735, 39.6465, 39.614, 39.5777, 39.5252, 39.4454, 39.3783, 39.2909, 39.1798, 39.1082, 39.017, 38.9066, 38.835, 38.7443, 38.6162, 38.5315, 38.4285, 38.2939, 38.2238, 38.1325, 37.9873, 37.9396, 37.8533, 37.7409, 37.689, 37.6018, 37.4805, 37.4088, 37.366 ], "C": [ 38.5456, 39.4163, 39.4971, 39.5947, 39.591, 39.5739, 39.5402, 39.5677, 39.5662, 39.5991, 39.6216, 39.6129, 39.6198, 39.6061, 39.6082, 39.7619, 39.7635, 39.7639, 39.7666, 39.7621, 39.7609, 39.7689, 39.7663, 39.765, 39.7706, 39.6182, 39.6228, 39.6275, 39.6243, 39.6252, 39.6322, 39.6382, 39.6419, 39.6485, 39.6504, 39.6612, 39.6586, 39.6562, 39.6587, 39.6579, 39.6549, 39.6564, 39.6572, 39.6574, 39.658, 39.6676, 39.6603, 39.6589, 39.6634, 39.6616, 39.666, 39.669, 39.6624, 39.6645, 39.6698, 39.662, 39.6631, 39.6697, 39.659, 39.6581, 39.6601, 39.6569, 39.6527, 39.6553, 39.6496, 39.6556, 39.6581, 39.6523, 39.6557, 39.66, 39.6525, 39.6506, 39.654, 39.65, 39.651, 39.6542, 39.6426, 39.6478, 39.6455, 39.6415, 39.6468, 39.6477, 39.6458, 39.6417, 39.6454, 39.6374, 39.6364, 39.6437, 39.6342, 39.6385, 39.6396, 39.6354, 39.6348, 39.6316, 39.6303, 39.6324, 39.6374, 39.6249, 39.6273, 39.6297, 39.6248, 39.6272, 39.627, 39.6238, 39.622, 39.624, 39.6165, 39.6187, 39.6183, 39.6143, 39.6171, 39.6202, 39.6128, 39.6118, 39.6076, 39.6042, 39.6036, 39.6017, 39.5941, 39.5968, 39.5933, 39.5789, 39.5827, 39.5806, 39.5752, 39.574, 39.5689, 39.5593, 39.5589, 39.5508, 39.5376, 39.5262, 39.517, 39.5052, 39.4964, 39.4883, 39.4728, 39.4667, 39.4515, 39.4308, 39.4223, 39.4059, 39.3895, 39.3894, 39.3731, 39.3551, 39.3461, 39.3345, 39.3082, 39.2937 ], "G": [ 39.2805, 39.385, 39.361, 39.563, 39.5771, 39.5784, 39.5971, 39.6132, 39.6251, 39.6225, 39.6488, 39.6683, 39.6769, 39.6765, 39.6736, 39.7507, 39.7584, 39.7603, 39.7678, 39.7718, 39.7696, 39.7763, 39.7811, 39.7827, 39.7851, 39.6578, 39.6623, 39.6629, 39.6688, 39.6672, 39.6757, 39.6794, 39.6837, 39.6877, 39.6935, 39.6977, 39.6982, 39.701, 39.7033, 39.7072, 39.712, 39.7098, 39.715, 39.7144, 39.7168, 39.7194, 39.7225, 39.7186, 39.7224, 39.7226, 39.7268, 39.7297, 39.7314, 39.7297, 39.7303, 39.7334, 39.7324, 39.7344, 39.7342, 39.7342, 39.7357, 39.7374, 39.7372, 39.7368, 39.7407, 39.7385, 39.7394, 39.7408, 39.7359, 39.7379, 39.7383, 39.7369, 39.7383, 39.7406, 39.7373, 39.7384, 39.7353, 39.7359, 39.7353, 39.7342, 39.7339, 39.7366, 39.7358, 39.7337, 39.7366, 39.7371, 39.7356, 39.7361, 39.7327, 39.7324, 39.7346, 39.7326, 39.7305, 39.7306, 39.7319, 39.7288, 39.7273, 39.726, 39.7235, 39.7239, 39.7242, 39.7227, 39.7209, 39.7185, 39.7149, 39.7133, 39.7071, 39.7022, 39.7019, 39.697, 39.6931, 39.6845, 39.6742, 39.6646, 39.6555, 39.6428, 39.6252, 39.6079, 39.5898, 39.5741, 39.5549, 39.5304, 39.4999, 39.4778, 39.4418, 39.4169, 39.4037, 39.3852, 39.3747, 39.3705, 39.3446, 39.3286, 39.3068, 39.2744, 39.2356, 39.2114, 39.1743, 39.1365, 39.1128, 39.0734, 39.0447, 39.0094, 38.9602, 38.9017, 38.8627, 38.7857, 38.7246, 38.6949, 38.614, 38.5616 ], "mean": [ 38.8954, 39.3616, 39.4423, 39.5673, 39.5511, 39.555, 39.5643, 39.6038, 39.6073, 39.6097, 39.6238, 39.6432, 39.6579, 39.6478, 39.633, 39.7363, 39.7687, 39.7515, 39.7685, 39.7769, 39.7603, 39.7798, 39.7859, 39.7864, 39.7887, 39.6507, 39.6556, 39.6593, 39.6574, 39.6631, 39.6645, 39.6754, 39.6786, 39.6709, 39.686, 39.6823, 39.695, 39.6881, 39.6979, 39.6996, 39.701, 39.7012, 39.7036, 39.7047, 39.7061, 39.7101, 39.7102, 39.693, 39.7118, 39.6925, 39.7156, 39.7167, 39.7153, 39.7149, 39.7056, 39.7173, 39.7172, 39.7152, 39.7179, 39.7085, 39.7148, 39.7181, 39.7116, 39.7126, 39.7168, 39.7175, 39.7185, 39.7165, 39.7157, 39.7183, 39.7154, 39.7145, 39.7149, 39.7155, 39.7148, 39.7157, 39.7066, 39.7041, 39.7079, 39.7113, 39.7107, 39.7035, 39.7088, 39.7091, 39.7059, 39.7084, 39.7068, 39.6922, 39.7068, 39.706, 39.7065, 39.7052, 39.7043, 39.6982, 39.7022, 39.7021, 39.7022, 39.6982, 39.6934, 39.6972, 39.6966, 39.6954, 39.695, 39.6946, 39.69, 39.6906, 39.6799, 39.6837, 39.6836, 39.6808, 39.6743, 39.6757, 39.6595, 39.6662, 39.6598, 39.655, 39.64, 39.6417, 39.6331, 39.6252, 39.6152, 39.6007, 39.5878, 39.5718, 39.5487, 39.527, 39.5082, 39.4777, 39.4621, 39.4346, 39.3933, 39.3753, 39.3441, 39.3119, 39.2762, 39.2359, 39.203, 39.1641, 39.1144, 39.0851, 39.0337, 38.9917, 38.9617, 38.9122, 38.8747, 38.8341, 38.7825, 38.7479, 38.6782, 38.6463 ] }, "content_curves": { "A": [ 0.0742538, 0.0785402, 0.124067, 0.16963, 0.225579, 0.244221, 0.220814, 0.181686, 0.169862, 0.277724, 0.225846, 0.199554, 0.217838, 0.226964, 0.22379, 0.219941, 0.223247, 0.221965, 0.225199, 0.226998, 0.221013, 0.218196, 0.219096, 0.216544, 0.218028, 0.222863, 0.217805, 0.21696, 0.221144, 0.215304, 0.218662, 0.221096, 0.216796, 0.21813, 0.221087, 0.217036, 0.216385, 0.220476, 0.216446, 0.215824, 0.21951, 0.215159, 0.214943, 0.219485, 0.214018, 0.21581, 0.219279, 0.215212, 0.21637, 0.220039, 0.213466, 0.215869, 0.219609, 0.214706, 0.214594, 0.218661, 0.213743, 0.214313, 0.218759, 0.215217, 0.214577, 0.21801, 0.213982, 0.214196, 0.218752, 0.213469, 0.215293, 0.218609, 0.215047, 0.2155, 0.218871, 0.214504, 0.215198, 0.218336, 0.213926, 0.216194, 0.219913, 0.216349, 0.21613, 0.219483, 0.214864, 0.216183, 0.220771, 0.21634, 0.217064, 0.221918, 0.216582, 0.218338, 0.223997, 0.218672, 0.219767, 0.223006, 0.21893, 0.219315, 0.224292, 0.220246, 0.220781, 0.226249, 0.222091, 0.222644, 0.226202, 0.223208, 0.225562, 0.228492, 0.225118, 0.225786, 0.230284, 0.226238, 0.228153, 0.233309, 0.227939, 0.230984, 0.234221, 0.230297, 0.231627, 0.235435, 0.231656, 0.233227, 0.237375, 0.233715, 0.234446, 0.238561, 0.235321, 0.235656, 0.239537, 0.235393, 0.2365, 0.240061, 0.236496, 0.238644, 0.241787, 0.238246, 0.238761, 0.240361, 0.238498, 0.23926, 0.241987, 0.239546, 0.240079, 0.242562, 0.239522, 0.240092, 0.242573, 0.238921, 0.238809, 0.240541, 0.237377, 0.237691, 0.239509, 0.235758 ], "T": [ 0.0894615, 0.361927, 0.254622, 0.224747, 0.266532, 0.281158, 0.412842, 0.363756, 0.362524, 0.285317, 0.22584, 0.266751, 0.272557, 0.27693, 0.270243, 0.26303, 0.26151, 0.258046, 0.248978, 0.259764, 0.259659, 0.255178, 0.266665, 0.262323, 0.253144, 0.259027, 0.257525, 0.250425, 0.257555, 0.256005, 0.247115, 0.255244, 0.255972, 0.246542, 0.254174, 0.253911, 0.246714, 0.253295, 0.253678, 0.247489, 0.254843, 0.256124, 0.248097, 0.254904, 0.254129, 0.245426, 0.252966, 0.254539, 0.245021, 0.253925, 0.252139, 0.243901, 0.252356, 0.251225, 0.24338, 0.251054, 0.251894, 0.244605, 0.250198, 0.252131, 0.244517, 0.250765, 0.251476, 0.243773, 0.250167, 0.250463, 0.241818, 0.250081, 0.250149, 0.243547, 0.249724, 0.250717, 0.242758, 0.250339, 0.248012, 0.241173, 0.248125, 0.247814, 0.24267, 0.248098, 0.248517, 0.241866, 0.248289, 0.247741, 0.239821, 0.247129, 0.248199, 0.239991, 0.246492, 0.247255, 0.240258, 0.246286, 0.246332, 0.23792, 0.243973, 0.244191, 0.237549, 0.242923, 0.243968, 0.236243, 0.242126, 0.242464, 0.235746, 0.240903, 0.240936, 0.234156, 0.23942, 0.239515, 0.233292, 0.238845, 0.2383, 0.231073, 0.235262, 0.235729, 0.229452, 0.234351, 0.235321, 0.229019, 0.233808, 0.234213, 0.227519, 0.233182, 0.232913, 0.226935, 0.231743, 0.232316, 0.22663, 0.232234, 0.23232, 0.226862, 0.232408, 0.233872, 0.228391, 0.233965, 0.235192, 0.230009, 0.234467, 0.236225, 0.231524, 0.237538, 0.238731, 0.23446, 0.239979, 0.241123, 0.238023, 0.244112, 0.245669, 0.242413, 0.248076, 0.250994 ], "C": [ 0.416112, 0.26427, 0.34169, 0.290264, 0.210456, 0.227272, 0.16825, 0.241226, 0.254303, 0.202779, 0.265566, 0.269419, 0.251485, 0.248201, 0.258786, 0.257807, 0.257369, 0.262812, 0.258161, 0.25591, 0.26482, 0.26958, 0.262052, 0.267159, 0.269247, 0.262024, 0.269448, 0.271674, 0.26416, 0.270988, 0.272337, 0.264865, 0.27094, 0.272806, 0.264669, 0.270186, 0.27147, 0.264735, 0.271601, 0.271532, 0.26517, 0.270103, 0.272508, 0.265734, 0.272489, 0.274469, 0.266772, 0.27177, 0.274822, 0.265271, 0.274206, 0.275611, 0.265922, 0.27446, 0.275459, 0.267725, 0.27455, 0.275083, 0.26907, 0.273566, 0.274267, 0.269722, 0.273429, 0.276616, 0.268078, 0.274902, 0.276426, 0.268741, 0.274907, 0.275438, 0.269754, 0.275688, 0.27625, 0.269176, 0.276642, 0.277807, 0.269629, 0.275585, 0.276115, 0.268381, 0.274353, 0.274303, 0.268329, 0.274669, 0.275869, 0.267696, 0.273274, 0.275297, 0.268016, 0.272973, 0.273929, 0.266973, 0.271635, 0.273925, 0.266478, 0.272159, 0.274218, 0.267072, 0.271246, 0.273273, 0.266604, 0.271558, 0.271139, 0.265026, 0.270579, 0.272051, 0.265537, 0.271284, 0.271786, 0.264848, 0.270399, 0.271508, 0.266681, 0.271688, 0.272218, 0.265729, 0.269795, 0.270836, 0.264212, 0.268131, 0.270807, 0.264683, 0.269301, 0.270132, 0.26529, 0.270118, 0.270696, 0.264496, 0.269082, 0.26981, 0.264203, 0.268137, 0.269545, 0.264717, 0.268312, 0.268513, 0.263715, 0.267078, 0.26764, 0.26212, 0.264821, 0.266095, 0.260622, 0.264407, 0.264647, 0.259501, 0.261757, 0.261328, 0.255813, 0.25803 ], "G": [ 0.420173, 0.295262, 0.279621, 0.315358, 0.297433, 0.247349, 0.198094, 0.213332, 0.213312, 0.234181, 0.282747, 0.264276, 0.258119, 0.247906, 0.247181, 0.259222, 0.257874, 0.257177, 0.267663, 0.257329, 0.254508, 0.257046, 0.252187, 0.253974, 0.259581, 0.256086, 0.255223, 0.260941, 0.257141, 0.257704, 0.261886, 0.258794, 0.256292, 0.262522, 0.26007, 0.258868, 0.265431, 0.261494, 0.258274, 0.265156, 0.260477, 0.258614, 0.264453, 0.259877, 0.259364, 0.264296, 0.260982, 0.258479, 0.263787, 0.260764, 0.260189, 0.264619, 0.262113, 0.25961, 0.266567, 0.26256, 0.259814, 0.265999, 0.261972, 0.259086, 0.26664, 0.261503, 0.261114, 0.265415, 0.263003, 0.261166, 0.266462, 0.262569, 0.259897, 0.265516, 0.261651, 0.259091, 0.265794, 0.262148, 0.261421, 0.264825, 0.262333, 0.260253, 0.265085, 0.264038, 0.262266, 0.267648, 0.262611, 0.26125, 0.267246, 0.263257, 0.261944, 0.266374, 0.261495, 0.2611, 0.266046, 0.263735, 0.263103, 0.26884, 0.265258, 0.263404, 0.267452, 0.263756, 0.262696, 0.267841, 0.265069, 0.26277, 0.267553, 0.265579, 0.263367, 0.268007, 0.264759, 0.262963, 0.26677, 0.262997, 0.263361, 0.266435, 0.263836, 0.262286, 0.266703, 0.264484, 0.263228, 0.266918, 0.264606, 0.26394, 0.267228, 0.263574, 0.262464, 0.267277, 0.26343, 0.262174, 0.266173, 0.26321, 0.262102, 0.264684, 0.261602, 0.259745, 0.263303, 0.260956, 0.257998, 0.262217, 0.259831, 0.257151, 0.260756, 0.257781, 0.256925, 0.259352, 0.256827, 0.255549, 0.258521, 0.255846, 0.255197, 0.258568, 0.256602, 0.255218 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.836285, 0.559533, 0.621311, 0.605622, 0.507889, 0.474622, 0.366344, 0.454557, 0.467614, 0.436959, 0.548314, 0.533695, 0.509605, 0.496106, 0.505967, 0.517029, 0.515243, 0.519989, 0.525823, 0.513238, 0.519328, 0.526626, 0.514239, 0.521133, 0.528828, 0.51811, 0.52467, 0.532615, 0.5213, 0.528692, 0.534223, 0.52366, 0.527232, 0.535328, 0.524739, 0.529053, 0.536901, 0.526229, 0.529876, 0.536687, 0.525647, 0.528717, 0.536961, 0.525611, 0.531853, 0.538764, 0.527755, 0.530249, 0.538609, 0.526035, 0.534395, 0.54023, 0.528035, 0.534069, 0.542026, 0.530284, 0.534363, 0.541082, 0.531043, 0.532652, 0.540906, 0.531225, 0.534542, 0.542031, 0.531081, 0.536067, 0.542889, 0.531311, 0.534804, 0.540953, 0.531405, 0.534779, 0.542044, 0.531325, 0.538062, 0.542632, 0.531962, 0.535837, 0.541201, 0.532419, 0.536619, 0.541951, 0.53094, 0.535919, 0.543115, 0.530953, 0.535219, 0.541671, 0.529511, 0.534073, 0.539975, 0.530708, 0.534739, 0.542765, 0.531736, 0.535563, 0.54167, 0.530828, 0.533942, 0.541113, 0.531673, 0.534328, 0.538692, 0.530605, 0.533946, 0.540058, 0.530297, 0.534248, 0.538555, 0.527845, 0.533761, 0.537943, 0.530517, 0.533975, 0.538921, 0.530213, 0.533023, 0.537753, 0.528817, 0.532072, 0.538035, 0.528257, 0.531766, 0.537408, 0.52872, 0.532292, 0.536869, 0.527706, 0.531184, 0.534494, 0.525805, 0.527882, 0.532848, 0.525674, 0.52631, 0.53073, 0.523546, 0.524229, 0.528397, 0.5199, 0.521747, 0.525447, 0.517448, 0.519956, 0.523168, 0.515347, 0.516954, 0.519896, 0.512415, 0.513248 ] }, "kmer_count": { "AAAAA": 1612838, "AAAAT": 1329549, "AAAAC": 1064893, "AAAAG": 1388965, "AAATA": 971531, "AAATT": 1182183, "AAATC": 1130436, "AAATG": 1161454, "AAACA": 1397017, "AAACT": 1312185, "AAACC": 883342, "AAACG": 370996, "AAAGA": 1495894, "AAAGT": 1259389, "AAAGC": 1362789, "AAAGG": 1403054, "AATAA": 890503, "AATAT": 828130, "AATAC": 637292, "AATAG": 686330, "AATTA": 517277, "AATTT": 1457845, "AATTC": 1256493, "AATTG": 703984, "AATCA": 1099435, "AATCT": 1403304, "AATCC": 1050557, "AATCG": 296308, "AATGA": 1204967, "AATGT": 1138664, "AATGC": 1025583, "AATGG": 1235703, "AACAA": 1032498, "AACAT": 1199082, "AACAC": 1129172, "AACAG": 1503192, "AACTA": 386033, "AACTT": 1477248, "AACTC": 2792470, "AACTG": 1537678, "AACCA": 1203325, "AACCT": 986783, "AACCC": 611211, "AACCG": 353640, "AACGA": 303468, "AACGT": 344839, "AACGC": 329897, "AACGG": 368052, "AAGAA": 1605310, "AAGAT": 1564437, "AAGAC": 1026806, "AAGAG": 4176519, "AAGTA": 823664, "AAGTT": 1275091, "AAGTC": 1323152, "AAGTG": 1046902, "AAGCA": 2397853, "AAGCT": 1460368, "AAGCC": 1405898, "AAGCG": 613418, "AAGGA": 1447019, "AAGGT": 1289855, "AAGGC": 1640916, "AAGGG": 1304672, "ATAAA": 944945, "ATAAT": 796112, "ATAAC": 566488, "ATAAG": 649828, "ATATA": 524768, "ATATT": 922245, "ATATC": 790223, "ATATG": 553717, "ATACA": 786890, "ATACT": 839307, "ATACC": 574442, "ATACG": 218620, "ATAGA": 821986, "ATAGT": 722346, "ATAGC": 792203, "ATAGG": 684294, "ATTAA": 640287, "ATTAT": 591541, "ATTAC": 438778, "ATTAG": 471791, "ATTTA": 745372, "ATTTT": 2028758, "ATTTC": 1815744, "ATTTG": 1264142, "ATTCA": 1314484, "ATTCT": 1689094, "ATTCC": 1244370, "ATTCG": 389780, "ATTGA": 833758, "ATTGT": 913094, "ATTGC": 814964, "ATTGG": 944078, "ATCAA": 1261624, "ATCAT": 1687856, "ATCAC": 1263133, "ATCAG": 1589811, "ATCTA": 511854, "ATCTT": 2461082, "ATCTC": 1885386, "ATCTG": 2731369, "ATCCA": 1925661, "ATCCT": 1641403, "ATCCC": 978860, "ATCCG": 514278, "ATCGA": 377305, "ATCGT": 409709, "ATCGC": 355353, "ATCGG": 3258165, "ATGAA": 1308991, "ATGAT": 1376795, "ATGAC": 1123171, "ATGAG": 1431607, "ATGTA": 833912, "ATGTT": 1419524, "ATGTC": 1417760, "ATGTG": 1037311, "ATGCA": 1049222, "ATGCT": 1311485, "ATGCC": 1419416, "ATGCG": 566545, "ATGGA": 1327020, "ATGGT": 1549166, "ATGGC": 1930023, "ATGGG": 1251760, "ACAAA": 1343158, "ACAAT": 970537, "ACAAC": 760247, "ACAAG": 2074484, "ACATA": 773601, "ACATT": 1255002, "ACATC": 1492525, "ACATG": 1187950, "ACACA": 1512626, "ACACT": 1115264, "ACACC": 1318203, "ACACG": 2880878, "ACAGA": 1755605, "ACAGT": 1280430, "ACAGC": 2209725, "ACAGG": 1914583, "ACTAA": 389945, "ACTAT": 401851, "ACTAC": 384538, "ACTAG": 407994, "ACTTA": 485147, "ACTTT": 1531351, "ACTTC": 1856296, "ACTTG": 1674910, "ACTCA": 1078618, "ACTCT": 1287840, "ACTCC": 3046584, "ACTCG": 709761, "ACTGA": 2125205, "ACTGT": 1443456, "ACTGC": 1741997, "ACTGG": 1860786, "ACCAA": 1126539, "ACCAT": 1227675, "ACCAC": 1801897, "ACCAG": 2189445, "ACCTA": 284197, "ACCTT": 1513041, "ACCTC": 1538608, "ACCTG": 1618740, "ACCCA": 1120265, "ACCCT": 878089, "ACCCC": 848597, "ACCCG": 535618, "ACCGA": 414810, "ACCGT": 436993, "ACCGC": 616291, "ACCGG": 505528, "ACGAA": 538254, "ACGAT": 564629, "ACGAC": 395997, "ACGAG": 559607, "ACGTA": 360144, "ACGTT": 543632, "ACGTC": 2631024, "ACGTG": 558715, "ACGCA": 497578, "ACGCT": 606719, "ACGCC": 657224, "ACGCG": 311479, "ACGGA": 554244, "ACGGT": 575516, "ACGGC": 943184, "ACGGG": 660947, "AGAAA": 1569898, "AGAAT": 1113741, "AGAAC": 1177262, "AGAAG": 2178422, "AGATA": 709116, "AGATT": 986096, "AGATC": 4145667, "AGATG": 1755178, "AGACA": 1367436, "AGACT": 1046942, "AGACC": 971732, "AGACG": 674953, "AGAGA": 1941049, "AGAGT": 1047022, "AGAGC": 4198594, "AGAGG": 1878491, "AGTAA": 753352, "AGTAT": 562316, "AGTAC": 699504, "AGTAG": 1026119, "AGTTA": 499349, "AGTTT": 1532978, "AGTTC": 1422896, "AGTTG": 1311946, "AGTCA": 2663671, "AGTCT": 1363356, "AGTCC": 1422954, "AGTCG": 544109, "AGTGA": 1159708, "AGTGT": 975482, "AGTGC": 1153906, "AGTGG": 1476001, "AGCAA": 1528160, "AGCAT": 1565329, "AGCAC": 5167429, "AGCAG": 3591762, "AGCTA": 502892, "AGCTT": 2208443, "AGCTC": 2554355, "AGCTG": 3250946, "AGCCA": 2384002, "AGCCT": 1849917, "AGCCC": 1800962, "AGCCG": 1253986, "AGCGA": 624877, "AGCGT": 594796, "AGCGC": 1033798, "AGCGG": 1087395, "AGGAA": 2045870, "AGGAT": 1588791, "AGGAC": 1448801, "AGGAG": 2525642, "AGGTA": 1113981, "AGGTT": 1378275, "AGGTC": 1817812, "AGGTG": 2032533, "AGGCA": 2034250, "AGGCT": 2029808, "AGGCC": 2200633, "AGGCG": 1233087, "AGGGA": 1590611, "AGGGT": 1503800, "AGGGC": 2308561, "AGGGG": 1826007, "TAAAA": 991259, "TAAAT": 764747, "TAAAC": 610401, "TAAAG": 827620, "TAATA": 559567, "TAATT": 742517, "TAATC": 658116, "TAATG": 704493, "TAACA": 729117, "TAACT": 655078, "TAACC": 468604, "TAACG": 203269, "TAAGA": 691285, "TAAGT": 580093, "TAAGC": 538449, "TAAGG": 643514, "TATAA": 507983, "TATAT": 466808, "TATAC": 379824, "TATAG": 459005, "TATTA": 455400, "TATTT": 1214850, "TATTC": 785932, "TATTG": 640840, "TATCA": 811698, "TATCT": 954658, "TATCC": 679017, "TATCG": 208331, "TATGA": 517391, "TATGT": 511737, "TATGC": 425768, "TATGG": 520300, "TACAA": 685781, "TACAT": 734454, "TACAC": 632977, "TACAG": 1031124, "TACTA": 318938, "TACTT": 1134286, "TACTC": 760664, "TACTG": 1021121, "TACCA": 868926, "TACCT": 676358, "TACCC": 466285, "TACCG": 221284, "TACGA": 228413, "TACGT": 214213, "TACGC": 194804, "TACGG": 292912, "TAGAA": 902971, "TAGAT": 1071319, "TAGAC": 511095, "TAGAG": 837468, "TAGTA": 521588, "TAGTT": 763023, "TAGTC": 668257, "TAGTG": 613367, "TAGCA": 968248, "TAGCT": 948116, "TAGCC": 888600, "TAGCG": 396870, "TAGGA": 836668, "TAGGT": 701828, "TAGGC": 783077, "TAGGG": 711192, "TTAAA": 966961, "TTAAT": 790097, "TTAAC": 559494, "TTAAG": 657464, "TTATA": 585833, "TTATT": 966323, "TTATC": 820503, "TTATG": 483844, "TTACA": 699339, "TTACT": 700521, "TTACC": 535993, "TTACG": 218443, "TTAGA": 640707, "TTAGT": 508835, "TTAGC": 714716, "TTAGG": 651365, "TTTAA": 1114582, "TTTAT": 1110398, "TTTAC": 795538, "TTTAG": 910801, "TTTTA": 1297015, "TTTTT": 4823489, "TTTTC": 3088957, "TTTTG": 2032724, "TTTCA": 2344182, "TTTCT": 3555665, "TTTCC": 2483467, "TTTCG": 577341, "TTTGA": 1497800, "TTTGT": 1745986, "TTTGC": 1775279, "TTTGG": 1952053, "TTCAA": 1796199, "TTCAT": 2513938, "TTCAC": 1983267, "TTCAG": 2732728, "TTCTA": 921680, "TTCTT": 4702669, "TTCTC": 3181486, "TTCTG": 3289704, "TTCCA": 2856703, "TTCCT": 2837022, "TTCCC": 1756540, "TTCCG": 939919, "TTCGA": 517381, "TTCGT": 499648, "TTCGC": 430988, "TTCGG": 666528, "TTGAA": 1566795, "TTGAT": 1687817, "TTGAC": 1101489, "TTGAG": 1586128, "TTGTA": 1250803, "TTGTT": 1939833, "TTGTC": 1773271, "TTGTG": 1288432, "TTGCA": 1427858, "TTGCT": 2030938, "TTGCC": 1777904, "TTGCG": 788086, "TTGGA": 1658821, "TTGGT": 1865234, "TTGGC": 2393422, "TTGGG": 1756840, "TCAAA": 1883772, "TCAAT": 1443780, "TCAAC": 977436, "TCAAG": 1172523, "TCATA": 1271064, "TCATT": 1749725, "TCATC": 2885906, "TCATG": 1723197, "TCACA": 2930690, "TCACT": 1662347, "TCACC": 1763576, "TCACG": 857209, "TCAGA": 1853707, "TCAGT": 1501095, "TCAGC": 2794832, "TCAGG": 2607586, "TCTAA": 647901, "TCTAT": 611664, "TCTAC": 669651, "TCTAG": 699365, "TCTTA": 896615, "TCTTT": 3128786, "TCTTC": 4748059, "TCTTG": 3111936, "TCTCA": 1918585, "TCTCT": 2497993, "TCTCC": 3294005, "TCTCG": 1171812, "TCTGA": 3943838, "TCTGT": 2226566, "TCTGC": 2953842, "TCTGG": 3588040, "TCCAA": 1872862, "TCCAT": 2284401, "TCCAC": 2888193, "TCCAG": 5613876, "TCCTA": 488192, "TCCTT": 3131636, "TCCTC": 3890677, "TCCTG": 3080071, "TCCCA": 1973381, "TCCCT": 1419946, "TCCCC": 1620047, "TCCCG": 1278988, "TCCGA": 679464, "TCCGT": 690416, "TCCGC": 1047347, "TCCGG": 1125258, "TCGAA": 681130, "TCGAT": 719361, "TCGAC": 378824, "TCGAG": 635925, "TCGTA": 491553, "TCGTT": 626981, "TCGTC": 890305, "TCGTG": 570838, "TCGCA": 519265, "TCGCT": 822432, "TCGCC": 772320, "TCGCG": 376736, "TCGGA": 3505468, "TCGGT": 694533, "TCGGC": 1108422, "TCGGG": 967482, "TGAAA": 1334350, "TGAAT": 1173868, "TGAAC": 2918790, "TGAAG": 2415258, "TGATA": 873475, "TGATT": 1115760, "TGATC": 2089289, "TGATG": 2365784, "TGACA": 1501720, "TGACT": 1239025, "TGACC": 1225230, "TGACG": 760879, "TGAGA": 1640780, "TGAGT": 1134895, "TGAGC": 1867379, "TGAGG": 2237267, "TGTAA": 937336, "TGTAT": 720397, "TGTAC": 938802, "TGTAG": 1579529, "TGTTA": 642128, "TGTTT": 1941593, "TGTTC": 1837017, "TGTTG": 2102863, "TGTCA": 1797228, "TGTCT": 1908556, "TGTCC": 2017898, "TGTCG": 797612, "TGTGA": 1273514, "TGTGT": 1371444, "TGTGC": 1453440, "TGTGG": 1891025, "TGCAA": 1206959, "TGCAT": 1396113, "TGCAC": 1474661, "TGCAG": 3081031, "TGCTA": 647962, "TGCTT": 2317660, "TGCTC": 2364262, "TGCTG": 3768285, "TGCCA": 2479469, "TGCCT": 1848009, "TGCCC": 1935846, "TGCCG": 1189229, "TGCGA": 464363, "TGCGT": 521500, "TGCGC": 912364, "TGCGG": 1230708, "TGGAA": 1976642, "TGGAT": 1686833, "TGGAC": 1411528, "TGGAG": 2664411, "TGGTA": 1178778, "TGGTT": 1634449, "TGGTC": 1941272, "TGGTG": 2915313, "TGGCA": 2560591, "TGGCT": 2558971, "TGGCC": 2863800, "TGGCG": 1394905, "TGGGA": 1785809, "TGGGT": 1639816, "TGGGC": 2559586, "TGGGG": 2899278, "CAAAA": 1551492, "CAAAT": 1306081, "CAAAC": 1332902, "CAAAG": 2059542, "CAATA": 829323, "CAATT": 1037965, "CAATC": 1054664, "CAATG": 1687068, "CAACA": 1418540, "CAACT": 1147708, "CAACC": 859862, "CAACG": 368028, "CAAGA": 1408486, "CAAGT": 1066465, "CAAGC": 2079942, "CAAGG": 1417873, "CATAA": 892398, "CATAT": 880508, "CATAC": 826210, "CATAG": 1236772, "CATTA": 773593, "CATTT": 1857766, "CATTC": 1579931, "CATTG": 1526294, "CATCA": 2657007, "CATCT": 2771730, "CATCC": 2160133, "CATCG": 694147, "CATGA": 1517802, "CATGT": 1426108, "CATGC": 1307258, "CATGG": 2120740, "CACAA": 2542073, "CACAT": 1689535, "CACAC": 3953996, "CACAG": 2913789, "CACTA": 577760, "CACTT": 1687109, "CACTC": 1468859, "CACTG": 3367771, "CACCA": 2987095, "CACCT": 2216279, "CACCC": 1355501, "CACCG": 925936, "CACGA": 886774, "CACGT": 3078790, "CACGC": 899924, "CACGG": 1348974, "CAGAA": 2009847, "CAGAT": 2655984, "CAGAC": 1429566, "CAGAG": 2509588, "CAGTA": 1052212, "CAGTT": 1674931, "CAGTC": 2895881, "CAGTG": 2073475, "CAGCA": 4368436, "CAGCT": 4047080, "CAGCC": 3122184, "CAGCG": 1508622, "CAGGA": 3204459, "CAGGT": 2727965, "CAGGC": 2948365, "CAGGG": 3325989, "CTAAA": 568821, "CTAAT": 403205, "CTAAC": 348790, "CTAAG": 482385, "CTATA": 343682, "CTATT": 497697, "CTATC": 476391, "CTATG": 470135, "CTACA": 609392, "CTACT": 609970, "CTACC": 498089, "CTACG": 227525, "CTAGA": 649945, "CTAGT": 363852, "CTAGC": 477872, "CTAGG": 526501, "CTTAA": 749450, "CTTAT": 705782, "CTTAC": 513758, "CTTAG": 731197, "CTTTA": 1254673, "CTTTT": 2650292, "CTTTC": 2402319, "CTTTG": 2406770, "CTTCA": 3831742, "CTTCT": 4851604, "CTTCC": 3079489, "CTTCG": 814278, "CTTGA": 2227257, "CTTGT": 2220747, "CTTGC": 2189219, "CTTGG": 3142541, "CTCAA": 1373597, "CTCAT": 1961146, "CTCAC": 1382058, "CTCAG": 2602309, "CTCTA": 763009, "CTCTT": 2697630, "CTCTC": 2166303, "CTCTG": 3031191, "CTCCA": 5634602, "CTCCT": 4101170, "CTCCC": 2081913, "CTCCG": 1370339, "CTCGA": 921695, "CTCGT": 1015908, "CTCGC": 1062666, "CTCGG": 1639675, "CTGAA": 3847314, "CTGAT": 2249346, "CTGAC": 1342673, "CTGAG": 2451541, "CTGTA": 1356285, "CTGTT": 1926961, "CTGTC": 2035251, "CTGTG": 2377742, "CTGCA": 3314931, "CTGCT": 4037781, "CTGCC": 2781138, "CTGCG": 1152556, "CTGGA": 3101068, "CTGGT": 2561447, "CTGGC": 2933780, "CTGGG": 4040254, "CCAAA": 1703399, "CCAAT": 1152931, "CCAAC": 1161619, "CCAAG": 1631901, "CCATA": 1005109, "CCATT": 1526397, "CCATC": 2148219, "CCATG": 2131186, "CCACA": 2742111, "CCACT": 2033184, "CCACC": 2675175, "CCACG": 1519853, "CCAGA": 2712893, "CCAGT": 3315235, "CCAGC": 3887861, "CCAGG": 4188922, "CCTAA": 326666, "CCTAT": 327966, "CCTAC": 367213, "CCTAG": 431463, "CCTTA": 735519, "CCTTT": 1983121, "CCTTC": 2950014, "CCTTG": 2691626, "CCTCA": 2283701, "CCTCT": 2415255, "CCTCC": 3497601, "CCTCG": 1527776, "CCTGA": 1700040, "CCTGT": 1655042, "CCTGC": 2647847, "CCTGG": 3225539, "CCCAA": 1191425, "CCCAT": 1409815, "CCCAC": 1868827, "CCCAG": 2945866, "CCCTA": 317554, "CCCTT": 1457055, "CCCTC": 1679183, "CCCTG": 1984082, "CCCCA": 1987057, "CCCCT": 1282983, "CCCCC": 1243504, "CCCCG": 1187809, "CCCGA": 806546, "CCCGT": 745622, "CCCGC": 1352887, "CCCGG": 1552739, "CCGAA": 598123, "CCGAT": 506417, "CCGAC": 565705, "CCGAG": 1060194, "CCGTA": 410612, "CCGTT": 564858, "CCGTC": 882261, "CCGTG": 976585, "CCGCA": 1138065, "CCGCT": 1300103, "CCGCC": 1660875, "CCGCG": 889509, "CCGGA": 1015333, "CCGGT": 808718, "CCGGC": 1495046, "CCGGG": 1544780, "CGAAA": 322287, "CGAAT": 407163, "CGAAC": 537568, "CGAAG": 1022511, "CGATA": 264851, "CGATT": 334638, "CGATC": 626982, "CGATG": 1165178, "CGACA": 507901, "CGACT": 482155, "CGACC": 452428, "CGACG": 385779, "CGAGA": 780905, "CGAGT": 462108, "CGAGC": 803244, "CGAGG": 985650, "CGTAA": 260736, "CGTAT": 225183, "CGTAC": 426989, "CGTAG": 694522, "CGTTA": 140874, "CGTTT": 565948, "CGTTC": 737023, "CGTTG": 799648, "CGTCA": 720643, "CGTCT": 2808818, "CGTCC": 1034245, "CGTCG": 574149, "CGTGA": 539387, "CGTGT": 577538, "CGTGC": 724778, "CGTGG": 1075110, "CGCAA": 342235, "CGCAT": 473423, "CGCAC": 778308, "CGCAG": 1488076, "CGCTA": 148378, "CGCTT": 937990, "CGCTC": 1237459, "CGCTG": 1572908, "CGCCA": 1085543, "CGCCT": 1026273, "CGCCC": 1094187, "CGCCG": 1139455, "CGCGA": 319036, "CGCGT": 361123, "CGCGC": 677059, "CGCGG": 958257, "CGGAA": 3422731, "CGGAT": 780702, "CGGAC": 628196, "CGGAG": 1177962, "CGGTA": 475414, "CGGTT": 552554, "CGGTC": 883421, "CGGTG": 1131132, "CGGCA": 1066897, "CGGCT": 1235996, "CGGCC": 1879115, "CGGCG": 1367843, "CGGGA": 921711, "CGGGT": 736078, "CGGGC": 1577950, "CGGGG": 1458655, "GAAAA": 1262195, "GAAAT": 1060977, "GAAAC": 971117, "GAAAG": 1272758, "GAATA": 692984, "GAATT": 985915, "GAATC": 1021613, "GAATG": 1069217, "GAACA": 1341344, "GAACT": 3156575, "GAACC": 956155, "GAACG": 408114, "GAAGA": 4872961, "GAAGT": 1582483, "GAAGC": 1964716, "GAAGG": 2241790, "GATAA": 669665, "GATAT": 622906, "GATAC": 582626, "GATAG": 648661, "GATTA": 397868, "GATTT": 1325066, "GATTC": 1023086, "GATTG": 639608, "GATCA": 1243082, "GATCT": 2514887, "GATCC": 1170946, "GATCG": 3260254, "GATGA": 2013085, "GATGT": 1647881, "GATGC": 1599912, "GATGG": 2192946, "GACAA": 954573, "GACAT": 1107452, "GACAC": 1192941, "GACAG": 1742631, "GACTA": 306640, "GACTT": 1268973, "GACTC": 1172976, "GACTG": 1307697, "GACCA": 1300303, "GACCT": 1084353, "GACCC": 952588, "GACCG": 470135, "GACGA": 647471, "GACGT": 526784, "GACGC": 653932, "GACGG": 724397, "GAGAA": 1533138, "GAGAT": 2379258, "GAGAC": 1104673, "GAGAG": 1632309, "GAGTA": 649497, "GAGTT": 1063339, "GAGTC": 1177760, "GAGTG": 1040434, "GAGCA": 4251956, "GAGCT": 2082472, "GAGCC": 1882588, "GAGCG": 822759, "GAGGA": 2133313, "GAGGT": 1637549, "GAGGC": 2136388, "GAGGG": 1881660, "GTAAA": 726786, "GTAAT": 684708, "GTAAC": 589046, "GTAAG": 673903, "GTATA": 365071, "GTATT": 719387, "GTATC": 575895, "GTATG": 473363, "GTACA": 1002197, "GTACT": 1098522, "GTACC": 632958, "GTACG": 269581, "GTAGA": 1230750, "GTAGT": 983499, "GTAGC": 1230107, "GTAGG": 1180439, "GTTAA": 481344, "GTTAT": 454290, "GTTAC": 412238, "GTTAG": 410971, "GTTTA": 646320, "GTTTT": 1987527, "GTTTC": 1677363, "GTTTG": 1284820, "GTTCA": 1562527, "GTTCT": 2031017, "GTTCC": 1592783, "GTTCG": 335831, "GTTGA": 1406875, "GTTGT": 1396677, "GTTGC": 1264728, "GTTGG": 1654373, "GTCAA": 1070558, "GTCAT": 1494829, "GTCAC": 2660954, "GTCAG": 1869955, "GTCTA": 437535, "GTCTT": 2060110, "GTCTC": 1661931, "GTCTG": 3770198, "GTCCA": 2334626, "GTCCT": 2032866, "GTCCC": 1485549, "GTCCG": 724875, "GTCGA": 610736, "GTCGT": 663273, "GTCGC": 651746, "GTCGG": 784199, "GTGAA": 1191832, "GTGAT": 1184955, "GTGAC": 1174972, "GTGAG": 1427152, "GTGTA": 741727, "GTGTT": 1261314, "GTGTC": 1313134, "GTGTG": 1293526, "GTGCA": 1394436, "GTGCT": 1743042, "GTGCC": 1489778, "GTGCG": 629119, "GTGGA": 1666762, "GTGGT": 1711547, "GTGGC": 2132677, "GTGGG": 1842475, "GCAAA": 1335513, "GCAAT": 1051907, "GCAAC": 904007, "GCAAG": 1157064, "GCATA": 789927, "GCATT": 1213755, "GCATC": 1764479, "GCATG": 1335408, "GCACA": 4041883, "GCACT": 2343029, "GCACC": 1723675, "GCACG": 1013258, "GCAGA": 2323178, "GCAGT": 1666937, "GCAGC": 4180834, "GCAGG": 3477535, "GCTAA": 428144, "GCTAT": 434110, "GCTAC": 513129, "GCTAG": 467507, "GCTTA": 558378, "GCTTT": 1966047, "GCTTC": 2874746, "GCTTG": 2179585, "GCTCA": 1953127, "GCTCT": 2301807, "GCTCC": 3144226, "GCTCG": 1126125, "GCTGA": 2186722, "GCTGT": 2305313, "GCTGC": 3881130, "GCTGG": 3790317, "GCCAA": 1460356, "GCCAT": 1876032, "GCCAC": 2383655, "GCCAG": 3386529, "GCCTA": 349136, "GCCTT": 2192557, "GCCTC": 2501217, "GCCTG": 2442294, "GCCCA": 2253825, "GCCCT": 1774914, "GCCCC": 1886202, "GCCCG": 1383898, "GCCGA": 830198, "GCCGT": 949285, "GCCGC": 1964771, "GCCGG": 1633615, "GCGAA": 474180, "GCGAT": 598354, "GCGAC": 486539, "GCGAG": 775356, "GCGTA": 343204, "GCGTT": 500167, "GCGTC": 784064, "GCGTG": 796949, "GCGCA": 933879, "GCGCT": 1161807, "GCGCC": 1238659, "GCGCG": 736503, "GCGGA": 992975, "GCGGT": 944082, "GCGGC": 1969625, "GCGGG": 1431808, "GGAAA": 1351627, "GGAAT": 1084959, "GGAAC": 1300262, "GGAAG": 5135849, "GGATA": 682329, "GGATT": 956637, "GGATC": 1439834, "GGATG": 2184689, "GGACA": 1632814, "GGACT": 1299834, "GGACC": 1160539, "GGACG": 730709, "GGAGA": 2324332, "GGAGT": 1299708, "GGAGC": 2252529, "GGAGG": 2694378, "GGTAA": 711826, "GGTAT": 618424, "GGTAC": 927149, "GGTAG": 1307007, "GGTTA": 464931, "GGTTT": 1528007, "GGTTC": 1468559, "GGTTG": 1453409, "GGTCA": 1894567, "GGTCT": 1830221, "GGTCC": 1951220, "GGTCG": 729252, "GGTGA": 1964587, "GGTGT": 1665760, "GGTGC": 1878866, "GGTGG": 2796532, "GGCAA": 1382115, "GGCAT": 1669781, "GGCAC": 1803422, "GGCAG": 3492957, "GGCTA": 539486, "GGCTT": 2092453, "GGCTC": 2332456, "GGCTG": 3518597, "GGCCA": 3084571, "GGCCT": 2673285, "GGCCC": 2371592, "GGCCG": 1736372, "GGCGA": 926418, "GGCGT": 940845, "GGCGC": 1444879, "GGCGG": 2029816, "GGGAA": 1474299, "GGGAT": 1186875, "GGGAC": 1314262, "GGGAG": 2160083, "GGGTA": 768834, "GGGTT": 1326586, "GGGTC": 1707395, "GGGTG": 2157494, "GGGCA": 2589161, "GGGCT": 2561094, "GGGCC": 2802898, "GGGCG": 1270250, "GGGGA": 1739404, "GGGGT": 2023020, "GGGGC": 2646998, "GGGGG": 2356544 }, "overrepresented_sequences": {} }, "read2_before_filtering": { "total_reads": 10000000, "total_bases": 1500000000, "q20_bases": 1484512451, "q30_bases": 1458809565, "total_cycles": 150, "quality_curves": { "A": [ 37.9101, 38.8922, 39.1115, 39.3303, 39.3682, 39.4307, 39.4066, 39.4004, 39.4775, 39.537, 39.5505, 39.568, 39.5593, 39.5408, 39.5048, 39.5588, 39.5917, 39.6264, 39.6103, 39.6425, 39.6099, 39.6372, 39.635, 39.6478, 39.6389, 39.4974, 39.4989, 39.4955, 39.4724, 39.5094, 39.4539, 39.5059, 39.5492, 39.5403, 39.5279, 39.4936, 39.5138, 39.5445, 39.5287, 39.5487, 39.554, 39.5525, 39.52, 39.5452, 39.5579, 39.3849, 39.5572, 39.568, 39.54, 39.5655, 39.5673, 39.562, 39.5704, 39.5709, 39.5534, 39.5683, 39.5235, 39.5695, 39.5722, 39.5411, 39.5742, 39.5394, 39.5573, 39.5518, 39.554, 39.5672, 39.5677, 39.5768, 39.573, 39.5077, 39.5365, 39.5483, 39.5716, 39.549, 39.5486, 39.5685, 39.5625, 39.5685, 39.5572, 39.5578, 39.5169, 39.4568, 39.5538, 39.5326, 39.5529, 39.54, 39.4729, 39.5487, 39.5444, 39.5359, 39.5339, 39.5189, 39.5291, 39.4992, 39.5161, 39.4917, 39.4966, 39.487, 39.4863, 39.4485, 39.4612, 39.4518, 39.4291, 39.4334, 39.4031, 39.404, 39.3803, 39.3741, 39.3503, 39.3469, 39.3233, 39.2821, 39.2956, 39.2298, 39.2365, 39.2231, 39.2161, 39.1906, 39.1876, 39.1586, 39.1336, 39.1193, 39.1095, 39.0648, 39.0628, 38.9896, 39.0112, 39.0044, 39.0195, 38.9703, 38.9194, 38.9523, 38.929, 38.9173, 38.9215, 38.887, 38.877, 38.8735, 38.8199, 38.819, 38.82, 38.7559, 38.8036, 38.7664, 38.7583, 38.7494, 38.7207, 38.6954, 38.6938, 38.6808 ], "T": [ 38.9116, 39.4747, 39.5869, 39.6554, 39.6938, 39.6959, 39.7304, 39.7248, 39.7436, 39.751, 39.7369, 39.7597, 39.7726, 39.7669, 39.7692, 39.7686, 39.7765, 39.78, 39.786, 39.7864, 39.795, 39.8018, 39.8042, 39.804, 39.8024, 39.6443, 39.6474, 39.6596, 39.6572, 39.6587, 39.6614, 39.668, 39.6694, 39.6789, 39.6783, 39.683, 39.688, 39.6861, 39.6873, 39.6958, 39.6925, 39.7001, 39.6991, 39.7008, 39.7068, 39.7067, 39.7068, 39.7104, 39.7148, 39.7107, 39.7152, 39.7166, 39.714, 39.7158, 39.7202, 39.7192, 39.723, 39.7245, 39.722, 39.7257, 39.7283, 39.7243, 39.7304, 39.7286, 39.7273, 39.731, 39.7319, 39.7283, 39.7317, 39.7308, 39.7315, 39.7303, 39.7302, 39.7288, 39.7312, 39.7346, 39.7285, 39.73, 39.7314, 39.7273, 39.7282, 39.724, 39.7253, 39.7248, 39.7267, 39.7225, 39.7249, 39.7179, 39.7163, 39.7137, 39.7163, 39.708, 39.7051, 39.7029, 39.7003, 39.6993, 39.6955, 39.6906, 39.6847, 39.6819, 39.6771, 39.6745, 39.6776, 39.6642, 39.6693, 39.656, 39.6558, 39.6571, 39.6524, 39.646, 39.6357, 39.6353, 39.6349, 39.6266, 39.6239, 39.6209, 39.605, 39.595, 39.5898, 39.5881, 39.5841, 39.5766, 39.5659, 39.557, 39.552, 39.5435, 39.5352, 39.5203, 39.5083, 39.5064, 39.4877, 39.4885, 39.4738, 39.4665, 39.4475, 39.4478, 39.4284, 39.4307, 39.4071, 39.3923, 39.3912, 39.3952, 39.3608, 39.3813, 39.3573, 39.3458, 39.3485, 39.3346, 39.3296, 39.322 ], "C": [ 37.7996, 38.9995, 39.2754, 39.4438, 39.5156, 39.5465, 39.5795, 39.6215, 39.6239, 39.6548, 39.6914, 39.6867, 39.7055, 39.71, 39.7114, 39.7099, 39.7105, 39.7054, 39.7241, 39.7199, 39.7259, 39.7272, 39.7317, 39.7193, 39.7329, 39.5566, 39.5559, 39.5629, 39.5664, 39.558, 39.5689, 39.5618, 39.5585, 39.5766, 39.5717, 39.5664, 39.572, 39.5671, 39.5519, 39.56, 39.5598, 39.5541, 39.5631, 39.5644, 39.5546, 39.553, 39.5579, 39.5571, 39.5626, 39.5613, 39.5586, 39.5663, 39.5635, 39.5587, 39.5707, 39.5577, 39.5615, 39.5648, 39.5685, 39.5603, 39.5686, 39.5674, 39.5565, 39.5657, 39.5643, 39.5536, 39.5643, 39.564, 39.5593, 39.5638, 39.5631, 39.5559, 39.5641, 39.56, 39.5527, 39.5627, 39.5658, 39.5543, 39.5645, 39.5618, 39.553, 39.5624, 39.5575, 39.5508, 39.5602, 39.556, 39.5494, 39.5561, 39.5555, 39.5509, 39.56, 39.5557, 39.5451, 39.5588, 39.5566, 39.5465, 39.5538, 39.5486, 39.5473, 39.5558, 39.5477, 39.5465, 39.5502, 39.548, 39.5412, 39.5433, 39.539, 39.5293, 39.5316, 39.5233, 39.5131, 39.5175, 39.5063, 39.4945, 39.4942, 39.4833, 39.4705, 39.4655, 39.4557, 39.431, 39.4321, 39.4157, 39.3949, 39.3929, 39.3666, 39.3498, 39.3372, 39.3072, 39.288, 39.2704, 39.2422, 39.1993, 39.1985, 39.1591, 39.1189, 39.1017, 39.0666, 39.0124, 39.009, 38.952, 38.9024, 38.8953, 38.8257, 38.786, 38.7658, 38.7238, 38.6598, 38.6428, 38.5934, 38.527 ], "G": [ 39.2769, 39.3348, 39.2082, 39.365, 39.39, 39.2939, 39.3613, 39.342, 39.3847, 39.4273, 39.4777, 39.4751, 39.4825, 39.4675, 39.4621, 39.4915, 39.4995, 39.4985, 39.5191, 39.5222, 39.5117, 39.5297, 39.537, 39.5267, 39.5403, 39.2787, 39.2645, 39.2943, 39.3003, 39.2862, 39.3038, 39.3174, 39.3033, 39.329, 39.328, 39.3195, 39.3422, 39.3459, 39.3287, 39.3561, 39.3561, 39.3463, 39.3694, 39.3701, 39.3581, 39.3685, 39.3819, 39.3727, 39.39, 39.3958, 39.3825, 39.4008, 39.4011, 39.3909, 39.4104, 39.4106, 39.4007, 39.4226, 39.4214, 39.4061, 39.4221, 39.4291, 39.4157, 39.4316, 39.434, 39.4261, 39.4401, 39.442, 39.4259, 39.4426, 39.4457, 39.4354, 39.4501, 39.4493, 39.4394, 39.4545, 39.4519, 39.4432, 39.4545, 39.4548, 39.4433, 39.454, 39.455, 39.4438, 39.457, 39.4571, 39.4436, 39.456, 39.4564, 39.4455, 39.4576, 39.4487, 39.4442, 39.4517, 39.4463, 39.4284, 39.4367, 39.4365, 39.411, 39.4244, 39.4144, 39.4007, 39.4003, 39.3939, 39.3735, 39.3741, 39.3695, 39.3437, 39.3461, 39.3401, 39.3167, 39.3121, 39.3052, 39.2695, 39.2851, 39.2531, 39.2395, 39.2372, 39.2152, 39.2029, 39.1953, 39.182, 39.1521, 39.1451, 39.1409, 39.0867, 39.1001, 39.0777, 39.0477, 39.0481, 39.0487, 39.0183, 39.0193, 39.0273, 38.994, 39.0048, 38.9981, 38.9765, 38.9765, 38.9862, 38.9656, 38.9786, 38.9888, 38.9635, 38.9799, 38.9939, 38.9612, 38.9737, 38.9768, 38.9531 ], "mean": [ 38.4865, 39.2239, 39.31, 39.4314, 39.4678, 39.4765, 39.5318, 39.5331, 39.5646, 39.5802, 39.6028, 39.617, 39.6244, 39.6153, 39.6069, 39.625, 39.6353, 39.6444, 39.6484, 39.6579, 39.6532, 39.6663, 39.6694, 39.6682, 39.6711, 39.483, 39.4838, 39.492, 39.4881, 39.4951, 39.4869, 39.5021, 39.5122, 39.5199, 39.5148, 39.5072, 39.5179, 39.5242, 39.5154, 39.5288, 39.5288, 39.5296, 39.5271, 39.5338, 39.536, 39.4935, 39.5397, 39.5436, 39.5409, 39.5471, 39.5474, 39.5502, 39.551, 39.5506, 39.5528, 39.5526, 39.5437, 39.5595, 39.5603, 39.5503, 39.5623, 39.5543, 39.5566, 39.559, 39.5591, 39.5612, 39.5656, 39.5671, 39.5645, 39.5514, 39.5585, 39.5592, 39.5686, 39.5613, 39.5598, 39.57, 39.5669, 39.5659, 39.5671, 39.5652, 39.5521, 39.5403, 39.5626, 39.5549, 39.5643, 39.559, 39.5395, 39.5601, 39.5583, 39.5536, 39.5574, 39.5479, 39.5482, 39.5441, 39.5449, 39.533, 39.536, 39.5306, 39.5239, 39.5184, 39.5145, 39.5095, 39.5038, 39.4987, 39.4864, 39.4832, 39.4735, 39.4646, 39.4574, 39.4503, 39.4347, 39.423, 39.4199, 39.3895, 39.3948, 39.377, 39.3666, 39.355, 39.3423, 39.3271, 39.3174, 39.3017, 39.2856, 39.2689, 39.2577, 39.2188, 39.2235, 39.2028, 39.1929, 39.1749, 39.1492, 39.1415, 39.1317, 39.1189, 39.0991, 39.0886, 39.0706, 39.0535, 39.0332, 39.0187, 39.0037, 38.9897, 38.9811, 38.9615, 38.9542, 38.9432, 38.9146, 38.9046, 38.8926, 38.8686 ] }, "content_curves": { "A": [ 0.120453, 0.135133, 0.211591, 0.251255, 0.292463, 0.328483, 0.202052, 0.213191, 0.207376, 0.289869, 0.225995, 0.210663, 0.225256, 0.238153, 0.247089, 0.235638, 0.247501, 0.26024, 0.250051, 0.254226, 0.257238, 0.241899, 0.245421, 0.251089, 0.239728, 0.247314, 0.250392, 0.237076, 0.244258, 0.2493, 0.237755, 0.245336, 0.250741, 0.239411, 0.245607, 0.250455, 0.23947, 0.247027, 0.251074, 0.239191, 0.246726, 0.250016, 0.239151, 0.244679, 0.249297, 0.23901, 0.244339, 0.249457, 0.237685, 0.244892, 0.249492, 0.238439, 0.245012, 0.249892, 0.238127, 0.245572, 0.248868, 0.238238, 0.24514, 0.249054, 0.238069, 0.245305, 0.249185, 0.238473, 0.24551, 0.250018, 0.238639, 0.246309, 0.250036, 0.239649, 0.24658, 0.250872, 0.240808, 0.247424, 0.251884, 0.241235, 0.248125, 0.252098, 0.24114, 0.248283, 0.253173, 0.242598, 0.24992, 0.254122, 0.243226, 0.249701, 0.254682, 0.244693, 0.251916, 0.254774, 0.244942, 0.251665, 0.256091, 0.247104, 0.253755, 0.258051, 0.247363, 0.254459, 0.258639, 0.248378, 0.254894, 0.259037, 0.250038, 0.255694, 0.260352, 0.250992, 0.257769, 0.261185, 0.2529, 0.258667, 0.261849, 0.253518, 0.25919, 0.262983, 0.25379, 0.259673, 0.263629, 0.255839, 0.262346, 0.264849, 0.256084, 0.262639, 0.265477, 0.256886, 0.263205, 0.265885, 0.257333, 0.263216, 0.267192, 0.258965, 0.263918, 0.266888, 0.259171, 0.263904, 0.266813, 0.259195, 0.263881, 0.267183, 0.259659, 0.264274, 0.266604, 0.259805, 0.264743, 0.267271, 0.260405, 0.265226, 0.267248, 0.259941, 0.264645, 0.266699 ], "T": [ 0.110201, 0.2744, 0.274773, 0.186425, 0.182658, 0.189984, 0.292188, 0.248802, 0.255189, 0.215473, 0.178241, 0.214676, 0.220248, 0.218034, 0.223209, 0.213945, 0.206788, 0.212415, 0.204468, 0.204756, 0.215644, 0.212443, 0.213016, 0.221286, 0.213427, 0.21084, 0.221219, 0.213089, 0.210798, 0.220165, 0.212632, 0.209867, 0.220062, 0.211439, 0.209109, 0.218435, 0.210174, 0.207444, 0.217641, 0.211568, 0.208051, 0.219101, 0.211035, 0.209206, 0.219557, 0.210846, 0.209927, 0.218235, 0.211309, 0.208263, 0.217698, 0.209472, 0.208223, 0.217224, 0.209651, 0.207812, 0.217425, 0.209912, 0.208239, 0.218239, 0.210287, 0.207356, 0.217208, 0.210072, 0.207584, 0.217269, 0.210346, 0.207223, 0.217723, 0.210191, 0.207075, 0.216107, 0.208885, 0.207376, 0.216495, 0.209673, 0.207457, 0.216263, 0.210562, 0.20747, 0.216337, 0.210147, 0.207206, 0.215852, 0.209234, 0.208422, 0.216565, 0.209165, 0.207192, 0.215608, 0.209068, 0.206572, 0.215605, 0.208878, 0.206129, 0.214171, 0.208239, 0.206388, 0.215195, 0.209431, 0.206431, 0.214878, 0.208201, 0.205988, 0.213905, 0.207727, 0.205569, 0.213293, 0.207114, 0.205897, 0.2131, 0.207439, 0.204911, 0.212227, 0.207057, 0.204908, 0.212402, 0.205884, 0.204101, 0.212259, 0.207187, 0.204544, 0.211782, 0.206155, 0.204844, 0.211454, 0.206744, 0.205417, 0.211378, 0.207259, 0.205446, 0.212002, 0.207595, 0.20618, 0.212152, 0.207986, 0.20695, 0.212414, 0.209004, 0.20763, 0.213543, 0.210168, 0.20801, 0.214065, 0.210624, 0.208691, 0.214607, 0.211324, 0.209505, 0.215455 ], "C": [ 0.39637, 0.266719, 0.271111, 0.26586, 0.228714, 0.242595, 0.245119, 0.298206, 0.288491, 0.225644, 0.291915, 0.289567, 0.272474, 0.268461, 0.263734, 0.267065, 0.264081, 0.255296, 0.253194, 0.25792, 0.257552, 0.267124, 0.264021, 0.258435, 0.265841, 0.263201, 0.260602, 0.268526, 0.265172, 0.261885, 0.269261, 0.265599, 0.26107, 0.267866, 0.26434, 0.262061, 0.269249, 0.265049, 0.26197, 0.268505, 0.26456, 0.260732, 0.268751, 0.265862, 0.26224, 0.269841, 0.265626, 0.262734, 0.270122, 0.267006, 0.263292, 0.270686, 0.266454, 0.263079, 0.270929, 0.26618, 0.263364, 0.270922, 0.26744, 0.264408, 0.270201, 0.267005, 0.264456, 0.270872, 0.266975, 0.263268, 0.270879, 0.266787, 0.264236, 0.269468, 0.266448, 0.263208, 0.270352, 0.265788, 0.262758, 0.270018, 0.265122, 0.26212, 0.268541, 0.264178, 0.26033, 0.266706, 0.262527, 0.2603, 0.26734, 0.262118, 0.259649, 0.265822, 0.261483, 0.258565, 0.264358, 0.261216, 0.257537, 0.263026, 0.258897, 0.255795, 0.261307, 0.257038, 0.253119, 0.25937, 0.255043, 0.251998, 0.257494, 0.253413, 0.249773, 0.254547, 0.250205, 0.248481, 0.252601, 0.248039, 0.245794, 0.250485, 0.246759, 0.243097, 0.247978, 0.244688, 0.24052, 0.245459, 0.240958, 0.23745, 0.241918, 0.23744, 0.23523, 0.240247, 0.235492, 0.23335, 0.237631, 0.232975, 0.23037, 0.234008, 0.229808, 0.227509, 0.231641, 0.228144, 0.225736, 0.229085, 0.225576, 0.223247, 0.226829, 0.223277, 0.220576, 0.223621, 0.221024, 0.218573, 0.221836, 0.219679, 0.217171, 0.220624, 0.216981, 0.214509 ], "G": [ 0.372976, 0.323748, 0.242524, 0.296459, 0.296164, 0.238938, 0.260641, 0.239801, 0.248944, 0.269014, 0.303849, 0.285094, 0.282022, 0.275352, 0.265967, 0.283352, 0.281631, 0.272048, 0.292288, 0.283098, 0.269566, 0.278534, 0.277542, 0.26919, 0.281003, 0.278645, 0.267786, 0.281309, 0.279771, 0.26865, 0.280351, 0.279199, 0.268127, 0.281284, 0.280944, 0.269049, 0.281107, 0.28048, 0.269315, 0.280736, 0.280663, 0.270151, 0.281062, 0.280253, 0.268906, 0.280303, 0.280108, 0.269575, 0.280884, 0.279838, 0.269518, 0.281403, 0.280311, 0.269805, 0.281293, 0.280435, 0.270343, 0.280928, 0.279181, 0.2683, 0.281443, 0.280334, 0.269151, 0.280583, 0.279932, 0.269446, 0.280136, 0.279682, 0.268005, 0.280692, 0.279897, 0.269813, 0.279956, 0.279413, 0.268863, 0.279074, 0.279296, 0.269518, 0.279757, 0.280069, 0.27016, 0.280549, 0.280346, 0.269726, 0.2802, 0.279759, 0.269104, 0.28032, 0.27941, 0.271052, 0.281632, 0.280546, 0.270768, 0.280992, 0.281219, 0.271982, 0.283092, 0.282114, 0.273046, 0.282821, 0.283631, 0.274087, 0.284268, 0.284905, 0.27597, 0.286734, 0.286458, 0.277041, 0.287385, 0.287397, 0.279257, 0.288558, 0.28914, 0.281694, 0.291176, 0.290731, 0.28345, 0.292818, 0.292595, 0.285442, 0.294811, 0.295377, 0.287511, 0.296712, 0.296458, 0.289311, 0.298292, 0.298392, 0.29106, 0.299769, 0.300828, 0.2936, 0.301593, 0.301772, 0.295299, 0.303734, 0.303592, 0.297157, 0.304508, 0.304818, 0.299277, 0.306406, 0.306223, 0.300092, 0.307135, 0.306404, 0.300975, 0.308111, 0.30887, 0.303337 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.769347, 0.590467, 0.513635, 0.562319, 0.524879, 0.481533, 0.50576, 0.538006, 0.537435, 0.494658, 0.595764, 0.574661, 0.554496, 0.543813, 0.529702, 0.550417, 0.545712, 0.527345, 0.545481, 0.541018, 0.527118, 0.545658, 0.541563, 0.527626, 0.546845, 0.541846, 0.528389, 0.549834, 0.544944, 0.530535, 0.549613, 0.544797, 0.529197, 0.54915, 0.545284, 0.53111, 0.550356, 0.545529, 0.531284, 0.549241, 0.545223, 0.530883, 0.549814, 0.546115, 0.531147, 0.550144, 0.545734, 0.532309, 0.551006, 0.546844, 0.53281, 0.552089, 0.546765, 0.532884, 0.552222, 0.546616, 0.533707, 0.551851, 0.54662, 0.532708, 0.551645, 0.547338, 0.533607, 0.551455, 0.546907, 0.532713, 0.551015, 0.546469, 0.532241, 0.55016, 0.546345, 0.53302, 0.550307, 0.5452, 0.531621, 0.549092, 0.544418, 0.531639, 0.548298, 0.544247, 0.53049, 0.547256, 0.542874, 0.530026, 0.547539, 0.541877, 0.528753, 0.546142, 0.540892, 0.529618, 0.54599, 0.541763, 0.528304, 0.544018, 0.540116, 0.527777, 0.544399, 0.539153, 0.526166, 0.542191, 0.538674, 0.526084, 0.541761, 0.538318, 0.525743, 0.541281, 0.536662, 0.525522, 0.539986, 0.535436, 0.525051, 0.539043, 0.535899, 0.524791, 0.539153, 0.535419, 0.523969, 0.538277, 0.533553, 0.522892, 0.536728, 0.532817, 0.522741, 0.536959, 0.531951, 0.522661, 0.535923, 0.531367, 0.52143, 0.533776, 0.530636, 0.521109, 0.533234, 0.529917, 0.521035, 0.532819, 0.529168, 0.520403, 0.531337, 0.528095, 0.519853, 0.530028, 0.527247, 0.518664, 0.528971, 0.526083, 0.518146, 0.528736, 0.52585, 0.517846 ] }, "kmer_count": { "AAAAA": 2839533, "AAAAT": 1893759, "AAAAC": 1621497, "AAAAG": 2466677, "AAATA": 1091619, "AAATT": 1372400, "AAATC": 1255028, "AAATG": 1760692, "AAACA": 1726575, "AAACT": 1456730, "AAACC": 1292324, "AAACG": 522146, "AAAGA": 4386267, "AAAGT": 1500788, "AAAGC": 1891886, "AAAGG": 1917307, "AATAA": 838864, "AATAT": 856573, "AATAC": 660464, "AATAG": 475146, "AATTA": 682497, "AATTT": 1121516, "AATTC": 947094, "AATTG": 987646, "AATCA": 1057982, "AATCT": 949574, "AATCC": 919925, "AATCG": 332960, "AATGA": 1662744, "AATGT": 1219372, "AATGC": 1185502, "AATGG": 1481975, "AACAA": 1829879, "AACAT": 1416161, "AACAC": 1079273, "AACAG": 1928489, "AACTA": 733414, "AACTT": 1233802, "AACTC": 1045334, "AACTG": 1604893, "AACCA": 1567045, "AACCT": 1339297, "AACCC": 1118161, "AACCG": 554986, "AACGA": 609433, "AACGT": 1232273, "AACGC": 496092, "AACGG": 551111, "AAGAA": 4405105, "AAGAT": 2668940, "AAGAC": 1879511, "AAGAG": 6654984, "AAGTA": 1053156, "AAGTT": 1435561, "AAGTC": 1288406, "AAGTG": 1668902, "AAGCA": 2276240, "AAGCT": 2203990, "AAGCC": 2034937, "AAGCG": 957437, "AAGGA": 3052106, "AAGGT": 1492989, "AAGGC": 2184961, "AAGGG": 1404912, "ATAAA": 971666, "ATAAT": 546431, "ATAAC": 428581, "ATAAG": 664249, "ATATA": 422734, "ATATT": 764828, "ATATC": 605160, "ATATG": 832794, "ATACA": 682941, "ATACT": 529652, "ATACC": 579936, "ATACG": 212796, "ATAGA": 636589, "ATAGT": 378132, "ATAGC": 421420, "ATAGG": 299501, "ATTAA": 777443, "ATTAT": 737585, "ATTAC": 659602, "ATTAG": 378546, "ATTTA": 700862, "ATTTT": 1253426, "ATTTC": 1054979, "ATTTG": 1258699, "ATTCA": 1144534, "ATTCT": 1079266, "ATTCC": 1038802, "ATTCG": 416989, "ATTGA": 1389060, "ATTGT": 942626, "ATTGC": 1032443, "ATTGG": 1128675, "ATCAA": 1640512, "ATCAT": 1429405, "ATCAC": 1147696, "ATCAG": 1487312, "ATCTA": 686585, "ATCTT": 1227248, "ATCTC": 1596395, "ATCTG": 1457673, "ATCCA": 1669709, "ATCCT": 1557368, "ATCCC": 1142837, "ATCCG": 776861, "ATCGA": 726747, "ATCGT": 579574, "ATCGC": 617738, "ATCGG": 3366798, "ATGAA": 2403541, "ATGAT": 1650217, "ATGAC": 1439031, "ATGAG": 1921471, "ATGTA": 731523, "ATGTT": 1173646, "ATGTC": 1159188, "ATGTG": 1638020, "ATGCA": 1353149, "ATGCT": 1554592, "ATGCC": 1639486, "ATGCG": 480352, "ATGGA": 2234213, "ATGGT": 1235526, "ATGGC": 1917809, "ATGGG": 1348980, "ACAAA": 1646299, "ACAAT": 891036, "ACAAC": 1344278, "ACAAG": 2144807, "ACATA": 478622, "ACATT": 1107572, "ACATC": 1621853, "ACATG": 1437508, "ACACA": 1313094, "ACACT": 950384, "ACACC": 1426840, "ACACG": 567913, "ACAGA": 2530132, "ACAGT": 1424163, "ACAGC": 2289140, "ACAGG": 1594052, "ACTAA": 482697, "ACTAT": 700960, "ACTAC": 956303, "ACTAG": 354090, "ACTTA": 542524, "ACTTT": 1217605, "ACTTC": 1578818, "ACTTG": 1040434, "ACTCA": 1097788, "ACTCT": 1038235, "ACTCC": 1297856, "ACTCG": 476419, "ACTGA": 1439319, "ACTGT": 1241011, "ACTGC": 1664430, "ACTGG": 1873778, "ACCAA": 1808371, "ACCAT": 1543571, "ACCAC": 1660770, "ACCAG": 2507772, "ACCTA": 677277, "ACCTT": 1271189, "ACCTC": 1630591, "ACCTG": 2677536, "ACCCA": 1586276, "ACCCT": 1489788, "ACCCC": 1643564, "ACCCG": 762013, "ACCGA": 696030, "ACCGT": 585169, "ACCGC": 979867, "ACCGG": 831726, "ACGAA": 484729, "ACGAT": 418853, "ACGAC": 648135, "ACGAG": 1022124, "ACGTA": 212423, "ACGTT": 351843, "ACGTC": 535953, "ACGTG": 1628931, "ACGCA": 531303, "ACGCT": 605311, "ACGCC": 922857, "ACGCG": 372091, "ACGGA": 688666, "ACGGT": 441115, "ACGGC": 962963, "ACGGG": 730969, "AGAAA": 3284830, "AGAAT": 1627549, "AGAAC": 1955113, "AGAAG": 4701603, "AGATA": 918057, "AGATT": 1373429, "AGATC": 5308917, "AGATG": 2720347, "AGACA": 1833040, "AGACT": 1346947, "AGACC": 1784752, "AGACG": 812024, "AGAGA": 3068744, "AGAGT": 2597954, "AGAGC": 4767576, "AGAGG": 2309159, "AGTAA": 637899, "AGTAT": 815793, "AGTAC": 1054010, "AGTAG": 584396, "AGTTA": 608605, "AGTTT": 1286043, "AGTTC": 1489155, "AGTTG": 1112644, "AGTCA": 1225172, "AGTCT": 1041381, "AGTCC": 1304900, "AGTCG": 507918, "AGTGA": 1622449, "AGTGT": 2360707, "AGTGC": 1466870, "AGTGG": 1994079, "AGCAA": 1982284, "AGCAT": 1295659, "AGCAC": 1695116, "AGCAG": 4097455, "AGCTA": 929221, "AGCTT": 1454447, "AGCTC": 2099004, "AGCTG": 4058089, "AGCCA": 2594553, "AGCCT": 2036758, "AGCCC": 2524691, "AGCCG": 1303139, "AGCGA": 837088, "AGCGT": 2980456, "AGCGC": 1234598, "AGCGG": 1355324, "AGGAA": 2748120, "AGGAT": 1630508, "AGGAC": 1978869, "AGGAG": 4094717, "AGGTA": 647014, "AGGTT": 975020, "AGGTC": 2031836, "AGGTG": 2214647, "AGGCA": 1891333, "AGGCT": 1861592, "AGGCC": 2648749, "AGGCG": 1073339, "AGGGA": 3080298, "AGGGT": 869190, "AGGGC": 1729962, "AGGGG": 1240732, "TAAAA": 1152979, "TAAAT": 656841, "TAAAC": 585356, "TAAAG": 1170306, "TAATA": 393810, "TAATT": 470026, "TAATC": 376900, "TAATG": 725016, "TAACA": 605767, "TAACT": 470083, "TAACC": 439545, "TAACG": 134934, "TAAGA": 859664, "TAAGT": 459256, "TAAGC": 536290, "TAAGG": 705497, "TATAA": 530279, "TATAT": 474399, "TATAC": 333978, "TATAG": 326184, "TATTA": 503558, "TATTT": 889681, "TATTC": 658420, "TATTG": 789576, "TATCA": 928558, "TATCT": 681747, "TATCC": 655246, "TATCG": 265833, "TATGA": 1203746, "TATGT": 753033, "TATGC": 759913, "TATGG": 971541, "TACAA": 1188760, "TACAT": 792669, "TACAC": 706092, "TACAG": 1334123, "TACTA": 501792, "TACTT": 791075, "TACTC": 638594, "TACTG": 1010481, "TACCA": 1147811, "TACCT": 1081769, "TACCC": 726359, "TACCG": 470044, "TACGA": 481671, "TACGT": 358689, "TACGC": 337912, "TACGG": 396396, "TAGAA": 834058, "TAGAT": 1183407, "TAGAC": 408336, "TAGAG": 731565, "TAGTA": 287521, "TAGTT": 349853, "TAGTC": 292267, "TAGTG": 554047, "TAGCA": 627243, "TAGCT": 483789, "TAGCC": 520674, "TAGCG": 150040, "TAGGA": 451380, "TAGGT": 1258872, "TAGGC": 331633, "TAGGG": 2030050, "TTAAA": 1020315, "TTAAT": 576805, "TTAAC": 449084, "TTAAG": 712403, "TTATA": 459111, "TTATT": 822329, "TTATC": 634966, "TTATG": 849989, "TTACA": 900448, "TTACT": 721840, "TTACC": 682019, "TTACG": 254121, "TTAGA": 637131, "TTAGT": 364973, "TTAGC": 419020, "TTAGG": 310265, "TTTAA": 864990, "TTTAT": 872704, "TTTAC": 687331, "TTTAG": 548685, "TTTTA": 897727, "TTTTT": 1445042, "TTTTC": 1245233, "TTTTG": 1502317, "TTTCA": 1303585, "TTTCT": 1575184, "TTTCC": 1350875, "TTTCG": 339895, "TTTGA": 1830538, "TTTGT": 1314563, "TTTGC": 1340013, "TTTGG": 1666995, "TTCAA": 1542129, "TTCAT": 1281465, "TTCAC": 1164376, "TTCAG": 2055168, "TTCTA": 873739, "TTCTT": 1598506, "TTCTC": 1545766, "TTCTG": 2004348, "TTCCA": 1943446, "TTCCT": 2063714, "TTCCC": 1459774, "TTCCG": 715488, "TTCGA": 704352, "TTCGT": 560619, "TTCGC": 520794, "TTCGG": 615455, "TTGAA": 1707814, "TTGAT": 1231406, "TTGAC": 1035926, "TTGAG": 1336346, "TTGTA": 635428, "TTGTT": 1010751, "TTGTC": 944038, "TTGTG": 1398285, "TTGCA": 1195127, "TTGCT": 1538278, "TTGCC": 1357509, "TTGCG": 344942, "TTGGA": 1819656, "TTGGT": 1127772, "TTGGC": 1445261, "TTGGG": 1135509, "TCAAA": 1433299, "TCAAT": 819876, "TCAAC": 2185277, "TCAAG": 2194516, "TCATA": 489388, "TCATT": 1250281, "TCATC": 1976874, "TCATG": 1504585, "TCACA": 1235282, "TCACT": 1133172, "TCACC": 1890292, "TCACG": 519887, "TCAGA": 2111805, "TCAGT": 1344256, "TCAGC": 2163499, "TCAGG": 1657181, "TCTAA": 564247, "TCTAT": 708098, "TCTAC": 1113752, "TCTAG": 488287, "TCTTA": 621186, "TCTTT": 1381150, "TCTTC": 2180811, "TCTTG": 1206192, "TCTCA": 1390207, "TCTCT": 1531642, "TCTCC": 1914684, "TCTCG": 985106, "TCTGA": 1657159, "TCTGT": 1480225, "TCTGC": 2014721, "TCTGG": 2199321, "TCCAA": 1616105, "TCCAT": 1307578, "TCCAC": 1659062, "TCCAG": 3086464, "TCCTA": 814521, "TCCTT": 1437107, "TCCTC": 2125807, "TCCTG": 3164175, "TCCCA": 1764013, "TCCCT": 1571753, "TCCCC": 1699105, "TCCCG": 972794, "TCCGA": 701681, "TCCGT": 579636, "TCCGC": 1051413, "TCCGG": 1060733, "TCGAA": 506717, "TCGAT": 415731, "TCGAC": 614799, "TCGAG": 933530, "TCGTA": 243732, "TCGTT": 309606, "TCGTC": 671880, "TCGTG": 2997791, "TCGCA": 488976, "TCGCT": 659001, "TCGCC": 1160128, "TCGCG": 370054, "TCGGA": 3479228, "TCGGT": 837365, "TCGGC": 857321, "TCGGG": 830324, "TGAAA": 2225509, "TGAAT": 1255731, "TGAAC": 1524801, "TGAAG": 3732501, "TGATA": 789435, "TGATT": 1068109, "TGATC": 1235830, "TGATG": 2611801, "TGACA": 1805170, "TGACT": 1368535, "TGACC": 1835556, "TGACG": 713428, "TGAGA": 2019914, "TGAGT": 1062831, "TGAGC": 1945547, "TGAGG": 2211591, "TGTAA": 663201, "TGTAT": 755830, "TGTAC": 965995, "TGTAG": 4080444, "TGTTA": 679118, "TGTTT": 1339161, "TGTTC": 1317664, "TGTTG": 1401791, "TGTCA": 1472191, "TGTCT": 1385938, "TGTCC": 1617528, "TGTCG": 653613, "TGTGA": 1706727, "TGTGT": 1488640, "TGTGC": 1746926, "TGTGG": 2683185, "TGCAA": 1384072, "TGCAT": 1015415, "TGCAC": 1353645, "TGCAG": 3320924, "TGCTA": 953661, "TGCTT": 1418670, "TGCTC": 1849640, "TGCTG": 4368343, "TGCCA": 2524362, "TGCCT": 2005356, "TGCCC": 2494379, "TGCCG": 1095805, "TGCGA": 520272, "TGCGT": 492193, "TGCGC": 961743, "TGCGG": 1173995, "TGGAA": 2771569, "TGGAT": 1887713, "TGGAC": 2280067, "TGGAG": 4092956, "TGGTA": 859818, "TGGTT": 1203945, "TGGTC": 1560402, "TGGTG": 2979542, "TGGCA": 2492690, "TGGCT": 2405035, "TGGCC": 3082765, "TGGCG": 1125523, "TGGGA": 1933227, "TGGGT": 1096415, "TGGGC": 2248176, "TGGGG": 1879803, "CAAAA": 1960775, "CAAAT": 1204425, "CAAAC": 1229652, "CAAAG": 2336352, "CAATA": 608209, "CAATT": 695482, "CAATC": 637198, "CAATG": 1540898, "CAACA": 2123317, "CAACT": 1304245, "CAACC": 1427367, "CAACG": 1535949, "CAAGA": 3204932, "CAAGT": 1658300, "CAAGC": 2168654, "CAAGG": 2668520, "CATAA": 455066, "CATAT": 532912, "CATAC": 450845, "CATAG": 458521, "CATTA": 740574, "CATTT": 1138581, "CATTC": 1042771, "CATTG": 1664666, "CATCA": 2336834, "CATCT": 1759283, "CATCC": 2128764, "CATCG": 1192283, "CATGA": 1711161, "CATGT": 1263900, "CATGC": 1329391, "CATGG": 2161507, "CACAA": 1268090, "CACAT": 1033178, "CACAC": 1233049, "CACAG": 2441714, "CACTA": 607611, "CACTT": 1034068, "CACTC": 1039300, "CACTG": 2052602, "CACCA": 2865837, "CACCT": 2018853, "CACCC": 1956369, "CACCG": 1169853, "CACGA": 584294, "CACGT": 591283, "CACGC": 791636, "CACGG": 981089, "CAGAA": 3209454, "CAGAT": 3414277, "CAGAC": 1827580, "CAGAG": 3145632, "CAGTA": 1005528, "CAGTT": 1533202, "CAGTC": 1324325, "CAGTG": 2540742, "CAGCA": 3795640, "CAGCT": 3273744, "CAGCC": 3539973, "CAGCG": 1636943, "CAGGA": 3104819, "CAGGT": 1635009, "CAGGC": 2454523, "CAGGG": 1928937, "CTAAA": 851388, "CTAAT": 439494, "CTAAC": 383049, "CTAAG": 702823, "CTATA": 427538, "CTATT": 638428, "CTATC": 618990, "CTATG": 1211967, "CTACA": 1536294, "CTACT": 995249, "CTACC": 1267193, "CTACG": 691274, "CTAGA": 714697, "CTAGT": 372221, "CTAGC": 433519, "CTAGG": 392507, "CTTAA": 608273, "CTTAT": 617702, "CTTAC": 652105, "CTTAG": 475697, "CTTTA": 787401, "CTTTT": 1335312, "CTTTC": 1264114, "CTTTG": 2047291, "CTTCA": 2411604, "CTTCT": 2189635, "CTTCC": 2484420, "CTTCG": 1084045, "CTTGA": 1131529, "CTTGT": 971762, "CTTGC": 1155359, "CTTGG": 1586083, "CTCAA": 1531888, "CTCAT": 1394190, "CTCAC": 1356495, "CTCAG": 2393002, "CTCTA": 805831, "CTCTT": 1525383, "CTCTC": 1568518, "CTCTG": 2421925, "CTCCA": 2589936, "CTCCT": 2466407, "CTCCC": 2061800, "CTCCG": 1248106, "CTCGA": 604487, "CTCGT": 560559, "CTCGC": 809498, "CTCGG": 1435971, "CTGAA": 2644241, "CTGAT": 1565391, "CTGAC": 1811331, "CTGAG": 2594481, "CTGTA": 992344, "CTGTT": 1418659, "CTGTC": 1680608, "CTGTG": 2851441, "CTGCA": 3038912, "CTGCT": 3598457, "CTGCC": 3324838, "CTGCG": 1519809, "CTGGA": 4065583, "CTGGT": 2181667, "CTGGC": 3302861, "CTGGG": 2822782, "CCAAA": 1922789, "CCAAT": 953234, "CCAAC": 1646313, "CCAAG": 3139554, "CCATA": 514381, "CCATT": 1223105, "CCATC": 2187791, "CCATG": 2197455, "CCACA": 1961145, "CCACT": 1484807, "CCACC": 2795315, "CCACG": 1120909, "CCAGA": 3675895, "CCAGT": 1898638, "CCAGC": 3811523, "CCAGG": 3206640, "CCTAA": 632958, "CCTAT": 686001, "CCTAC": 1170858, "CCTAG": 564190, "CCTTA": 634214, "CCTTT": 1379991, "CCTTC": 2256853, "CCTTG": 1432456, "CCTCA": 2254387, "CCTCT": 1923150, "CCTCC": 2749455, "CCTCG": 1047784, "CCTGA": 2642899, "CCTGT": 1953268, "CCTGC": 3500387, "CCTGG": 4228495, "CCCAA": 1789803, "CCCAT": 1249000, "CCCAC": 1857840, "CCCAG": 3816800, "CCCTA": 730474, "CCCTT": 1286648, "CCCTC": 1916964, "CCCTG": 3340537, "CCCCA": 2668248, "CCCCT": 1830498, "CCCCC": 2234395, "CCCCG": 1552417, "CCCGA": 1068517, "CCCGT": 713138, "CCCGC": 1582856, "CCCGG": 1671504, "CCGAA": 691207, "CCGAT": 407945, "CCGAC": 811076, "CCGAG": 1763574, "CCGTA": 448968, "CCGTT": 392317, "CCGTC": 771952, "CCGTG": 1381921, "CCGCA": 1316783, "CCGCT": 1180925, "CCGCC": 2203165, "CCGCG": 1121214, "CCGGA": 1223091, "CCGGT": 562966, "CCGGC": 1804581, "CCGGG": 1639361, "CGAAA": 587498, "CGAAT": 385917, "CGAAC": 343609, "CGAAG": 833524, "CGATA": 220325, "CGATT": 295770, "CGATC": 379992, "CGATG": 732980, "CGACA": 851972, "CGACT": 568020, "CGACC": 760223, "CGACG": 605156, "CGAGA": 1391803, "CGAGT": 742616, "CGAGC": 1209097, "CGAGG": 1549100, "CGTAA": 222433, "CGTAT": 342889, "CGTAC": 285294, "CGTAG": 256086, "CGTTA": 203902, "CGTTT": 385460, "CGTTC": 428781, "CGTTG": 396168, "CGTCA": 778292, "CGTCT": 692741, "CGTCC": 780537, "CGTCG": 2662266, "CGTGA": 882313, "CGTGT": 3380799, "CGTGC": 1042321, "CGTGG": 1573717, "CGCAA": 838604, "CGCAT": 580925, "CGCAC": 645086, "CGCAG": 1243869, "CGCTA": 422259, "CGCTT": 639003, "CGCTC": 894635, "CGCTG": 1598078, "CGCCA": 1508464, "CGCCT": 1318948, "CGCCC": 1359776, "CGCCG": 1690640, "CGCGA": 422214, "CGCGT": 343638, "CGCGC": 868827, "CGCGG": 1031498, "CGGAA": 3706424, "CGGAT": 535979, "CGGAC": 759525, "CGGAG": 1495904, "CGGTA": 244396, "CGGTT": 380066, "CGGTC": 560207, "CGGTG": 1300567, "CGGCA": 1298583, "CGGCT": 1350453, "CGGCC": 1890877, "CGGCG": 1315270, "CGGGA": 1401792, "CGGGT": 577395, "CGGGC": 1487191, "CGGGG": 1241749, "GAAAA": 2922287, "GAAAT": 1747560, "GAAAC": 1578228, "GAAAG": 3819049, "GAATA": 748496, "GAATT": 1211857, "GAATC": 999999, "GAATG": 1539420, "GAACA": 1820483, "GAACT": 1404860, "GAACC": 1435485, "GAACG": 743826, "GAAGA": 7332962, "GAAGT": 1852929, "GAAGC": 2901936, "GAAGG": 2880209, "GATAA": 794675, "GATAT": 771122, "GATAC": 563498, "GATAG": 482125, "GATTA": 632063, "GATTT": 1099417, "GATTC": 1015763, "GATTG": 1041120, "GATCA": 1395438, "GATCT": 1616745, "GATCC": 1445250, "GATCG": 3560610, "GATGA": 2849911, "GATGT": 1482758, "GATGC": 1766316, "GATGG": 2135432, "GACAA": 1753609, "GACAT": 1420665, "GACAC": 1248281, "GACAG": 2156990, "GACTA": 653632, "GACTT": 1327717, "GACTC": 1190953, "GACTG": 1555079, "GACCA": 1946876, "GACCT": 1829329, "GACCC": 1692257, "GACCG": 898892, "GACGA": 902833, "GACGT": 595318, "GACGC": 812436, "GACGG": 899930, "GAGAA": 3113144, "GAGAT": 3155475, "GAGAC": 1655163, "GAGAG": 2349521, "GAGTA": 744003, "GAGTT": 1180444, "GAGTC": 1173078, "GAGTG": 2733527, "GAGCA": 2380306, "GAGCT": 2592362, "GAGCC": 2369100, "GAGCG": 3724756, "GAGGA": 3854683, "GAGGT": 1543562, "GAGGC": 2517565, "GAGGG": 1624965, "GTAAA": 745939, "GTAAT": 412272, "GTAAC": 396210, "GTAAG": 493157, "GTATA": 360520, "GTATT": 622955, "GTATC": 688224, "GTATG": 802334, "GTACA": 917101, "GTACT": 706887, "GTACC": 908392, "GTACG": 422014, "GTAGA": 1217681, "GTAGT": 375093, "GTAGC": 514887, "GTAGG": 3183507, "GTTAA": 524849, "GTTAT": 547960, "GTTAC": 566751, "GTTAG": 334749, "GTTTA": 587553, "GTTTT": 1048855, "GTTTC": 994907, "GTTTG": 1335758, "GTTCA": 1197198, "GTTCT": 1193243, "GTTCC": 1322637, "GTTCG": 564287, "GTTGA": 974258, "GTTGT": 773044, "GTTGC": 922013, "GTTGG": 1159773, "GTCAA": 1984381, "GTCAT": 1146210, "GTCAC": 1127042, "GTCAG": 1367123, "GTCTA": 507756, "GTCTT": 1047415, "GTCTC": 1141856, "GTCTG": 1464117, "GTCCA": 1488786, "GTCCT": 1478411, "GTCCC": 1360411, "GTCCG": 660963, "GTCGA": 445016, "GTCGT": 2592709, "GTCGC": 755256, "GTCGG": 686255, "GTGAA": 1972027, "GTGAT": 1256064, "GTGAC": 1432228, "GTGAG": 1389018, "GTGTA": 4247320, "GTGTT": 1130373, "GTGTC": 1339481, "GTGTG": 1720030, "GTGCA": 1506916, "GTGCT": 1923505, "GTGCC": 1811550, "GTGCG": 809761, "GTGGA": 2898819, "GTGGT": 2087752, "GTGGC": 2440818, "GTGGG": 1838852, "GCAAA": 1737337, "GCAAT": 818288, "GCAAC": 1254807, "GCAAG": 2226277, "GCATA": 412675, "GCATT": 1007154, "GCATC": 1609488, "GCATG": 1306390, "GCACA": 1445190, "GCACT": 1158090, "GCACC": 1867981, "GCACG": 724696, "GCAGA": 3305140, "GCAGT": 1741620, "GCAGC": 3969883, "GCAGG": 2649150, "GCTAA": 690852, "GCTAT": 792803, "GCTAC": 1226836, "GCTAG": 500063, "GCTTA": 524597, "GCTTT": 1359607, "GCTTC": 2017510, "GCTTG": 1079141, "GCTCA": 1859025, "GCTCT": 1769487, "GCTCC": 2326497, "GCTCG": 887351, "GCTGA": 2813584, "GCTGT": 2238698, "GCTGC": 4272348, "GCTGG": 3954910, "GCCAA": 2407402, "GCCAT": 2004939, "GCCAC": 2148889, "GCCAG": 3130340, "GCCTA": 788995, "GCCTT": 1668222, "GCCTC": 2214264, "GCCTG": 3006164, "GCCCA": 2613364, "GCCCT": 2343113, "GCCCC": 2658480, "GCCCG": 1699191, "GCCGA": 1190158, "GCCGT": 1127573, "GCCGC": 2192041, "GCCGG": 1625879, "GCGAA": 447317, "GCGAT": 371491, "GCGAC": 684133, "GCGAG": 1125009, "GCGTA": 206489, "GCGTT": 347795, "GCGTC": 2968657, "GCGTG": 929965, "GCGCA": 967569, "GCGCT": 1101798, "GCGCC": 1579847, "GCGCG": 788432, "GCGGA": 1132857, "GCGGT": 658618, "GCGGC": 2180517, "GCGGG": 1438194, "GGAAA": 4035809, "GGAAT": 1239397, "GGAAC": 1581951, "GGAAG": 5782432, "GGATA": 684257, "GGATT": 1047561, "GGATC": 1182244, "GGATG": 2167419, "GGACA": 2081201, "GGACT": 1442874, "GGACC": 1977328, "GGACG": 1072534, "GGAGA": 3824830, "GGAGT": 1493443, "GGAGC": 3212718, "GGAGG": 3482475, "GGTAA": 520539, "GGTAT": 568366, "GGTAC": 637629, "GGTAG": 511648, "GGTTA": 463035, "GGTTT": 884347, "GGTTC": 980848, "GGTTG": 871850, "GGTCA": 2145343, "GGTCT": 1001185, "GGTCC": 1234772, "GGTCG": 714459, "GGTGA": 1789638, "GGTGT": 1350647, "GGTGC": 1780132, "GGTGG": 2982330, "GGCAA": 1809603, "GGCAT": 1438932, "GGCAC": 1486951, "GGCAG": 2981378, "GGCTA": 889767, "GGCTT": 1450807, "GGCTC": 1970823, "GGCTG": 3207923, "GGCCA": 2977282, "GGCCT": 2274725, "GGCCC": 2883774, "GGCCG": 2014172, "GGCGA": 838276, "GGCGT": 697842, "GGCGC": 1369171, "GGCGG": 1830717, "GGGAA": 3445573, "GGGAT": 982850, "GGGAC": 1485407, "GGGAG": 2237909, "GGGTA": 466402, "GGGTT": 612348, "GGGTC": 976965, "GGGTG": 1367035, "GGGCA": 1953829, "GGGCT": 1842458, "GGGCC": 2441820, "GGGCG": 1166764, "GGGGA": 1703875, "GGGGT": 861197, "GGGGC": 1895561, "GGGGG": 7701153 }, "overrepresented_sequences": {} }, "read1_after_filtering": { "total_reads": 9937706, "total_bases": 1396572795, "q20_bases": 1391108252, "q30_bases": 1377664520, "total_cycles": 150, "quality_curves": { "A": [ 38.3971, 38.6095, 39.2325, 39.4365, 39.377, 39.4105, 39.4034, 39.4831, 39.459, 39.5115, 39.4982, 39.5239, 39.5717, 39.5395, 39.477, 39.5843, 39.7173, 39.6331, 39.6981, 39.7319, 39.6576, 39.7244, 39.7447, 39.7433, 39.7483, 39.6307, 39.6402, 39.6475, 39.6271, 39.6486, 39.6377, 39.6642, 39.668, 39.6205, 39.6718, 39.6303, 39.6914, 39.654, 39.6917, 39.6958, 39.6945, 39.6926, 39.698, 39.6995, 39.6991, 39.7063, 39.7041, 39.6338, 39.7104, 39.6174, 39.7118, 39.7147, 39.7116, 39.7081, 39.662, 39.7154, 39.714, 39.6994, 39.7176, 39.6774, 39.7031, 39.7199, 39.6949, 39.7003, 39.7167, 39.7149, 39.7214, 39.7149, 39.7142, 39.7198, 39.7141, 39.7147, 39.7148, 39.7152, 39.7156, 39.7188, 39.692, 39.6731, 39.6956, 39.7137, 39.7107, 39.6737, 39.6989, 39.7105, 39.6954, 39.7071, 39.7048, 39.632, 39.7109, 39.7048, 39.7084, 39.7063, 39.7056, 39.6869, 39.7046, 39.7063, 39.7044, 39.7038, 39.6818, 39.7033, 39.7044, 39.7031, 39.7045, 39.7061, 39.7022, 39.703, 39.6685, 39.6995, 39.7041, 39.7036, 39.6777, 39.7045, 39.6484, 39.6977, 39.6981, 39.6979, 39.6611, 39.7077, 39.7041, 39.6996, 39.7072, 39.7038, 39.7071, 39.7056, 39.6808, 39.6715, 39.6953, 39.665, 39.7012, 39.7061, 39.6509, 39.7046, 39.7085, 39.7098, 39.7101, 39.6934, 39.7164, 39.716, 39.6705, 39.7204, 39.6523, 39.6693, 39.7046, 39.6641, 39.6796, 39.7186, 39.6978, 39.7152, 39.6597, 39.6784 ], "T": [ 39.284, 39.5177, 39.6165, 39.6909, 39.6897, 39.6942, 39.6815, 39.7186, 39.728, 39.748, 39.7659, 39.7772, 39.7843, 39.7876, 39.7893, 39.8602, 39.8636, 39.8674, 39.8719, 39.8721, 39.8727, 39.8775, 39.8783, 39.8812, 39.8821, 39.7813, 39.7826, 39.7885, 39.7934, 39.7979, 39.8015, 39.8067, 39.8088, 39.8128, 39.8156, 39.8204, 39.824, 39.8275, 39.8264, 39.8302, 39.8317, 39.8343, 39.8357, 39.8385, 39.8392, 39.8418, 39.844, 39.8422, 39.8457, 39.8482, 39.8487, 39.8494, 39.8487, 39.8505, 39.8503, 39.852, 39.8532, 39.8523, 39.8551, 39.854, 39.8562, 39.8549, 39.8551, 39.8565, 39.8566, 39.8572, 39.8565, 39.8579, 39.856, 39.8586, 39.8561, 39.8558, 39.8576, 39.8568, 39.8579, 39.8587, 39.8577, 39.8573, 39.8595, 39.8585, 39.8565, 39.8588, 39.8565, 39.8583, 39.8558, 39.8577, 39.8577, 39.8584, 39.8584, 39.8579, 39.8561, 39.856, 39.8581, 39.8565, 39.8561, 39.857, 39.8579, 39.8561, 39.8565, 39.8561, 39.8548, 39.8543, 39.8546, 39.858, 39.8529, 39.8558, 39.8573, 39.8533, 39.8528, 39.8524, 39.8533, 39.8508, 39.853, 39.853, 39.8507, 39.8514, 39.8481, 39.8478, 39.8467, 39.8473, 39.8459, 39.8414, 39.8365, 39.8383, 39.834, 39.8237, 39.8161, 39.8117, 39.7992, 39.7862, 39.7817, 39.7695, 39.7619, 39.762, 39.7524, 39.7462, 39.7438, 39.7411, 39.7377, 39.739, 39.7439, 39.7316, 39.7325, 39.7247, 39.7216, 39.7205, 39.7108, 39.707, 39.7036, 39.6985 ], "C": [ 38.6081, 39.4573, 39.5391, 39.636, 39.6384, 39.621, 39.5957, 39.6132, 39.6111, 39.6474, 39.6615, 39.6523, 39.6605, 39.6481, 39.6483, 39.7997, 39.802, 39.8016, 39.8039, 39.8007, 39.7991, 39.8062, 39.805, 39.8033, 39.8084, 39.699, 39.7024, 39.706, 39.7044, 39.7049, 39.7109, 39.7176, 39.7207, 39.7269, 39.7298, 39.7401, 39.7361, 39.7342, 39.7375, 39.7364, 39.7352, 39.7357, 39.7355, 39.7367, 39.7374, 39.7457, 39.7406, 39.7383, 39.7427, 39.7418, 39.746, 39.7484, 39.7429, 39.7433, 39.7481, 39.7426, 39.7425, 39.7485, 39.7401, 39.7384, 39.7406, 39.7376, 39.7336, 39.7351, 39.7315, 39.7372, 39.7392, 39.7338, 39.7367, 39.7397, 39.7339, 39.7323, 39.7332, 39.7323, 39.7318, 39.7338, 39.7243, 39.7297, 39.7264, 39.7246, 39.7271, 39.729, 39.7306, 39.7229, 39.7266, 39.7216, 39.7191, 39.7258, 39.7188, 39.7209, 39.7225, 39.7193, 39.7179, 39.7145, 39.7148, 39.7141, 39.7196, 39.7081, 39.7108, 39.7122, 39.7082, 39.7106, 39.71, 39.7083, 39.7064, 39.708, 39.7015, 39.704, 39.7054, 39.7015, 39.7061, 39.7086, 39.7033, 39.703, 39.6996, 39.7008, 39.7011, 39.7019, 39.7003, 39.7032, 39.7051, 39.6962, 39.7011, 39.7029, 39.7042, 39.708, 39.7108, 39.7079, 39.7116, 39.7152, 39.7107, 39.7066, 39.7039, 39.7002, 39.699, 39.7002, 39.6959, 39.6956, 39.691, 39.685, 39.6798, 39.6812, 39.6748, 39.6796, 39.6765, 39.6719, 39.6634, 39.6666, 39.6576, 39.657 ], "G": [ 39.2983, 39.4034, 39.3801, 39.5829, 39.5991, 39.6005, 39.619, 39.6346, 39.6478, 39.6441, 39.6698, 39.689, 39.6975, 39.6965, 39.6936, 39.7708, 39.7783, 39.7803, 39.7874, 39.7912, 39.789, 39.7964, 39.8003, 39.8027, 39.8041, 39.6968, 39.7022, 39.7025, 39.7089, 39.7071, 39.7155, 39.7195, 39.7232, 39.7268, 39.7324, 39.7371, 39.7379, 39.7406, 39.7431, 39.7458, 39.7508, 39.7482, 39.7539, 39.7531, 39.7565, 39.7582, 39.7618, 39.7581, 39.7612, 39.7614, 39.7671, 39.7688, 39.7706, 39.7693, 39.7698, 39.7736, 39.7734, 39.7745, 39.7752, 39.7742, 39.7768, 39.7784, 39.7775, 39.7779, 39.7814, 39.7799, 39.7804, 39.7804, 39.7782, 39.7789, 39.7805, 39.7799, 39.7807, 39.7835, 39.7807, 39.7818, 39.7789, 39.7808, 39.7798, 39.7798, 39.7792, 39.781, 39.7811, 39.7793, 39.7827, 39.784, 39.783, 39.7834, 39.7814, 39.7816, 39.7843, 39.7836, 39.7814, 39.7825, 39.7844, 39.7842, 39.7826, 39.7822, 39.781, 39.7824, 39.7833, 39.7832, 39.7837, 39.783, 39.7809, 39.7836, 39.7801, 39.7782, 39.7807, 39.7815, 39.7818, 39.7793, 39.7775, 39.777, 39.777, 39.7747, 39.7726, 39.7689, 39.7686, 39.7701, 39.7692, 39.7703, 39.7655, 39.7632, 39.7561, 39.7574, 39.755, 39.7544, 39.7609, 39.758, 39.7587, 39.7581, 39.7573, 39.7608, 39.76, 39.7592, 39.7624, 39.7603, 39.754, 39.763, 39.7676, 39.7604, 39.7597, 39.7657, 39.7604, 39.7586, 39.7615, 39.7569, 39.7539, 39.7525 ], "mean": [ 38.9431, 39.3967, 39.4763, 39.5977, 39.5814, 39.5851, 39.5933, 39.6325, 39.6355, 39.6376, 39.6506, 39.6697, 39.6845, 39.6741, 39.6593, 39.7607, 39.7931, 39.7757, 39.7926, 39.8012, 39.7844, 39.804, 39.8101, 39.8106, 39.8129, 39.7045, 39.7094, 39.7131, 39.7114, 39.7172, 39.7185, 39.729, 39.7325, 39.7249, 39.7395, 39.7359, 39.7486, 39.7418, 39.7516, 39.7533, 39.7549, 39.755, 39.7572, 39.7588, 39.76, 39.7641, 39.7643, 39.7474, 39.7658, 39.7466, 39.7701, 39.7712, 39.77, 39.7694, 39.7603, 39.7723, 39.7723, 39.7703, 39.7732, 39.7637, 39.7705, 39.7738, 39.7673, 39.7686, 39.7727, 39.7737, 39.7748, 39.773, 39.7725, 39.7748, 39.7723, 39.7719, 39.7721, 39.7732, 39.7725, 39.7735, 39.7647, 39.7625, 39.7664, 39.7701, 39.7696, 39.7626, 39.7684, 39.7687, 39.7661, 39.7687, 39.7674, 39.753, 39.7682, 39.7675, 39.7683, 39.7675, 39.767, 39.7611, 39.766, 39.7664, 39.7666, 39.7634, 39.7593, 39.7639, 39.7636, 39.7638, 39.7636, 39.7648, 39.7615, 39.7629, 39.7536, 39.7596, 39.761, 39.7605, 39.7566, 39.7609, 39.7477, 39.7584, 39.7564, 39.7569, 39.7479, 39.7564, 39.7556, 39.756, 39.7568, 39.7536, 39.7531, 39.7525, 39.745, 39.7419, 39.7448, 39.7366, 39.7442, 39.7418, 39.7278, 39.7354, 39.7332, 39.7337, 39.7306, 39.7255, 39.7297, 39.7282, 39.7145, 39.7267, 39.7127, 39.7118, 39.7179, 39.7098, 39.7103, 39.7169, 39.7082, 39.7109, 39.6947, 39.697 ] }, "content_curves": { "A": [ 0.0741105, 0.0784648, 0.124048, 0.169673, 0.225667, 0.244342, 0.220943, 0.181783, 0.169973, 0.27784, 0.225933, 0.199619, 0.217935, 0.227073, 0.223868, 0.220035, 0.223351, 0.222072, 0.225284, 0.227102, 0.221109, 0.218275, 0.219204, 0.216629, 0.218094, 0.222922, 0.217877, 0.217054, 0.221223, 0.215384, 0.21875, 0.221168, 0.216871, 0.218189, 0.22115, 0.217103, 0.216447, 0.220537, 0.216511, 0.215883, 0.219576, 0.215204, 0.214992, 0.219522, 0.214069, 0.215838, 0.219328, 0.215244, 0.216405, 0.220078, 0.213477, 0.215901, 0.219615, 0.21472, 0.214599, 0.218676, 0.213748, 0.214292, 0.218748, 0.215189, 0.214545, 0.217965, 0.213895, 0.214106, 0.218622, 0.213327, 0.215111, 0.218382, 0.21479, 0.215193, 0.218512, 0.214087, 0.214665, 0.217753, 0.213215, 0.21537, 0.218986, 0.215291, 0.214928, 0.218187, 0.213346, 0.214523, 0.218969, 0.214272, 0.214687, 0.219397, 0.213667, 0.215204, 0.220728, 0.215052, 0.215898, 0.218922, 0.214383, 0.214416, 0.219106, 0.214468, 0.214594, 0.219793, 0.215061, 0.215178, 0.218584, 0.214969, 0.21703, 0.219724, 0.215408, 0.215554, 0.219772, 0.214689, 0.216171, 0.221401, 0.214811, 0.217762, 0.220919, 0.215883, 0.21691, 0.22068, 0.215599, 0.216755, 0.220895, 0.21569, 0.216134, 0.220733, 0.216582, 0.216684, 0.221104, 0.215678, 0.21631, 0.220195, 0.215284, 0.21737, 0.22117, 0.216435, 0.216846, 0.219358, 0.216617, 0.21765, 0.221817, 0.218015, 0.218682, 0.221988, 0.217208, 0.21843, 0.222405, 0.217697, 0.218324, 0.221125, 0.217815, 0.217952, 0.222347, 0.217121 ], "T": [ 0.0894096, 0.36196, 0.254636, 0.224783, 0.266602, 0.281241, 0.412967, 0.363892, 0.362629, 0.285407, 0.225934, 0.266833, 0.272638, 0.277017, 0.27034, 0.263088, 0.261575, 0.258117, 0.249052, 0.259828, 0.259734, 0.255253, 0.266738, 0.26241, 0.25322, 0.259118, 0.257615, 0.250509, 0.257649, 0.256099, 0.247183, 0.255345, 0.256059, 0.246613, 0.254284, 0.253979, 0.246793, 0.253365, 0.253769, 0.247557, 0.254933, 0.256233, 0.248182, 0.255017, 0.254246, 0.245511, 0.253066, 0.254641, 0.245105, 0.254028, 0.252259, 0.244013, 0.252475, 0.251349, 0.243485, 0.251178, 0.252023, 0.244725, 0.250338, 0.252278, 0.244662, 0.250923, 0.25166, 0.243935, 0.250382, 0.250699, 0.242061, 0.25034, 0.250455, 0.243856, 0.250101, 0.251146, 0.243209, 0.250886, 0.248623, 0.241816, 0.248908, 0.248699, 0.24362, 0.249216, 0.249774, 0.243195, 0.249865, 0.24948, 0.241642, 0.249266, 0.250612, 0.242438, 0.2493, 0.250313, 0.243453, 0.24989, 0.250246, 0.241876, 0.248428, 0.24905, 0.2425, 0.24846, 0.249948, 0.242256, 0.24878, 0.249666, 0.242893, 0.248794, 0.249362, 0.242602, 0.248684, 0.249299, 0.243124, 0.249648, 0.249667, 0.242165, 0.247283, 0.248468, 0.241826, 0.247724, 0.249463, 0.242848, 0.248872, 0.250048, 0.242701, 0.249772, 0.249857, 0.243184, 0.248981, 0.24992, 0.243042, 0.249621, 0.24971, 0.242666, 0.249296, 0.250835, 0.243748, 0.250258, 0.251355, 0.243839, 0.248655, 0.249949, 0.242775, 0.249723, 0.250285, 0.243417, 0.249466, 0.24984, 0.243851, 0.25065, 0.251024, 0.243666, 0.248981, 0.251697 ], "C": [ 0.416083, 0.264088, 0.341451, 0.289971, 0.21012, 0.2269, 0.167864, 0.240852, 0.253946, 0.202415, 0.26522, 0.269083, 0.251168, 0.247837, 0.258439, 0.257453, 0.257011, 0.262436, 0.257798, 0.25554, 0.264463, 0.269233, 0.26168, 0.266808, 0.268892, 0.261665, 0.269114, 0.271323, 0.263805, 0.270636, 0.272008, 0.264536, 0.270604, 0.272488, 0.264319, 0.269853, 0.271149, 0.264414, 0.271263, 0.271209, 0.26483, 0.26976, 0.272191, 0.265395, 0.272139, 0.274161, 0.266438, 0.271464, 0.274518, 0.264951, 0.273897, 0.275291, 0.265626, 0.274145, 0.275161, 0.267425, 0.274262, 0.274799, 0.268784, 0.273286, 0.27399, 0.269449, 0.273177, 0.276403, 0.267848, 0.274671, 0.276212, 0.268556, 0.274776, 0.27534, 0.269665, 0.27565, 0.276314, 0.269232, 0.276805, 0.27807, 0.269905, 0.275956, 0.276572, 0.268849, 0.274975, 0.275021, 0.269065, 0.275636, 0.277005, 0.268824, 0.274581, 0.276803, 0.269428, 0.274593, 0.275616, 0.268642, 0.273559, 0.276109, 0.268584, 0.274641, 0.276914, 0.269651, 0.273966, 0.276179, 0.269164, 0.274378, 0.274095, 0.267688, 0.27372, 0.275571, 0.268692, 0.274922, 0.27543, 0.267792, 0.273727, 0.274902, 0.269515, 0.275131, 0.275996, 0.268669, 0.273366, 0.274708, 0.267072, 0.271412, 0.274517, 0.26696, 0.272309, 0.273268, 0.267606, 0.273533, 0.274807, 0.26741, 0.273104, 0.274252, 0.267214, 0.271893, 0.274014, 0.267881, 0.2729, 0.273704, 0.267803, 0.273071, 0.274723, 0.267683, 0.272181, 0.27435, 0.267436, 0.273106, 0.27435, 0.268221, 0.272573, 0.273916, 0.266911, 0.270764 ], "G": [ 0.420397, 0.295488, 0.279865, 0.315573, 0.297611, 0.247518, 0.198226, 0.213473, 0.213452, 0.234338, 0.282913, 0.264465, 0.258259, 0.248073, 0.247353, 0.259424, 0.258063, 0.257376, 0.267865, 0.25753, 0.254695, 0.257239, 0.252378, 0.254153, 0.259795, 0.256295, 0.255394, 0.261114, 0.257323, 0.25788, 0.262059, 0.258951, 0.256466, 0.26271, 0.260247, 0.259065, 0.265611, 0.261684, 0.258458, 0.26535, 0.260661, 0.258802, 0.264635, 0.260065, 0.259546, 0.264489, 0.261168, 0.25865, 0.263972, 0.260943, 0.260368, 0.264796, 0.262284, 0.259786, 0.266755, 0.26272, 0.259966, 0.266184, 0.26213, 0.259247, 0.266803, 0.261663, 0.261268, 0.265556, 0.263148, 0.261303, 0.266616, 0.262723, 0.259979, 0.265611, 0.261722, 0.259117, 0.265813, 0.262129, 0.261357, 0.264744, 0.262201, 0.260054, 0.264881, 0.263747, 0.261905, 0.267261, 0.262101, 0.260612, 0.266667, 0.262514, 0.261139, 0.265555, 0.260545, 0.260042, 0.265033, 0.262546, 0.261812, 0.267598, 0.263882, 0.261841, 0.265992, 0.262095, 0.261025, 0.266387, 0.263472, 0.260986, 0.265982, 0.263794, 0.26151, 0.266274, 0.262853, 0.26109, 0.265275, 0.261159, 0.261795, 0.26517, 0.262282, 0.260519, 0.265269, 0.262927, 0.261572, 0.265689, 0.263161, 0.262851, 0.266649, 0.262535, 0.261252, 0.266864, 0.262309, 0.260869, 0.265842, 0.262773, 0.261902, 0.265712, 0.26232, 0.260838, 0.265393, 0.262504, 0.259128, 0.264808, 0.261725, 0.258965, 0.263819, 0.260606, 0.260326, 0.263802, 0.260693, 0.259357, 0.263474, 0.260004, 0.258588, 0.264467, 0.261761, 0.260418 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.83648, 0.559576, 0.621317, 0.605544, 0.507731, 0.474418, 0.36609, 0.454325, 0.467398, 0.436753, 0.548133, 0.533548, 0.509427, 0.49591, 0.505792, 0.516877, 0.515074, 0.519811, 0.525663, 0.51307, 0.519158, 0.526472, 0.514058, 0.520961, 0.528687, 0.517959, 0.524508, 0.532437, 0.521128, 0.528516, 0.534067, 0.523487, 0.52707, 0.535198, 0.524565, 0.528918, 0.536761, 0.526098, 0.529721, 0.536559, 0.525491, 0.528563, 0.536825, 0.52546, 0.531685, 0.538651, 0.527606, 0.530114, 0.53849, 0.525894, 0.534264, 0.540086, 0.527909, 0.533931, 0.541916, 0.530145, 0.534228, 0.540984, 0.530914, 0.532533, 0.540793, 0.531112, 0.534445, 0.541959, 0.530996, 0.535974, 0.542828, 0.531279, 0.534755, 0.540951, 0.531387, 0.534767, 0.542127, 0.531361, 0.538162, 0.542815, 0.532106, 0.53601, 0.541452, 0.532596, 0.536879, 0.542283, 0.531166, 0.536248, 0.543672, 0.531337, 0.535721, 0.542358, 0.529973, 0.534635, 0.540649, 0.531188, 0.535371, 0.543708, 0.532466, 0.536482, 0.542906, 0.531747, 0.534991, 0.542566, 0.532636, 0.535364, 0.540077, 0.531482, 0.535229, 0.541845, 0.531544, 0.536012, 0.540705, 0.528951, 0.535522, 0.540073, 0.531797, 0.535649, 0.541265, 0.531596, 0.534939, 0.540397, 0.530233, 0.534262, 0.541165, 0.529495, 0.533561, 0.540132, 0.529915, 0.534402, 0.540648, 0.530184, 0.535006, 0.539964, 0.529534, 0.532731, 0.539406, 0.530384, 0.532028, 0.538511, 0.529528, 0.532036, 0.538543, 0.52829, 0.532507, 0.538152, 0.528129, 0.532463, 0.537825, 0.528225, 0.531161, 0.538382, 0.528672, 0.531182 ] }, "kmer_count": { "AAAAA": 1579309, "AAAAT": 1321537, "AAAAC": 1055410, "AAAAG": 1330997, "AAATA": 954080, "AAATT": 1175714, "AAATC": 1120440, "AAATG": 1154878, "AAACA": 1358908, "AAACT": 1303063, "AAACC": 872939, "AAACG": 367371, "AAAGA": 1378690, "AAAGT": 1252545, "AAAGC": 1353030, "AAAGG": 1373547, "AATAA": 882971, "AATAT": 823514, "AATAC": 633031, "AATAG": 646987, "AATTA": 511646, "AATTT": 1450192, "AATTC": 1248676, "AATTG": 700260, "AATCA": 1084536, "AATCT": 1394733, "AATCC": 1040407, "AATCG": 292483, "AATGA": 1188734, "AATGT": 1132930, "AATGC": 1019336, "AATGG": 1228597, "AACAA": 1015451, "AACAT": 1191552, "AACAC": 1116123, "AACAG": 1414539, "AACTA": 375590, "AACTT": 1468012, "AACTC": 1167957, "AACTG": 1528714, "AACCA": 1179077, "AACCT": 977499, "AACCC": 595691, "AACCG": 349985, "AACGA": 294994, "AACGT": 341454, "AACGC": 326725, "AACGG": 365256, "AAGAA": 1588804, "AAGAT": 1238429, "AAGAC": 1020400, "AAGAG": 1485294, "AAGTA": 814266, "AAGTT": 1268265, "AAGTC": 1314320, "AAGTG": 1041202, "AAGCA": 1409322, "AAGCT": 1451891, "AAGCC": 1395647, "AAGCG": 608302, "AAGGA": 1417153, "AAGGT": 1282713, "AAGGC": 1632089, "AAGGG": 1270248, "ATAAA": 937316, "ATAAT": 791988, "ATAAC": 562635, "ATAAG": 636903, "ATATA": 519931, "ATATT": 917226, "ATATC": 784251, "ATATG": 550064, "ATACA": 776812, "ATACT": 834339, "ATACC": 568841, "ATACG": 216400, "ATAGA": 721950, "ATAGT": 718606, "ATAGC": 787241, "ATAGG": 679465, "ATTAA": 635949, "ATTAT": 588208, "ATTAC": 435772, "ATTAG": 458997, "ATTTA": 738530, "ATTTT": 2015217, "ATTTC": 1804666, "ATTTG": 1249497, "ATTCA": 1301881, "ATTCT": 1678555, "ATTCC": 1234142, "ATTCG": 387125, "ATTGA": 824076, "ATTGT": 908091, "ATTGC": 810141, "ATTGG": 937998, "ATCAA": 1243732, "ATCAT": 1678533, "ATCAC": 1251677, "ATCAG": 1547515, "ATCTA": 493748, "ATCTT": 2444146, "ATCTC": 1872261, "ATCTG": 2119208, "ATCCA": 1889131, "ATCCT": 1629246, "ATCCC": 964192, "ATCCG": 509707, "ATCGA": 363866, "ATCGT": 406346, "ATCGC": 352279, "ATCGG": 383679, "ATGAA": 1298769, "ATGAT": 1369121, "ATGAC": 1116743, "ATGAG": 1377805, "ATGTA": 826480, "ATGTT": 1411090, "ATGTC": 1408785, "ATGTG": 1031376, "ATGCA": 1033906, "ATGCT": 1304036, "ATGCC": 1409849, "ATGCG": 563170, "ATGGA": 1303258, "ATGGT": 1540200, "ATGGC": 1919727, "ATGGG": 1243299, "ACAAA": 1329912, "ACAAT": 963658, "ACAAC": 752383, "ACAAG": 960914, "ACATA": 765444, "ACATT": 1247306, "ACATC": 1479667, "ACATG": 1180616, "ACACA": 1483762, "ACACT": 1104448, "ACACC": 1301528, "ACACG": 707503, "ACAGA": 1466618, "ACAGT": 1272374, "ACAGC": 2195625, "ACAGG": 1903410, "ACTAA": 386159, "ACTAT": 398697, "ACTAC": 379773, "ACTAG": 375198, "ACTTA": 479833, "ACTTT": 1521900, "ACTTC": 1841822, "ACTTG": 1665901, "ACTCA": 1065463, "ACTCT": 1277710, "ACTCC": 1471032, "ACTCG": 704835, "ACTGA": 1329434, "ACTGT": 1435521, "ACTGC": 1730237, "ACTGG": 1850388, "ACCAA": 1108463, "ACCAT": 1218220, "ACCAC": 1784073, "ACCAG": 2099887, "ACCTA": 276204, "ACCTT": 1501287, "ACCTC": 1518739, "ACCTG": 1607846, "ACCCA": 1093515, "ACCCT": 865143, "ACCCC": 819413, "ACCCG": 527005, "ACCGA": 403158, "ACCGT": 432994, "ACCGC": 609551, "ACCGG": 500647, "ACGAA": 533451, "ACGAT": 561020, "ACGAC": 392481, "ACGAG": 511625, "ACGTA": 355331, "ACGTT": 539624, "ACGTC": 584326, "ACGTG": 555343, "ACGCA": 488363, "ACGCT": 602146, "ACGCC": 649883, "ACGCG": 308624, "ACGGA": 543654, "ACGGT": 572110, "ACGGC": 937243, "ACGGG": 657062, "AGAAA": 1555500, "AGAAT": 1107784, "AGAAC": 1167368, "AGAAG": 2134774, "AGATA": 699824, "AGATT": 979882, "AGATC": 1139934, "AGATG": 1745023, "AGACA": 1339847, "AGACT": 1041113, "AGACC": 963794, "AGACG": 670030, "AGAGA": 1491702, "AGAGT": 1040153, "AGAGC": 1704323, "AGAGG": 1863014, "AGTAA": 747542, "AGTAT": 559016, "AGTAC": 694219, "AGTAG": 999407, "AGTTA": 494496, "AGTTT": 1523742, "AGTTC": 1414694, "AGTTG": 1304993, "AGTCA": 1375594, "AGTCT": 1354681, "AGTCC": 1412096, "AGTCG": 540562, "AGTGA": 1143526, "AGTGT": 969460, "AGTGC": 1147437, "AGTGG": 1467891, "AGCAA": 1510973, "AGCAT": 1555677, "AGCAC": 1879285, "AGCAG": 3495083, "AGCTA": 489838, "AGCTT": 2196753, "AGCTC": 2536622, "AGCTG": 3233331, "AGCCA": 2336421, "AGCCT": 1838332, "AGCCC": 1782959, "AGCCG": 1245952, "AGCGA": 613784, "AGCGT": 591421, "AGCGC": 1025038, "AGCGG": 1080883, "AGGAA": 2030073, "AGGAT": 1579232, "AGGAC": 1440469, "AGGAG": 2372123, "AGGTA": 1101536, "AGGTT": 1370245, "AGGTC": 1806608, "AGGTG": 2020911, "AGGCA": 1997072, "AGGCT": 2018962, "AGGCC": 2187695, "AGGCG": 1225971, "AGGGA": 1557208, "AGGGT": 1492870, "AGGGC": 2295506, "AGGGG": 1780439, "TAAAA": 969816, "TAAAT": 760114, "TAAAC": 605459, "TAAAG": 811735, "TAATA": 551813, "TAATT": 738508, "TAATC": 653782, "TAATG": 700553, "TAACA": 714694, "TAACT": 649889, "TAACC": 463348, "TAACG": 201817, "TAAGA": 652469, "TAAGT": 576954, "TAAGC": 535000, "TAAGG": 637345, "TATAA": 503048, "TATAT": 463774, "TATAC": 377136, "TATAG": 448592, "TATTA": 451100, "TATTT": 1206593, "TATTC": 780589, "TATTG": 637174, "TATCA": 802458, "TATCT": 947807, "TATCC": 672981, "TATCG": 206056, "TATGA": 509431, "TATGT": 508342, "TATGC": 422867, "TATGG": 516207, "TACAA": 674048, "TACAT": 729640, "TACAC": 626453, "TACAG": 1002213, "TACTA": 310665, "TACTT": 1127359, "TACTC": 754563, "TACTG": 1015092, "TACCA": 851102, "TACCT": 669855, "TACCC": 458131, "TACCG": 219011, "TACGA": 222316, "TACGT": 211950, "TACGC": 192994, "TACGG": 290960, "TAGAA": 891849, "TAGAT": 704646, "TAGAC": 507761, "TAGAG": 798491, "TAGTA": 514974, "TAGTT": 758108, "TAGTC": 663280, "TAGTG": 608985, "TAGCA": 951906, "TAGCT": 942320, "TAGCC": 882615, "TAGCG": 394489, "TAGGA": 813247, "TAGGT": 697330, "TAGGC": 778681, "TAGGG": 703066, "TTAAA": 942786, "TTAAT": 785239, "TTAAC": 554653, "TTAAG": 646484, "TTATA": 578733, "TTATT": 959812, "TTATC": 814736, "TTATG": 480141, "TTACA": 689628, "TTACT": 695750, "TTACC": 530269, "TTACG": 216835, "TTAGA": 584731, "TTAGT": 505543, "TTAGC": 710501, "TTAGG": 645430, "TTTAA": 1082648, "TTTAT": 1100090, "TTTAC": 789901, "TTTAG": 886536, "TTTTA": 1245102, "TTTTT": 2945516, "TTTTC": 3026178, "TTTTG": 1983382, "TTTCA": 2316992, "TTTCT": 3467740, "TTTCC": 2460915, "TTTCG": 571655, "TTTGA": 1466597, "TTTGT": 1721757, "TTTGC": 1763761, "TTTGG": 1920473, "TTCAA": 1765618, "TTCAT": 2499768, "TTCAC": 1968329, "TTCAG": 2680517, "TTCTA": 891325, "TTCTT": 4596798, "TTCTC": 3157943, "TTCTG": 3269812, "TTCCA": 2792392, "TTCCT": 2811833, "TTCCC": 1733320, "TTCCG": 932354, "TTCGA": 503276, "TTCGT": 494797, "TTCGC": 427445, "TTCGG": 661921, "TTGAA": 1545582, "TTGAT": 1678604, "TTGAC": 1094882, "TTGAG": 1536039, "TTGTA": 1234214, "TTGTT": 1906821, "TTGTC": 1755443, "TTGTG": 1278957, "TTGCA": 1401138, "TTGCT": 2018609, "TTGCC": 1765883, "TTGCG": 783273, "TTGGA": 1615935, "TTGGT": 1852645, "TTGGC": 2380225, "TTGGG": 1734433, "TCAAA": 1866387, "TCAAT": 1435499, "TCAAC": 968745, "TCAAG": 1114913, "TCATA": 1254656, "TCATT": 1739310, "TCATC": 2867943, "TCATG": 1714029, "TCACA": 1725213, "TCACT": 1650000, "TCACC": 1744648, "TCACG": 850938, "TCAGA": 1658988, "TCAGT": 1492313, "TCAGC": 2778526, "TCAGG": 2593111, "TCTAA": 640987, "TCTAT": 607272, "TCTAC": 663614, "TCTAG": 633179, "TCTTA": 884339, "TCTTT": 3005652, "TCTTC": 4697710, "TCTTG": 3093383, "TCTCA": 1891203, "TCTCT": 2479078, "TCTCC": 3265761, "TCTCG": 1163992, "TCTGA": 2057868, "TCTGT": 2213309, "TCTGC": 2932204, "TCTGG": 3009306, "TCCAA": 1834406, "TCCAT": 2267807, "TCCAC": 2863445, "TCCAG": 3997198, "TCCTA": 465555, "TCCTT": 3105110, "TCCTC": 3856433, "TCCTG": 3060983, "TCCCA": 1908197, "TCCCT": 1399929, "TCCCC": 1583162, "TCCCG": 1265235, "TCCGA": 653691, "TCCGT": 684681, "TCCGC": 1037525, "TCCGG": 1116575, "TCGAA": 672206, "TCGAT": 714519, "TCGAC": 375492, "TCGAG": 577411, "TCGTA": 484689, "TCGTT": 615901, "TCGTC": 882059, "TCGTG": 567321, "TCGCA": 506782, "TCGCT": 816690, "TCGCC": 765524, "TCGCG": 373928, "TCGGA": 684018, "TCGGT": 690213, "TCGGC": 1098219, "TCGGG": 958479, "TGAAA": 1313889, "TGAAT": 1167389, "TGAAC": 1179354, "TGAAG": 2386799, "TGATA": 859804, "TGATT": 1098602, "TGATC": 1399415, "TGATG": 2352847, "TGACA": 1469823, "TGACT": 1231635, "TGACC": 1215260, "TGACG": 756369, "TGAGA": 1389355, "TGAGT": 1128748, "TGAGC": 1857007, "TGAGG": 2223333, "TGTAA": 929329, "TGTAT": 715820, "TGTAC": 933399, "TGTAG": 1548391, "TGTTA": 634139, "TGTTT": 1791857, "TGTTC": 1824805, "TGTTG": 2085735, "TGTCA": 1772766, "TGTCT": 1852069, "TGTCC": 2003691, "TGTCG": 787762, "TGTGA": 1249570, "TGTGT": 1342939, "TGTGC": 1444956, "TGTGG": 1877713, "TGCAA": 1194183, "TGCAT": 1387371, "TGCAC": 1463131, "TGCAG": 2995597, "TGCTA": 631147, "TGCTT": 2303301, "TGCTC": 2349092, "TGCTG": 3747039, "TGCCA": 2423875, "TGCCT": 1834322, "TGCCC": 1919652, "TGCCG": 1180510, "TGCGA": 454941, "TGCGT": 517658, "TGCGC": 906540, "TGCGG": 1223445, "TGGAA": 1955048, "TGGAT": 1676373, "TGGAC": 1403190, "TGGAG": 2542985, "TGGTA": 1160758, "TGGTT": 1592846, "TGGTC": 1928608, "TGGTG": 2845328, "TGGCA": 2501506, "TGGCT": 2543831, "TGGCC": 2847179, "TGGCG": 1384422, "TGGGA": 1729524, "TGGGT": 1572072, "TGGGC": 2544837, "TGGGG": 2514901, "CAAAA": 1527544, "CAAAT": 1296858, "CAAAC": 1319227, "CAAAG": 2033118, "CAATA": 814302, "CAATT": 1031542, "CAATC": 1044175, "CAATG": 1677127, "CAACA": 1386922, "CAACT": 1138309, "CAACC": 845177, "CAACG": 364229, "CAAGA": 1195468, "CAAGT": 1058410, "CAAGC": 1056888, "CAAGG": 1409251, "CATAA": 883546, "CATAT": 874505, "CATAC": 818601, "CATAG": 1207441, "CATTA": 765368, "CATTT": 1846179, "CATTC": 1567706, "CATTG": 1517771, "CATCA": 2627291, "CATCT": 2751641, "CATCC": 2138748, "CATCG": 689173, "CATGA": 1492909, "CATGT": 1417719, "CATGC": 1298698, "CATGG": 2109368, "CACAA": 1397422, "CACAT": 1675057, "CACAC": 1699787, "CACAG": 2811488, "CACTA": 561029, "CACTT": 1673198, "CACTC": 1450973, "CACTG": 2526756, "CACCA": 2927188, "CACCT": 2194798, "CACCC": 1322293, "CACCG": 916310, "CACGA": 859635, "CACGT": 966975, "CACGC": 889588, "CACGG": 1340943, "CAGAA": 1984762, "CAGAT": 1482648, "CAGAC": 1419003, "CAGAG": 2357630, "CAGTA": 1037027, "CAGTT": 1665374, "CAGTC": 1556568, "CAGTG": 2062457, "CAGCA": 4306483, "CAGCT": 4023014, "CAGCC": 3098657, "CAGCG": 1499138, "CAGGA": 3124730, "CAGGT": 2712242, "CAGGC": 2931203, "CAGGG": 3306598, "CTAAA": 562391, "CTAAT": 399980, "CTAAC": 344001, "CTAAG": 476077, "CTATA": 339737, "CTATT": 494013, "CTATC": 471318, "CTATG": 467088, "CTACA": 598414, "CTACT": 604333, "CTACC": 489681, "CTACG": 225530, "CTAGA": 480778, "CTAGT": 359429, "CTAGC": 473693, "CTAGG": 520808, "CTTAA": 742370, "CTTAT": 700497, "CTTAC": 507929, "CTTAG": 714889, "CTTTA": 1243518, "CTTTT": 2533925, "CTTTC": 2381020, "CTTTG": 2392409, "CTTCA": 3793534, "CTTCT": 4801987, "CTTCC": 3047260, "CTTCG": 808614, "CTTGA": 2200598, "CTTGT": 2207498, "CTTGC": 2175619, "CTTGG": 3125321, "CTCAA": 1349925, "CTCAT": 1948038, "CTCAC": 1367271, "CTCAG": 2545505, "CTCTA": 743206, "CTCTT": 2675307, "CTCTC": 2145208, "CTCTG": 3011905, "CTCCA": 4048647, "CTCCT": 4066771, "CTCCC": 2040705, "CTCCG": 1357912, "CTCGA": 890717, "CTCGT": 1009051, "CTCGC": 1054337, "CTCGG": 1627609, "CTGAA": 2038557, "CTGAT": 1504299, "CTGAC": 1331354, "CTGAG": 2368842, "CTGTA": 1341693, "CTGTT": 1915030, "CTGTC": 2021939, "CTGTG": 2364690, "CTGCA": 3264506, "CTGCT": 4012592, "CTGCC": 2759126, "CTGCG": 1145262, "CTGGA": 3043698, "CTGGT": 2460440, "CTGGC": 2916440, "CTGGG": 3579794, "CCAAA": 1682822, "CCAAT": 1142492, "CCAAC": 1145515, "CCAAG": 1559716, "CCATA": 990153, "CCATT": 1514707, "CCATC": 2126764, "CCATG": 2118370, "CCACA": 2682983, "CCACT": 2014517, "CCACC": 2636594, "CCACG": 1506490, "CCAGA": 2163531, "CCAGT": 1917700, "CCAGC": 3858945, "CCAGG": 4164519, "CCTAA": 320929, "CCTAT": 323758, "CCTAC": 359324, "CCTAG": 392104, "CCTTA": 725865, "CCTTT": 1962869, "CCTTC": 2920201, "CCTTG": 2674813, "CCTCA": 2251106, "CCTCT": 2389831, "CCTCC": 3447660, "CCTCG": 1516591, "CCTGA": 1666668, "CCTGT": 1643671, "CCTGC": 2627460, "CCTGG": 3206611, "CCCAA": 1155611, "CCCAT": 1393033, "CCCAC": 1832902, "CCCAG": 2805591, "CCCTA": 302693, "CCCTT": 1436144, "CCCTC": 1644715, "CCCTG": 1965940, "CCCCA": 1910890, "CCCCT": 1250096, "CCCCC": 1161065, "CCCCG": 1170665, "CCCGA": 766915, "CCCGT": 733794, "CCCGC": 1335518, "CCCGG": 1540385, "CCGAA": 589499, "CCGAT": 500593, "CCGAC": 559508, "CCGAG": 971947, "CCGTA": 403994, "CCGTT": 560171, "CCGTC": 868844, "CCGTG": 970263, "CCGCA": 1113038, "CCGCT": 1289093, "CCGCC": 1640081, "CCGCG": 882552, "CCGGA": 985516, "CCGGT": 802468, "CCGGC": 1483389, "CCGGG": 1534303, "CGAAA": 315700, "CGAAT": 404548, "CGAAC": 532092, "CGAAG": 1008894, "CGATA": 258390, "CGATT": 332420, "CGATC": 619130, "CGATG": 1158612, "CGACA": 491778, "CGACT": 478195, "CGACC": 446834, "CGACG": 382896, "CGAGA": 545133, "CGAGT": 459252, "CGAGC": 795634, "CGAGG": 979813, "CGTAA": 257388, "CGTAT": 222231, "CGTAC": 423645, "CGTAG": 681437, "CGTTA": 138242, "CGTTT": 549386, "CGTTC": 731445, "CGTTG": 794944, "CGTCA": 705526, "CGTCT": 819583, "CGTCC": 1023140, "CGTCG": 569952, "CGTGA": 526313, "CGTGT": 573429, "CGTGC": 720092, "CGTGG": 1068597, "CGCAA": 335897, "CGCAT": 469502, "CGCAC": 767578, "CGCAG": 1444884, "CGCTA": 139828, "CGCTT": 931444, "CGCTC": 1227302, "CGCTG": 1562622, "CGCCA": 1048841, "CGCCT": 1016286, "CGCCC": 1078990, "CGCCG": 1129741, "CGCGA": 308458, "CGCGT": 358219, "CGCGC": 671105, "CGCGG": 951809, "CGGAA": 677891, "CGGAT": 775192, "CGGAC": 621896, "CGGAG": 1116839, "CGGTA": 467507, "CGGTT": 547615, "CGGTC": 877003, "CGGTG": 1124766, "CGGCA": 1031375, "CGGCT": 1227252, "CGGCC": 1865753, "CGGCG": 1358613, "CGGGA": 889911, "CGGGT": 730626, "CGGGC": 1568134, "CGGGG": 1447659, "GAAAA": 1238825, "GAAAT": 1053839, "GAAAC": 965043, "GAAAG": 1241674, "GAATA": 678934, "GAATT": 980520, "GAATC": 1015541, "GAATG": 1063383, "GAACA": 1305964, "GAACT": 1474901, "GAACC": 947677, "GAACG": 405207, "GAAGA": 2132177, "GAAGT": 1574263, "GAAGC": 1952824, "GAAGG": 2223828, "GATAA": 663820, "GATAT": 618601, "GATAC": 579189, "GATAG": 619691, "GATTA": 393033, "GATTT": 1307518, "GATTC": 1016984, "GATTG": 635108, "GATCA": 1225116, "GATCT": 1861923, "GATCC": 1163021, "GATCG": 321030, "GATGA": 1985094, "GATGT": 1637618, "GATGC": 1591012, "GATGG": 2179540, "GACAA": 938095, "GACAT": 1101005, "GACAC": 1185088, "GACAG": 1654987, "GACTA": 297208, "GACTT": 1261921, "GACTC": 1164244, "GACTG": 1300662, "GACCA": 1274048, "GACCT": 1075140, "GACCC": 943532, "GACCG": 465696, "GACGA": 629133, "GACGT": 523497, "GACGC": 649042, "GACGG": 719511, "GAGAA": 1515204, "GAGAT": 1155959, "GAGAC": 1097965, "GAGAG": 1503014, "GAGTA": 640065, "GAGTT": 1057117, "GAGTC": 1171081, "GAGTG": 1034478, "GAGCA": 1801120, "GAGCT": 2070447, "GAGCC": 1869557, "GAGCG": 817211, "GAGGA": 2080410, "GAGGT": 1628140, "GAGGC": 2124668, "GAGGG": 1859915, "GTAAA": 720130, "GTAAT": 681177, "GTAAC": 585002, "GTAAG": 663707, "GTATA": 360631, "GTATT": 714325, "GTATC": 572379, "GTATG": 468813, "GTACA": 987163, "GTACT": 1092280, "GTACC": 628300, "GTACG": 267646, "GTAGA": 1132021, "GTAGT": 977226, "GTAGC": 1223309, "GTAGG": 1173652, "GTTAA": 477817, "GTTAT": 451264, "GTTAC": 409543, "GTTAG": 398930, "GTTTA": 639406, "GTTTT": 1722986, "GTTTC": 1633085, "GTTTG": 1269740, "GTTCA": 1545980, "GTTCT": 2015699, "GTTCC": 1581686, "GTTCG": 333065, "GTTGA": 1389375, "GTTGT": 1365276, "GTTGC": 1256744, "GTTGG": 1643545, "GTCAA": 1053694, "GTCAT": 1486293, "GTCAC": 1431721, "GTCAG": 1817070, "GTCTA": 421802, "GTCTT": 1995843, "GTCTC": 1651140, "GTCTG": 1842423, "GTCCA": 2286825, "GTCCT": 2018283, "GTCCC": 1470721, "GTCCG": 718860, "GTCGA": 593694, "GTCGT": 651550, "GTCGC": 647032, "GTCGG": 777779, "GTGAA": 1182212, "GTGAT": 1178419, "GTGAC": 1168698, "GTGAG": 1361134, "GTGTA": 732627, "GTGTT": 1118474, "GTGTC": 1259206, "GTGTG": 1262828, "GTGCA": 1372116, "GTGCT": 1732889, "GTGCC": 1480030, "GTGCG": 624594, "GTGGA": 1632513, "GTGGT": 1693992, "GTGGC": 2117371, "GTGGG": 1825435, "GCAAA": 1323496, "GCAAT": 1045123, "GCAAC": 897054, "GCAAG": 1127919, "GCATA": 780244, "GCATT": 1206407, "GCATC": 1753338, "GCATG": 1328027, "GCACA": 1721334, "GCACT": 1459426, "GCACC": 1706816, "GCACG": 1006435, "GCAGA": 1980376, "GCAGT": 1657792, "GCAGC": 4156312, "GCAGG": 3458084, "GCTAA": 424629, "GCTAT": 431460, "GCTAC": 509311, "GCTAG": 424243, "GCTTA": 551654, "GCTTT": 1951383, "GCTTC": 2857553, "GCTTG": 2168265, "GCTCA": 1929662, "GCTCT": 2287322, "GCTCC": 3121993, "GCTCG": 1116844, "GCTGA": 2151263, "GCTGT": 2292411, "GCTGC": 3858269, "GCTGG": 3769531, "GCCAA": 1436769, "GCCAT": 1864834, "GCCAC": 2365913, "GCCAG": 3223961, "GCCTA": 337278, "GCCTT": 2177864, "GCCTC": 2483135, "GCCTG": 2427241, "GCCCA": 2206916, "GCCCT": 1759625, "GCCCC": 1863786, "GCCCG": 1373426, "GCCGA": 798899, "GCCGT": 942837, "GCCGC": 1949421, "GCCGG": 1622990, "GCGAA": 470150, "GCGAT": 594101, "GCGAC": 483286, "GCGAG": 732268, "GCGTA": 339272, "GCGTT": 491997, "GCGTC": 776794, "GCGTG": 791863, "GCGCA": 918549, "GCGCT": 1154518, "GCGCC": 1229384, "GCGCG": 731214, "GCGGA": 973144, "GCGGT": 937464, "GCGGC": 1956469, "GCGGG": 1422043, "GGAAA": 1334068, "GGAAT": 1078691, "GGAAC": 1292865, "GGAAG": 2430600, "GGATA": 670952, "GGATT": 950559, "GGATC": 1425632, "GGATG": 2171654, "GGACA": 1599131, "GGACT": 1292072, "GGACC": 1152767, "GGACG": 724511, "GGAGA": 1864721, "GGAGT": 1292020, "GGAGC": 2239568, "GGAGG": 2673011, "GGTAA": 706299, "GGTAT": 613738, "GGTAC": 921921, "GGTAG": 1272661, "GGTTA": 459681, "GGTTT": 1347915, "GGTTC": 1457039, "GGTTG": 1422533, "GGTCA": 1870164, "GGTCT": 1813570, "GGTCC": 1938860, "GGTCG": 720123, "GGTGA": 1931479, "GGTGT": 1457408, "GGTGC": 1865837, "GGTGG": 2765037, "GGCAA": 1365385, "GGCAT": 1660565, "GGCAC": 1792114, "GGCAG": 3344255, "GGCTA": 524621, "GGCTT": 2078520, "GGCTC": 2318007, "GGCTG": 3499406, "GGCCA": 3021102, "GGCCT": 2657686, "GGCCC": 2355171, "GGCCG": 1724953, "GGCGA": 903287, "GGCGT": 928324, "GGCGC": 1435704, "GGCGG": 2014524, "GGGAA": 1459942, "GGGAT": 1175319, "GGGAC": 1306864, "GGGAG": 2025055, "GGGTA": 758566, "GGGTT": 1136655, "GGGTC": 1688534, "GGGTG": 1968637, "GGGCA": 2541716, "GGGCT": 2545485, "GGGCC": 2785868, "GGGCG": 1254975, "GGGGA": 1694562, "GGGGT": 1679640, "GGGGC": 2622980, "GGGGG": 1879543 }, "overrepresented_sequences": {} }, "read2_after_filtering": { "total_reads": 9937706, "total_bases": 1396684695, "q20_bases": 1389391946, "q30_bases": 1372670092, "total_cycles": 150, "quality_curves": { "A": [ 37.9551, 38.9369, 39.155, 39.3717, 39.4079, 39.4697, 39.4619, 39.4485, 39.5293, 39.5792, 39.5985, 39.6189, 39.6081, 39.589, 39.5532, 39.6084, 39.6405, 39.674, 39.6596, 39.6926, 39.6581, 39.6887, 39.6849, 39.6983, 39.6894, 39.5731, 39.5754, 39.5752, 39.5515, 39.5864, 39.5349, 39.5868, 39.6291, 39.6218, 39.609, 39.5749, 39.599, 39.6285, 39.6105, 39.6348, 39.6416, 39.6385, 39.6075, 39.6341, 39.6439, 39.4752, 39.6465, 39.6556, 39.6312, 39.6558, 39.6573, 39.6542, 39.6627, 39.6616, 39.6475, 39.6615, 39.617, 39.6673, 39.6672, 39.6367, 39.6693, 39.6381, 39.6539, 39.6511, 39.6544, 39.666, 39.6695, 39.6776, 39.6732, 39.6099, 39.6384, 39.6495, 39.6732, 39.6524, 39.6511, 39.6753, 39.67, 39.6737, 39.6674, 39.6677, 39.6249, 39.5701, 39.6672, 39.6456, 39.6707, 39.6579, 39.5915, 39.6728, 39.6689, 39.6672, 39.6681, 39.655, 39.6671, 39.6492, 39.6708, 39.6486, 39.6666, 39.6638, 39.6656, 39.6438, 39.6597, 39.6607, 39.6552, 39.6634, 39.6462, 39.6614, 39.6593, 39.6576, 39.6569, 39.6581, 39.6534, 39.6369, 39.6576, 39.5966, 39.6476, 39.6424, 39.6375, 39.6516, 39.6563, 39.6484, 39.6511, 39.6365, 39.6452, 39.6271, 39.6398, 39.5734, 39.6164, 39.628, 39.6281, 39.6201, 39.5587, 39.6099, 39.6125, 39.5991, 39.5888, 39.584, 39.5862, 39.5795, 39.5437, 39.554, 39.5296, 39.5006, 39.5265, 39.5027, 39.5037, 39.4947, 39.4579, 39.4586, 39.4487, 39.4282 ], "T": [ 38.9571, 39.5106, 39.6218, 39.6965, 39.7331, 39.7362, 39.7639, 39.7617, 39.781, 39.7904, 39.7771, 39.799, 39.8116, 39.8069, 39.8075, 39.807, 39.818, 39.819, 39.8248, 39.8266, 39.8351, 39.8413, 39.8453, 39.8445, 39.8429, 39.711, 39.7131, 39.7261, 39.7263, 39.7276, 39.7299, 39.7365, 39.7371, 39.7476, 39.748, 39.7508, 39.7576, 39.7561, 39.7575, 39.765, 39.7618, 39.7684, 39.7696, 39.7727, 39.7761, 39.7778, 39.7797, 39.7828, 39.788, 39.784, 39.7867, 39.7891, 39.7895, 39.79, 39.7958, 39.7952, 39.7973, 39.7998, 39.801, 39.8015, 39.8049, 39.8023, 39.8071, 39.8072, 39.8064, 39.8093, 39.8111, 39.8102, 39.8103, 39.8117, 39.8125, 39.8119, 39.813, 39.8116, 39.8144, 39.8184, 39.8128, 39.8139, 39.818, 39.8154, 39.8142, 39.8135, 39.8161, 39.8166, 39.8192, 39.8185, 39.8185, 39.8163, 39.8179, 39.8153, 39.8206, 39.8157, 39.8169, 39.8174, 39.8177, 39.8181, 39.8203, 39.8181, 39.8162, 39.8162, 39.8158, 39.8159, 39.8172, 39.8138, 39.817, 39.8157, 39.813, 39.8163, 39.8169, 39.8144, 39.815, 39.8156, 39.8193, 39.8212, 39.8181, 39.82, 39.8184, 39.8182, 39.8207, 39.8222, 39.8233, 39.8239, 39.826, 39.8257, 39.8253, 39.8259, 39.8267, 39.8263, 39.8228, 39.8271, 39.82, 39.8196, 39.825, 39.8169, 39.8169, 39.8154, 39.8156, 39.8065, 39.8028, 39.8, 39.7941, 39.7947, 39.79, 39.7832, 39.7825, 39.7779, 39.7711, 39.7672, 39.7655, 39.7593 ], "C": [ 37.8354, 39.0424, 39.3277, 39.4942, 39.573, 39.6075, 39.6396, 39.6762, 39.6797, 39.7214, 39.7462, 39.7412, 39.7644, 39.7698, 39.774, 39.7715, 39.7722, 39.7704, 39.7885, 39.7838, 39.7909, 39.79, 39.7944, 39.7846, 39.7973, 39.6712, 39.6706, 39.6758, 39.6791, 39.6736, 39.6833, 39.6764, 39.6766, 39.6911, 39.6898, 39.6858, 39.6879, 39.6838, 39.6714, 39.6768, 39.6763, 39.6746, 39.6805, 39.6819, 39.6767, 39.6725, 39.6778, 39.6777, 39.6805, 39.681, 39.6809, 39.6858, 39.6843, 39.6821, 39.6912, 39.6819, 39.6864, 39.6872, 39.6905, 39.6845, 39.6916, 39.6909, 39.6828, 39.6883, 39.6886, 39.683, 39.6889, 39.6893, 39.6879, 39.6907, 39.6925, 39.6858, 39.692, 39.6891, 39.6825, 39.6905, 39.6942, 39.687, 39.6924, 39.6922, 39.6862, 39.6923, 39.6899, 39.6847, 39.6925, 39.6887, 39.6855, 39.69, 39.6922, 39.6888, 39.6965, 39.6935, 39.6866, 39.6986, 39.6983, 39.6906, 39.6962, 39.6929, 39.6926, 39.702, 39.6965, 39.6978, 39.7019, 39.7011, 39.7001, 39.703, 39.7039, 39.6985, 39.7016, 39.6987, 39.6922, 39.6997, 39.6976, 39.6913, 39.6956, 39.6924, 39.6848, 39.6858, 39.6841, 39.673, 39.6747, 39.6682, 39.6617, 39.6599, 39.6571, 39.6419, 39.6399, 39.6278, 39.613, 39.6075, 39.5932, 39.5754, 39.5698, 39.5504, 39.5366, 39.5253, 39.5024, 39.4774, 39.4653, 39.4343, 39.4031, 39.3895, 39.3486, 39.3226, 39.3154, 39.2828, 39.2383, 39.2145, 39.1829, 39.1199 ], "G": [ 39.4119, 39.5006, 39.4114, 39.5259, 39.5494, 39.4877, 39.5367, 39.529, 39.5641, 39.5926, 39.624, 39.6312, 39.6368, 39.6279, 39.6247, 39.6422, 39.6515, 39.6541, 39.6638, 39.671, 39.6668, 39.6812, 39.6882, 39.6833, 39.6911, 39.5046, 39.4982, 39.518, 39.5251, 39.5203, 39.5286, 39.5439, 39.5367, 39.5534, 39.552, 39.5518, 39.5656, 39.5713, 39.5606, 39.5797, 39.5804, 39.578, 39.5918, 39.5937, 39.589, 39.5908, 39.6028, 39.6026, 39.6119, 39.6166, 39.6119, 39.6227, 39.6215, 39.6181, 39.6291, 39.629, 39.6267, 39.6401, 39.6398, 39.6331, 39.6399, 39.6452, 39.64, 39.6477, 39.648, 39.6472, 39.6541, 39.6569, 39.6481, 39.6551, 39.6583, 39.6546, 39.6627, 39.6629, 39.6583, 39.6663, 39.664, 39.6615, 39.665, 39.6644, 39.6599, 39.6643, 39.6653, 39.6606, 39.6682, 39.6688, 39.6626, 39.668, 39.67, 39.6635, 39.6715, 39.6663, 39.6682, 39.6714, 39.6702, 39.6617, 39.6664, 39.6697, 39.6578, 39.6646, 39.6654, 39.6646, 39.665, 39.6659, 39.6593, 39.6643, 39.6668, 39.6601, 39.6678, 39.6674, 39.6633, 39.6654, 39.673, 39.6635, 39.671, 39.6723, 39.6658, 39.6736, 39.675, 39.6715, 39.6757, 39.6783, 39.6689, 39.6697, 39.6726, 39.6661, 39.67, 39.6666, 39.66, 39.6646, 39.6632, 39.6508, 39.6579, 39.6565, 39.6496, 39.6547, 39.6492, 39.6486, 39.6519, 39.6484, 39.6429, 39.6522, 39.6485, 39.6376, 39.6491, 39.6471, 39.6429, 39.6398, 39.6382, 39.6229 ], "mean": [ 38.5598, 39.3045, 39.3922, 39.5105, 39.5469, 39.5582, 39.6134, 39.6138, 39.6458, 39.6605, 39.6813, 39.6966, 39.7037, 39.6958, 39.6873, 39.7041, 39.7152, 39.7241, 39.7274, 39.7376, 39.7329, 39.7462, 39.749, 39.749, 39.7514, 39.6091, 39.6102, 39.6184, 39.6149, 39.6227, 39.6147, 39.6302, 39.6407, 39.6479, 39.6435, 39.6363, 39.647, 39.6537, 39.6452, 39.6583, 39.6588, 39.6602, 39.657, 39.6646, 39.6669, 39.6247, 39.6707, 39.675, 39.6723, 39.6784, 39.6796, 39.6823, 39.6834, 39.6833, 39.6854, 39.6857, 39.6772, 39.693, 39.6937, 39.6844, 39.6957, 39.6883, 39.6912, 39.6931, 39.6934, 39.6967, 39.7003, 39.7025, 39.7003, 39.6869, 39.6946, 39.6956, 39.7047, 39.6982, 39.6968, 39.7071, 39.7045, 39.7044, 39.7053, 39.7041, 39.6915, 39.6806, 39.7037, 39.697, 39.7072, 39.7028, 39.6846, 39.7064, 39.7065, 39.7041, 39.7089, 39.7019, 39.7052, 39.7041, 39.7085, 39.6999, 39.7069, 39.7054, 39.7035, 39.7018, 39.7037, 39.7053, 39.7047, 39.7055, 39.701, 39.706, 39.7053, 39.7036, 39.7057, 39.7042, 39.7015, 39.6994, 39.7063, 39.6879, 39.7031, 39.7011, 39.6969, 39.7021, 39.7032, 39.6991, 39.7009, 39.6957, 39.6954, 39.6898, 39.6925, 39.671, 39.6823, 39.6806, 39.6754, 39.6733, 39.6516, 39.6581, 39.6593, 39.6485, 39.6417, 39.6377, 39.6306, 39.6217, 39.6083, 39.6012, 39.5856, 39.5765, 39.57, 39.5543, 39.5544, 39.5417, 39.5196, 39.5106, 39.499, 39.4745 ] }, "content_curves": { "A": [ 0.120717, 0.135554, 0.212233, 0.251993, 0.293337, 0.329474, 0.202569, 0.213784, 0.207927, 0.290686, 0.226586, 0.211201, 0.225846, 0.238793, 0.247745, 0.236235, 0.24815, 0.260911, 0.250675, 0.254874, 0.257893, 0.242498, 0.246038, 0.251723, 0.240314, 0.24794, 0.251008, 0.237638, 0.244838, 0.249916, 0.238309, 0.245902, 0.251332, 0.239955, 0.246174, 0.251026, 0.239992, 0.247581, 0.251656, 0.239695, 0.24723, 0.250552, 0.239636, 0.245184, 0.249832, 0.239482, 0.24483, 0.249976, 0.238142, 0.245366, 0.249992, 0.238886, 0.245469, 0.25037, 0.238548, 0.246014, 0.249313, 0.238632, 0.245559, 0.24948, 0.238456, 0.245671, 0.249566, 0.238791, 0.245794, 0.250341, 0.238869, 0.246566, 0.250289, 0.239791, 0.246715, 0.250979, 0.240819, 0.2474, 0.251818, 0.240998, 0.247845, 0.251808, 0.240645, 0.247812, 0.252675, 0.241867, 0.249143, 0.25331, 0.242044, 0.248526, 0.253428, 0.243154, 0.250418, 0.253282, 0.243075, 0.249863, 0.254251, 0.244741, 0.251359, 0.255619, 0.244237, 0.251487, 0.255749, 0.244781, 0.251594, 0.25584, 0.245946, 0.251795, 0.256401, 0.246031, 0.253078, 0.256566, 0.24728, 0.253592, 0.256899, 0.247371, 0.253602, 0.257467, 0.246851, 0.253127, 0.257347, 0.248217, 0.255659, 0.258233, 0.247907, 0.255463, 0.258869, 0.248314, 0.255741, 0.258695, 0.248118, 0.2552, 0.260141, 0.249639, 0.256009, 0.259825, 0.249639, 0.255814, 0.259676, 0.249554, 0.256171, 0.260118, 0.250198, 0.256585, 0.259996, 0.250375, 0.257447, 0.261241, 0.251301, 0.25758, 0.261995, 0.250268, 0.258804, 0.262025 ], "T": [ 0.110311, 0.275123, 0.275579, 0.18692, 0.183154, 0.190522, 0.293059, 0.24952, 0.255914, 0.216083, 0.17874, 0.215271, 0.220871, 0.218629, 0.22385, 0.214548, 0.207348, 0.213017, 0.205046, 0.205322, 0.216237, 0.213037, 0.213583, 0.221889, 0.214009, 0.2114, 0.221829, 0.213672, 0.211352, 0.220756, 0.213196, 0.210437, 0.220665, 0.212004, 0.209666, 0.219037, 0.210731, 0.207999, 0.218224, 0.212136, 0.208618, 0.219715, 0.211601, 0.209753, 0.220167, 0.211411, 0.210473, 0.218819, 0.211863, 0.208812, 0.218292, 0.21004, 0.208764, 0.217799, 0.210203, 0.208359, 0.21802, 0.21047, 0.208768, 0.218842, 0.210851, 0.207915, 0.217812, 0.210657, 0.208162, 0.217901, 0.210955, 0.207817, 0.2184, 0.210845, 0.207735, 0.216843, 0.209601, 0.208132, 0.217352, 0.210535, 0.20834, 0.217295, 0.211573, 0.208496, 0.217547, 0.211352, 0.208473, 0.217348, 0.21075, 0.209999, 0.218447, 0.210967, 0.209054, 0.217774, 0.211178, 0.208724, 0.218193, 0.211438, 0.208724, 0.217298, 0.211312, 0.209553, 0.21892, 0.213003, 0.20998, 0.219117, 0.212205, 0.21, 0.218805, 0.212316, 0.210191, 0.218836, 0.212226, 0.211064, 0.219218, 0.212985, 0.210339, 0.218847, 0.212964, 0.210865, 0.219544, 0.212254, 0.21025, 0.22002, 0.214008, 0.210961, 0.219523, 0.212831, 0.211271, 0.21941, 0.213635, 0.211926, 0.219413, 0.214334, 0.211792, 0.220272, 0.214403, 0.212403, 0.220112, 0.214382, 0.212477, 0.220249, 0.214955, 0.212865, 0.221058, 0.215765, 0.212725, 0.221239, 0.215754, 0.212756, 0.221651, 0.216041, 0.212062, 0.2219 ], "C": [ 0.397131, 0.267234, 0.271509, 0.266256, 0.228935, 0.242764, 0.245324, 0.298539, 0.288803, 0.225723, 0.292218, 0.289868, 0.272678, 0.268649, 0.263857, 0.267215, 0.264225, 0.255386, 0.253296, 0.25802, 0.257652, 0.267268, 0.264138, 0.258527, 0.265964, 0.263281, 0.260686, 0.268644, 0.26528, 0.261968, 0.269368, 0.265691, 0.26112, 0.267971, 0.264409, 0.262125, 0.269355, 0.26514, 0.262027, 0.268606, 0.26467, 0.260792, 0.26885, 0.265964, 0.262279, 0.269938, 0.265711, 0.262814, 0.270238, 0.267103, 0.263367, 0.270797, 0.266557, 0.26316, 0.271052, 0.266264, 0.263447, 0.271049, 0.26757, 0.26452, 0.270343, 0.267152, 0.264592, 0.271056, 0.267178, 0.263436, 0.271114, 0.267036, 0.264486, 0.269788, 0.266782, 0.26359, 0.270837, 0.266309, 0.263324, 0.270744, 0.265901, 0.262929, 0.269538, 0.265227, 0.261442, 0.268063, 0.263976, 0.261896, 0.269245, 0.264158, 0.261814, 0.268374, 0.264107, 0.261347, 0.267544, 0.264642, 0.261153, 0.267226, 0.263376, 0.260568, 0.266752, 0.262739, 0.259055, 0.266024, 0.261915, 0.259164, 0.265659, 0.261874, 0.258646, 0.264603, 0.260533, 0.259299, 0.264538, 0.260124, 0.258293, 0.264312, 0.260751, 0.25762, 0.264149, 0.261206, 0.257443, 0.264122, 0.259837, 0.256533, 0.262693, 0.258149, 0.256497, 0.263346, 0.258555, 0.257091, 0.263592, 0.258882, 0.256662, 0.262297, 0.258054, 0.255742, 0.262065, 0.258356, 0.255919, 0.261553, 0.257667, 0.255626, 0.262167, 0.258051, 0.255409, 0.260813, 0.257603, 0.254842, 0.260405, 0.258053, 0.25515, 0.261815, 0.257239, 0.253665 ], "G": [ 0.37184, 0.322088, 0.240679, 0.294831, 0.294574, 0.23724, 0.259047, 0.238157, 0.247356, 0.267508, 0.302456, 0.28366, 0.280605, 0.273928, 0.264548, 0.282003, 0.280276, 0.270686, 0.290982, 0.281784, 0.268218, 0.277197, 0.276241, 0.267861, 0.279713, 0.277379, 0.266477, 0.280046, 0.27853, 0.26736, 0.279128, 0.27797, 0.266883, 0.28007, 0.279751, 0.267812, 0.279923, 0.27928, 0.268093, 0.279563, 0.279482, 0.268941, 0.279913, 0.279099, 0.267721, 0.279169, 0.278987, 0.268392, 0.279758, 0.278719, 0.268349, 0.280277, 0.27921, 0.268672, 0.280197, 0.279363, 0.26922, 0.279849, 0.278103, 0.267158, 0.280351, 0.279262, 0.268031, 0.279495, 0.278866, 0.268321, 0.279061, 0.278582, 0.266824, 0.279575, 0.278768, 0.268588, 0.278743, 0.278158, 0.267505, 0.277723, 0.277914, 0.267969, 0.278244, 0.278465, 0.268336, 0.278718, 0.278408, 0.267446, 0.277961, 0.277317, 0.266311, 0.277505, 0.276421, 0.267598, 0.278203, 0.276771, 0.266403, 0.276595, 0.276541, 0.266514, 0.277699, 0.276221, 0.266277, 0.276193, 0.276511, 0.265879, 0.276191, 0.276331, 0.266148, 0.27705, 0.276199, 0.265299, 0.275956, 0.27522, 0.26559, 0.275333, 0.275308, 0.266065, 0.276036, 0.274802, 0.265667, 0.275407, 0.274254, 0.265214, 0.275391, 0.275427, 0.26511, 0.275508, 0.274433, 0.264804, 0.274655, 0.273992, 0.263783, 0.273731, 0.274145, 0.264161, 0.273893, 0.273427, 0.264293, 0.274511, 0.273685, 0.264007, 0.27268, 0.272498, 0.263537, 0.273046, 0.272225, 0.262677, 0.272539, 0.27161, 0.261204, 0.271877, 0.271895, 0.26241 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.768971, 0.589323, 0.512187, 0.561087, 0.523509, 0.480004, 0.504372, 0.536695, 0.536159, 0.493231, 0.594674, 0.573528, 0.553283, 0.542577, 0.528405, 0.549218, 0.544501, 0.526072, 0.544279, 0.539804, 0.52587, 0.544465, 0.540379, 0.526388, 0.545677, 0.54066, 0.527163, 0.54869, 0.54381, 0.529328, 0.548496, 0.543661, 0.528003, 0.548041, 0.54416, 0.529937, 0.549277, 0.54442, 0.530121, 0.54817, 0.544152, 0.529733, 0.548763, 0.545063, 0.53, 0.549107, 0.544698, 0.531206, 0.549996, 0.545822, 0.531716, 0.551074, 0.545767, 0.531831, 0.551249, 0.545627, 0.532667, 0.550898, 0.545673, 0.531677, 0.550694, 0.546414, 0.532622, 0.550551, 0.546044, 0.531757, 0.550176, 0.545618, 0.53131, 0.549364, 0.54555, 0.532178, 0.54958, 0.544468, 0.53083, 0.548467, 0.543815, 0.530898, 0.547782, 0.543692, 0.529778, 0.546782, 0.542384, 0.529342, 0.547206, 0.541475, 0.528125, 0.54588, 0.540528, 0.528944, 0.545747, 0.541414, 0.527556, 0.543821, 0.539917, 0.527082, 0.544451, 0.53896, 0.525332, 0.542216, 0.538426, 0.525043, 0.54185, 0.538205, 0.524794, 0.541653, 0.536732, 0.524598, 0.540495, 0.535344, 0.523883, 0.539645, 0.53606, 0.523685, 0.540185, 0.536008, 0.523109, 0.539529, 0.534091, 0.521747, 0.538085, 0.533576, 0.521607, 0.538855, 0.532988, 0.521895, 0.538247, 0.532874, 0.520446, 0.536027, 0.532199, 0.519903, 0.535958, 0.531783, 0.520212, 0.536064, 0.531352, 0.519633, 0.534847, 0.530549, 0.518946, 0.53386, 0.529828, 0.51752, 0.532945, 0.529664, 0.516354, 0.533692, 0.529134, 0.516075 ] }, "kmer_count": { "AAAAA": 2637854, "AAAAT": 1879548, "AAAAC": 1595642, "AAAAG": 2360590, "AAATA": 1078257, "AAATT": 1366121, "AAATC": 1245194, "AAATG": 1751104, "AAACA": 1685987, "AAACT": 1449603, "AAACC": 1269117, "AAACG": 515610, "AAAGA": 2803955, "AAAGT": 1460171, "AAAGC": 1880476, "AAAGG": 1873027, "AATAA": 832031, "AATAT": 853279, "AATAC": 657010, "AATAG": 455196, "AATTA": 678569, "AATTT": 1115525, "AATTC": 943264, "AATTG": 984819, "AATCA": 1050939, "AATCT": 941721, "AATCC": 913335, "AATCG": 329767, "AATGA": 1651498, "AATGT": 1205897, "AATGC": 1181220, "AATGG": 1477244, "AACAA": 1806682, "AACAT": 1374198, "AACAC": 1066315, "AACAG": 1841860, "AACTA": 725854, "AACTT": 1227820, "AACTC": 1038031, "AACTG": 1599731, "AACCA": 1533869, "AACCT": 1328765, "AACCC": 1089895, "AACCG": 549412, "AACGA": 598138, "AACGT": 536059, "AACGC": 490245, "AACGG": 546946, "AAGAA": 4367566, "AAGAT": 2401483, "AAGAC": 1870748, "AAGAG": 2533800, "AAGTA": 1046673, "AAGTT": 1427897, "AAGTC": 1277182, "AAGTG": 1632230, "AAGCA": 2248657, "AAGCT": 2197651, "AAGCC": 2025668, "AAGCG": 949924, "AAGGA": 2997973, "AAGGT": 1486766, "AAGGC": 2177310, "AAGGG": 1364752, "ATAAA": 963567, "ATAAT": 544062, "ATAAC": 425708, "ATAAG": 656554, "ATATA": 418634, "ATATT": 762536, "ATATC": 599347, "ATATG": 830193, "ATACA": 674497, "ATACT": 527275, "ATACC": 575332, "ATACG": 211482, "ATAGA": 564950, "ATAGT": 376494, "ATAGC": 418893, "ATAGG": 295579, "ATTAA": 717152, "ATTAT": 735499, "ATTAC": 656857, "ATTAG": 371762, "ATTTA": 695719, "ATTTT": 1248944, "ATTTC": 1045284, "ATTTG": 1255441, "ATTCA": 1135905, "ATTCT": 1075511, "ATTCC": 1032480, "ATTCG": 415125, "ATTGA": 1381335, "ATTGT": 939818, "ATTGC": 1028996, "ATTGG": 1124915, "ATCAA": 1628752, "ATCAT": 1340970, "ATCAC": 1140599, "ATCAG": 1466861, "ATCTA": 680507, "ATCTT": 1221900, "ATCTC": 1158899, "ATCTG": 1452880, "ATCCA": 1646693, "ATCCT": 1548518, "ATCCC": 1128906, "ATCCG": 772789, "ATCGA": 715238, "ATCGT": 575118, "ATCGC": 614506, "ATCGG": 501189, "ATGAA": 2394372, "ATGAT": 1646416, "ATGAC": 1434635, "ATGAG": 1886206, "ATGTA": 694206, "ATGTT": 1170288, "ATGTC": 1140496, "ATGTG": 1633411, "ATGCA": 1340384, "ATGCT": 1550032, "ATGCC": 1633124, "ATGCG": 478310, "ATGGA": 2212305, "ATGGT": 1231861, "ATGGC": 1912263, "ATGGG": 1343670, "ACAAA": 1625079, "ACAAT": 886684, "ACAAC": 1331860, "ACAAG": 2113930, "ACATA": 472486, "ACATT": 1099660, "ACATC": 1613661, "ACATG": 1393782, "ACACA": 1284913, "ACACT": 944545, "ACACC": 1409570, "ACACG": 563140, "ACAGA": 2127586, "ACAGT": 1419805, "ACAGC": 2279868, "ACAGG": 1588428, "ACTAA": 478388, "ACTAT": 698351, "ACTAC": 951048, "ACTAG": 337805, "ACTTA": 539242, "ACTTT": 1212111, "ACTTC": 1571491, "ACTTG": 1036741, "ACTCA": 1090214, "ACTCT": 1032643, "ACTCC": 1286427, "ACTCG": 474051, "ACTGA": 1428433, "ACTGT": 1237213, "ACTGC": 1658223, "ACTGG": 1868589, "ACCAA": 1785822, "ACCAT": 1534686, "ACCAC": 1643956, "ACCAG": 2398333, "ACCTA": 667633, "ACCTT": 1262816, "ACCTC": 1612281, "ACCTG": 2668751, "ACCCA": 1533969, "ACCCT": 1475173, "ACCCC": 1594588, "ACCCG": 754638, "ACCGA": 679373, "ACCGT": 578952, "ACCGC": 972069, "ACCGG": 826246, "ACGAA": 479520, "ACGAT": 416441, "ACGAC": 643978, "ACGAG": 988414, "ACGTA": 208437, "ACGTT": 344881, "ACGTC": 531376, "ACGTG": 958938, "ACGCA": 521068, "ACGCT": 601607, "ACGCC": 915454, "ACGCG": 368365, "ACGGA": 675917, "ACGGT": 438948, "ACGGC": 958583, "ACGGG": 727490, "AGAAA": 3255181, "AGAAT": 1615813, "AGAAC": 1945518, "AGAAG": 4651255, "AGATA": 907502, "AGATT": 1368116, "AGATC": 1847888, "AGATG": 2712758, "AGACA": 1789373, "AGACT": 1342925, "AGACC": 1772514, "AGACG": 808334, "AGAGA": 2385947, "AGAGT": 1249643, "AGAGC": 2281230, "AGAGG": 2295567, "AGTAA": 634752, "AGTAT": 811637, "AGTAC": 1050777, "AGTAG": 569413, "AGTTA": 605983, "AGTTT": 1272873, "AGTTC": 1483757, "AGTTG": 1109001, "AGTCA": 1211966, "AGTCT": 1038015, "AGTCC": 1295047, "AGTCG": 504070, "AGTGA": 1609917, "AGTGT": 1097578, "AGTGC": 1462212, "AGTGG": 1985134, "AGCAA": 1968891, "AGCAT": 1290047, "AGCAC": 1687915, "AGCAG": 3999269, "AGCTA": 919113, "AGCTT": 1449565, "AGCTC": 2088951, "AGCTG": 4048515, "AGCCA": 2538825, "AGCCT": 2030289, "AGCCC": 2510541, "AGCCG": 1297281, "AGCGA": 824379, "AGCGT": 624611, "AGCGC": 1226980, "AGCGG": 1349978, "AGGAA": 2716483, "AGGAT": 1625432, "AGGAC": 1972698, "AGGAG": 3933851, "AGGTA": 638199, "AGGTT": 970189, "AGGTC": 1084938, "AGGTG": 2206353, "AGGCA": 1841239, "AGGCT": 1856508, "AGGCC": 2639756, "AGGCG": 1068838, "AGGGA": 1358199, "AGGGT": 860649, "AGGGC": 1722771, "AGGGG": 1182143, "TAAAA": 1098477, "TAAAT": 651629, "TAAAC": 580263, "TAAAG": 1159388, "TAATA": 389537, "TAATT": 468372, "TAATC": 375062, "TAATG": 722601, "TAACA": 596740, "TAACT": 467709, "TAACC": 435408, "TAACG": 133198, "TAAGA": 829841, "TAAGT": 450595, "TAAGC": 533839, "TAAGG": 696543, "TATAA": 526975, "TATAT": 471759, "TATAC": 331905, "TATAG": 315671, "TATTA": 500615, "TATTT": 886887, "TATTC": 655789, "TATTG": 787415, "TATCA": 828144, "TATCT": 678307, "TATCC": 647949, "TATCG": 263643, "TATGA": 1195945, "TATGT": 750087, "TATGC": 757115, "TATGG": 968024, "TACAA": 1179116, "TACAT": 789688, "TACAC": 701538, "TACAG": 1299045, "TACTA": 496751, "TACTT": 788173, "TACTC": 634856, "TACTG": 1007190, "TACCA": 1128234, "TACCT": 1076724, "TACCC": 717567, "TACCG": 467208, "TACGA": 476367, "TACGT": 357237, "TACGC": 335759, "TACGG": 394703, "TAGAA": 828442, "TAGAT": 474324, "TAGAC": 403673, "TAGAG": 703125, "TAGTA": 285150, "TAGTT": 348233, "TAGTC": 290769, "TAGTG": 547375, "TAGCA": 620412, "TAGCT": 481097, "TAGCC": 517621, "TAGCG": 148432, "TAGGA": 440360, "TAGGT": 266925, "TAGGC": 329410, "TAGGG": 287501, "TTAAA": 963369, "TTAAT": 575042, "TTAAC": 445872, "TTAAG": 705984, "TTATA": 454670, "TTATT": 819806, "TTATC": 632213, "TTATG": 847401, "TTACA": 890078, "TTACT": 719100, "TTACC": 677245, "TTACG": 252771, "TTAGA": 604757, "TTAGT": 363487, "TTAGC": 417082, "TTAGG": 304630, "TTTAA": 859810, "TTTAT": 869764, "TTTAC": 684215, "TTTAG": 533061, "TTTTA": 892056, "TTTTT": 1415905, "TTTTC": 1231691, "TTTTG": 1494672, "TTTCA": 1290613, "TTTCT": 1565012, "TTTCC": 1335005, "TTTCG": 328751, "TTTGA": 1820505, "TTTGT": 1309206, "TTTGC": 1334197, "TTTGG": 1660263, "TTCAA": 1525397, "TTCAT": 1277392, "TTCAC": 1157940, "TTCAG": 2034322, "TTCTA": 864697, "TTCTT": 1588176, "TTCTC": 1535858, "TTCTG": 1998109, "TTCCA": 1919088, "TTCCT": 2052618, "TTCCC": 1435910, "TTCCG": 710693, "TTCGA": 694264, "TTCGT": 557432, "TTCGC": 517599, "TTCGG": 608275, "TTGAA": 1702043, "TTGAT": 1228086, "TTGAC": 1032159, "TTGAG": 1315163, "TTGTA": 631056, "TTGTT": 1005421, "TTGTC": 936907, "TTGTG": 1393437, "TTGCA": 1186765, "TTGCT": 1532960, "TTGCC": 1347112, "TTGCG": 343021, "TTGGA": 1804682, "TTGGT": 1123503, "TTGGC": 1440247, "TTGGG": 1129303, "TCAAA": 1409334, "TCAAT": 814555, "TCAAC": 1360898, "TCAAG": 2168592, "TCATA": 482494, "TCATT": 1170288, "TCATC": 1969972, "TCATG": 1499707, "TCACA": 1208451, "TCACT": 1127254, "TCACC": 1874977, "TCACG": 516781, "TCAGA": 2015166, "TCAGT": 1333265, "TCAGC": 2156619, "TCAGG": 1651286, "TCTAA": 560486, "TCTAT": 705351, "TCTAC": 1108827, "TCTAG": 469637, "TCTTA": 616163, "TCTTT": 1371356, "TCTTC": 2168758, "TCTTG": 1200972, "TCTCA": 1375545, "TCTCT": 1520208, "TCTCC": 1896376, "TCTCG": 586709, "TCTGA": 1644556, "TCTGT": 1472132, "TCTGC": 2007465, "TCTGG": 2193438, "TCCAA": 1595944, "TCCAT": 1301124, "TCCAC": 1611924, "TCCAG": 3005796, "TCCTA": 801309, "TCCTT": 1424406, "TCCTC": 2110635, "TCCTG": 3154407, "TCCCA": 1708531, "TCCCT": 1556215, "TCCCC": 1652580, "TCCCG": 963647, "TCCGA": 689451, "TCCGT": 573808, "TCCGC": 1044341, "TCCGG": 1056105, "TCGAA": 499499, "TCGAT": 369674, "TCGAC": 608353, "TCGAG": 912056, "TCGTA": 238594, "TCGTT": 306468, "TCGTC": 667243, "TCGTG": 894970, "TCGCA": 480259, "TCGCT": 655734, "TCGCC": 972143, "TCGCG": 367235, "TCGGA": 673406, "TCGGT": 437213, "TCGGC": 849892, "TCGGG": 802416, "TGAAA": 2213461, "TGAAT": 1252497, "TGAAC": 1519719, "TGAAG": 3713457, "TGATA": 781284, "TGATT": 1065454, "TGATC": 1231868, "TGATG": 2605931, "TGACA": 1768386, "TGACT": 1363995, "TGACC": 1828503, "TGACG": 710285, "TGAGA": 1845535, "TGAGT": 1059804, "TGAGC": 1940450, "TGAGG": 2204127, "TGTAA": 643879, "TGTAT": 751707, "TGTAC": 962716, "TGTAG": 574262, "TGTTA": 675649, "TGTTT": 1332931, "TGTTC": 1312559, "TGTTG": 1395941, "TGTCA": 1455806, "TGTCT": 1380087, "TGTCC": 1610046, "TGTCG": 521255, "TGTGA": 1693680, "TGTGT": 1481502, "TGTGC": 1741815, "TGTGG": 2664014, "TGCAA": 1376131, "TGCAT": 1011863, "TGCAC": 1347679, "TGCAG": 3269807, "TGCTA": 944241, "TGCTT": 1413586, "TGCTC": 1842648, "TGCTG": 4357427, "TGCCA": 2472474, "TGCCT": 1998358, "TGCCC": 2481322, "TGCCG": 1087114, "TGCGA": 514898, "TGCGT": 490155, "TGCGC": 957967, "TGCGG": 1169852, "TGGAA": 2753159, "TGGAT": 1882848, "TGGAC": 2273876, "TGGAG": 3996074, "TGGTA": 850036, "TGGTT": 1194474, "TGGTC": 1312981, "TGGTG": 2969282, "TGGCA": 2446639, "TGGCT": 2398661, "TGGCC": 3072951, "TGGCG": 1119742, "TGGGA": 1884127, "TGGGT": 1090877, "TGGGC": 2241698, "TGGGG": 1852334, "CAAAA": 1924546, "CAAAT": 1196984, "CAAAC": 1214114, "CAAAG": 2302736, "CAATA": 601235, "CAATT": 692119, "CAATC": 630041, "CAATG": 1535779, "CAACA": 2046212, "CAACT": 1296204, "CAACC": 1404936, "CAACG": 796250, "CAAGA": 3034598, "CAAGT": 1652392, "CAAGC": 2159857, "CAAGG": 2660503, "CATAA": 450634, "CATAT": 527742, "CATAC": 446591, "CATAG": 440303, "CATTA": 671718, "CATTT": 1129961, "CATTC": 1034228, "CATTG": 1659992, "CATCA": 2321992, "CATCT": 1751602, "CATCC": 2114980, "CATCG": 1186745, "CATGA": 1698002, "CATGT": 1220221, "CATGC": 1323812, "CATGG": 2155648, "CACAA": 1248209, "CACAT": 1017063, "CACAC": 1218072, "CACAG": 2325774, "CACTA": 598005, "CACTT": 1027619, "CACTC": 1029865, "CACTG": 2045737, "CACCA": 2804484, "CACCT": 2004224, "CACCC": 1916717, "CACCG": 1158961, "CACGA": 571021, "CACGT": 566228, "CACGC": 784800, "CACGG": 976274, "CAGAA": 3184052, "CAGAT": 2106893, "CAGAC": 1819615, "CAGAG": 2958648, "CAGTA": 996192, "CAGTT": 1528311, "CAGTC": 1314883, "CAGTG": 2531896, "CAGCA": 3745242, "CAGCT": 3262812, "CAGCC": 3525353, "CAGCG": 1630477, "CAGGA": 3045725, "CAGGT": 1629815, "CAGGC": 2446538, "CAGGG": 1921710, "CTAAA": 844669, "CTAAT": 437353, "CTAAC": 379134, "CTAAG": 695861, "CTATA": 423630, "CTATT": 635996, "CTATC": 615060, "CTATG": 1208532, "CTACA": 1517204, "CTACT": 990632, "CTACC": 1257641, "CTACG": 688357, "CTAGA": 609745, "CTAGT": 370725, "CTAGC": 430709, "CTAGG": 390689, "CTTAA": 602530, "CTTAT": 614741, "CTTAC": 647572, "CTTAG": 467234, "CTTTA": 782487, "CTTTT": 1322873, "CTTTC": 1252693, "CTTTG": 2040076, "CTTCA": 2397323, "CTTCT": 2178085, "CTTCC": 2463782, "CTTCG": 1078875, "CTTGA": 1122618, "CTTGT": 966908, "CTTGC": 1149624, "CTTGG": 1580822, "CTCAA": 1517458, "CTCAT": 1387163, "CTCAC": 1346952, "CTCAG": 2360627, "CTCTA": 796794, "CTCTT": 1515297, "CTCTC": 1555282, "CTCTG": 2410613, "CTCCA": 2545090, "CTCCT": 2449494, "CTCCC": 2023667, "CTCCG": 1238047, "CTCGA": 594458, "CTCGT": 556925, "CTCGC": 804526, "CTCGG": 1061370, "CTGAA": 2633288, "CTGAT": 1561173, "CTGAC": 1803628, "CTGAG": 2538689, "CTGTA": 985523, "CTGTT": 1413263, "CTGTC": 1673619, "CTGTG": 2841906, "CTGCA": 3010913, "CTGCT": 3587842, "CTGCC": 3310442, "CTGCG": 1514578, "CTGGA": 4023725, "CTGGT": 2175500, "CTGGC": 3293060, "CTGGG": 2815381, "CCAAA": 1889922, "CCAAT": 946807, "CCAAC": 1623408, "CCAAG": 3079599, "CCATA": 501948, "CCATT": 1216520, "CCATC": 2173908, "CCATG": 2189120, "CCACA": 1882838, "CCACT": 1473401, "CCACC": 2751917, "CCACG": 1090419, "CCAGA": 2999018, "CCAGT": 1892067, "CCAGC": 3795495, "CCAGG": 3196901, "CCTAA": 625991, "CCTAT": 681875, "CCTAC": 1161610, "CCTAG": 523325, "CCTTA": 625310, "CCTTT": 1365940, "CCTTC": 2237563, "CCTTG": 1424918, "CCTCA": 2230588, "CCTCT": 1908135, "CCTCC": 2710061, "CCTCG": 1037536, "CCTGA": 2609327, "CCTGT": 1945388, "CCTGC": 3485937, "CCTGG": 4216754, "CCCAA": 1737251, "CCCAT": 1236674, "CCCAC": 1816994, "CCCAG": 3562520, "CCCTA": 706065, "CCCTT": 1266166, "CCCTC": 1882177, "CCCTG": 3324244, "CCCCA": 2505189, "CCCCT": 1790826, "CCCCC": 1953202, "CCCCG": 1528519, "CCCGA": 1019769, "CCCGT": 704834, "CCCGC": 1565347, "CCCGG": 1659323, "CCGAA": 681348, "CCGAT": 404129, "CCGAC": 803684, "CCGAG": 1678994, "CCGTA": 308988, "CCGTT": 387453, "CCGTC": 763204, "CCGTG": 1372151, "CCGCA": 1286048, "CCGCT": 1173023, "CCGCC": 2183794, "CCGCG": 1114509, "CCGGA": 1190473, "CCGGT": 558196, "CCGGC": 1795724, "CCGGG": 1631989, "CGAAA": 577058, "CGAAT": 383880, "CGAAC": 339340, "CGAAG": 822230, "CGATA": 215018, "CGATT": 293937, "CGATC": 333094, "CGATG": 729965, "CGACA": 820318, "CGACT": 565128, "CGACC": 750727, "CGACG": 601084, "CGAGA": 1191840, "CGAGT": 738861, "CGAGC": 1202826, "CGAGG": 1543746, "CGTAA": 219115, "CGTAT": 220313, "CGTAC": 282328, "CGTAG": 239207, "CGTTA": 201456, "CGTTT": 376935, "CGTTC": 425399, "CGTTG": 392492, "CGTCA": 769351, "CGTCT": 686297, "CGTCC": 773704, "CGTCG": 435044, "CGTGA": 869900, "CGTGT": 723822, "CGTGC": 1037406, "CGTGG": 1555476, "CGCAA": 830486, "CGCAT": 577368, "CGCAC": 638971, "CGCAG": 1196904, "CGCTA": 414216, "CGCTT": 634839, "CGCTC": 887970, "CGCTG": 1591986, "CGCCA": 1459847, "CGCCT": 1311525, "CGCCC": 1343376, "CGCCG": 1519833, "CGCGA": 413951, "CGCGT": 337917, "CGCGC": 863222, "CGCGG": 1026664, "CGGAA": 966828, "CGGAT": 533552, "CGGAC": 753901, "CGGAG": 1437446, "CGGTA": 238030, "CGGTT": 375088, "CGGTC": 502630, "CGGTG": 982865, "CGGCA": 1258995, "CGGCT": 1345601, "CGGCC": 1881243, "CGGCG": 1308181, "CGGGA": 1339392, "CGGGT": 574355, "CGGGC": 1481361, "CGGGG": 1231441, "GAAAA": 2856011, "GAAAT": 1742183, "GAAAC": 1569692, "GAAAG": 2272237, "GAATA": 740763, "GAATT": 1208111, "GAATC": 996520, "GAATG": 1528944, "GAACA": 1786099, "GAACT": 1400312, "GAACC": 1427350, "GAACG": 738168, "GAAGA": 4558535, "GAAGT": 1847499, "GAAGC": 2892564, "GAAGG": 2864633, "GATAA": 790322, "GATAT": 768647, "GATAC": 561192, "GATAG": 455701, "GATTA": 629015, "GATTT": 1095604, "GATTC": 1012198, "GATTG": 1037297, "GATCA": 1384639, "GATCT": 1153166, "GATCC": 1437333, "GATCG": 627245, "GATGA": 2831647, "GATGT": 1478559, "GATGC": 1760789, "GATGG": 2128276, "GACAA": 1740011, "GACAT": 1416512, "GACAC": 1241719, "GACAG": 1996965, "GACTA": 647552, "GACTT": 1323860, "GACTC": 1186522, "GACTG": 1550749, "GACCA": 1909298, "GACCT": 1819074, "GACCC": 1680099, "GACCG": 893571, "GACGA": 887381, "GACGT": 592022, "GACGC": 808058, "GACGG": 896368, "GAGAA": 3088755, "GAGAT": 1865537, "GAGAC": 1649187, "GAGAG": 2085311, "GAGTA": 736813, "GAGTT": 1170183, "GAGTC": 1167214, "GAGTG": 1447955, "GAGCA": 2344701, "GAGCT": 2584573, "GAGCC": 2360706, "GAGCG": 1304617, "GAGGA": 3781121, "GAGGT": 1535990, "GAGGC": 2509526, "GAGGG": 1593195, "GTAAA": 737613, "GTAAT": 410599, "GTAAC": 394185, "GTAAG": 474311, "GTATA": 355073, "GTATT": 620701, "GTATC": 577541, "GTATG": 798356, "GTACA": 906096, "GTACT": 704387, "GTACC": 904070, "GTACG": 420175, "GTAGA": 642510, "GTAGT": 368146, "GTAGC": 511941, "GTAGG": 344876, "GTTAA": 521661, "GTTAT": 546260, "GTTAC": 564565, "GTTAG": 328896, "GTTTA": 577094, "GTTTT": 1041059, "GTTTC": 982416, "GTTTG": 1330962, "GTTCA": 1189473, "GTTCT": 1188928, "GTTCC": 1315784, "GTTCG": 561839, "GTTGA": 967602, "GTTGT": 765226, "GTTGC": 914440, "GTTGG": 1154078, "GTCAA": 1103330, "GTCAT": 1141914, "GTCAC": 1118299, "GTCAG": 1342057, "GTCTA": 502485, "GTCTT": 1042812, "GTCTC": 1133611, "GTCTG": 1459234, "GTCCA": 1431929, "GTCCT": 1472656, "GTCCC": 1348752, "GTCCG": 657621, "GTCGA": 393607, "GTCGT": 426400, "GTCGC": 549639, "GTCGG": 602779, "GTGAA": 1962954, "GTGAT": 1252634, "GTGAC": 1427620, "GTGAG": 1345334, "GTGTA": 615133, "GTGTT": 1124811, "GTGTC": 1210125, "GTGTG": 1702257, "GTGCA": 1489002, "GTGCT": 1917781, "GTGCC": 1805040, "GTGCG": 806700, "GTGGA": 2857040, "GTGGT": 1809210, "GTGGC": 2431420, "GTGGG": 1809584, "GCAAA": 1725793, "GCAAT": 815076, "GCAAC": 1248072, "GCAAG": 2200716, "GCATA": 406482, "GCATT": 1003542, "GCATC": 1602442, "GCATG": 1302124, "GCACA": 1415734, "GCACT": 1153524, "GCACC": 1857531, "GCACG": 721145, "GCAGA": 2935558, "GCAGT": 1735379, "GCAGC": 3957423, "GCAGG": 2640227, "GCTAA": 687489, "GCTAT": 790423, "GCTAC": 1222596, "GCTAG": 469745, "GCTTA": 520532, "GCTTT": 1354723, "GCTTC": 2009869, "GCTTG": 1075558, "GCTCA": 1847500, "GCTCT": 1762721, "GCTCC": 2315064, "GCTCG": 881684, "GCTGA": 2793996, "GCTGT": 2232809, "GCTGC": 4260192, "GCTGG": 3944885, "GCCAA": 2385436, "GCCAT": 1996676, "GCCAC": 2137583, "GCCAG": 2937447, "GCCTA": 776154, "GCCTT": 1661726, "GCCTC": 2204364, "GCCTG": 2998295, "GCCCA": 2538937, "GCCCT": 2332323, "GCCCC": 2633398, "GCCCG": 1691101, "GCCGA": 1163136, "GCCGT": 973444, "GCCGC": 2181236, "GCCGG": 1619598, "GCGAA": 443557, "GCGAT": 368966, "GCGAC": 680687, "GCGAG": 1090153, "GCGTA": 195650, "GCGTT": 345505, "GCGTC": 679324, "GCGTG": 925454, "GCGCA": 954392, "GCGCT": 1097439, "GCGCC": 1571570, "GCGCG": 782708, "GCGGA": 1115591, "GCGGT": 655563, "GCGGC": 2171550, "GCGGG": 1431138, "GGAAA": 2410741, "GGAAT": 1235110, "GGAAC": 1574504, "GGAAG": 3057526, "GGATA": 673349, "GGATT": 1044182, "GGATC": 1177606, "GGATG": 2160060, "GGACA": 2011449, "GGACT": 1438855, "GGACC": 1969621, "GGACG": 1066659, "GGAGA": 3277230, "GGAGT": 1486944, "GGAGC": 3202520, "GGAGG": 3444557, "GGTAA": 515887, "GGTAT": 565763, "GGTAC": 634973, "GGTAG": 485789, "GGTTA": 459260, "GGTTT": 877588, "GGTTC": 975884, "GGTTG": 859939, "GGTCA": 1220992, "GGTCT": 996468, "GGTCC": 1194963, "GGTCG": 488687, "GGTGA": 1768633, "GGTGT": 1339146, "GGTGC": 1773579, "GGTGG": 2670888, "GGCAA": 1794366, "GGCAT": 1433878, "GGCAC": 1481068, "GGCAG": 2812407, "GGCTA": 877398, "GGCTT": 1446338, "GGCTC": 1964504, "GGCTG": 3199551, "GGCCA": 2907212, "GGCCT": 2267888, "GGCCC": 2870135, "GGCCG": 2006737, "GGCGA": 820477, "GGCGT": 693765, "GGCGC": 1363258, "GGCGG": 1820754, "GGGAA": 1759714, "GGGAT": 976998, "GGGAC": 1477479, "GGGAG": 2052719, "GGGTA": 455842, "GGGTT": 604857, "GGGTC": 971169, "GGGTG": 1342528, "GGGCA": 1898589, "GGGCT": 1836967, "GGGCC": 2432546, "GGGCG": 1160416, "GGGGA": 1598665, "GGGGT": 834802, "GGGGC": 1886272, "GGGGG": 5242768 }, "overrepresented_sequences": {} }, "command": "fastp --in1 rna_s1200_S21_1.fastq.gz --in2 rna_s1200_S21_2.fastq.gz --out1 rna_s1200_S21_1.fastp.fastq.gz --out2 rna_s1200_S21_2.fastp.fastq.gz --json rna_s1200_S21.fastp.json --html rna_s1200_S21.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 10000000 " }, "rna_s1221_S42": { "summary": { "fastp_version": "0.23.4", "sequencing": "paired end (150 cycles + 150 cycles)", "before_filtering": { "total_reads": 20000000, "total_bases": 3000000000, "q20_bases": 2967881584, "q30_bases": 2918587264, "q20_rate": 0.989294, "q30_rate": 0.972862, "read1_mean_length": 150, "read2_mean_length": 150, "gc_content": 0.532228 }, "after_filtering": { "total_reads": 19864012, "total_bases": 2750073323, "q20_bases": 2736635705, "q30_bases": 2705779238, "q20_rate": 0.995114, "q30_rate": 0.983893, "read1_mean_length": 138, "read2_mean_length": 138, "gc_content": 0.533166 } }, "filtering_result": { "passed_filter_reads": 19864012, "low_quality_reads": 135928, "too_many_N_reads": 0, "too_short_reads": 60, "too_long_reads": 0 }, "duplication": { "rate": 0.139479 }, "insert_size": { "peak": 138, "unknown": 119730, "histogram": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 9, 6, 4, 10, 8, 14, 15, 18, 25, 28, 28, 18, 36, 30, 40, 42, 44, 46, 57, 59, 59, 66, 71, 86, 94, 80, 97, 108, 124, 106, 115, 144, 172, 198, 230, 233, 297, 311, 381, 416, 492, 542, 583, 700, 777, 850, 952, 1017, 1066, 1241, 1289, 1359, 1469, 1567, 1724, 1852, 1992, 2124, 2195, 2293, 2427, 2585, 2654, 2851, 2906, 3083, 3229, 3341, 3424, 3542, 3557, 3680, 3752, 3886, 4023, 4324, 4279, 4404, 4328, 4441, 4635, 4618, 4611, 4685, 4782, 4900, 5040, 5171, 5046, 5089, 5227, 5206, 5133, 5317, 5305, 5179, 5425, 5183, 5195, 5499, 5423, 5421, 5453, 5317, 5390, 5402, 5400, 5529, 5443, 5375, 5395, 5401, 5453, 5355, 5390, 5384, 5250, 5395, 5322, 5280, 5199, 5273, 5272, 5250, 5220, 4980, 5129, 5129, 5093, 4990, 5051, 5022, 5110, 4884, 4768, 4839, 4702, 4670, 4838, 4690, 4744, 4667, 4540, 4537, 4509, 4498, 4358, 4355, 4440, 4279, 4460, 4241, 4236, 4316, 4301, 4118, 4086, 4047, 3994, 3967, 4010, 4019, 3928, 3849, 3772, 3772, 3771, 3753, 3818, 3740, 3574, 3644, 3595, 3576, 3406, 3510, 3511, 3429, 3255, 3210, 3317, 3333, 3280, 3319, 3202, 3121, 3148, 3035, 3012, 2967, 2996, 2889, 2892, 2866, 2932, 2889, 2775, 2818, 2836, 2782, 2611, 2599, 2678, 2536, 2563, 2529, 2506, 2571, 2425, 2304, 2414, 2317, 2379, 2378, 2322, 2266, 2294, 2154, 2182, 2157, 2133, 2160, 2132, 2005, 1914, 2042, 1904, 1865, 1901, 1819, 1805, 1884, 1833, 1796, 1816, 1789, 1669, 1720, 1796, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ] }, "adapter_cutting": { "adapter_trimmed_reads": 7366518, "adapter_trimmed_bases": 230290481, "read1_adapter_sequence": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA", "read2_adapter_sequence": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", "read1_adapter_counts": { "A": 63209, "AG": 63744, "AGA": 62804, "AGAT": 62741, "AGATC": 69440, "AGATCG": 63887, "AGATCGG": 63520, "AGATCGGA": 65052, "AGATCGGAA": 64371, "AGATCGGAAG": 64801, "AGATCGGAAGA": 65911, "AGATCGGAAGAG": 64291, "AGATCGGAAGAGC": 64283, "AGATCGGAAGAGCA": 64709, "AGATCGGAAGAGCAC": 63414, "AGATCGGAAGAGCACA": 63220, "AGATCGGAAGAGCACAC": 65029, "AGATCGGAAGAGCACACG": 63493, "AGATCGGAAGAGCACACGT": 64024, "AGATCGGAAGAGCACACGTC": 64497, "AGATCGGAAGAGCACACGTCT": 62994, "AGATCGGAAGAGCACACGTCTG": 63860, "AGATCGGAAGAGCACACGTCTGA": 64128, "AGATCGGAAGAGCACACGTCTGAA": 61946, "AGATCGGAAGAGCACACGTCTGAAC": 61757, "AGATCGGAAGAGCACACGTCTGAACT": 61445, "AGATCGGAAGAGCACACGTCTGAACTC": 60540, "AGATCGGAAGAGCACACGTCTGAACTCC": 60259, "AGATCGGAAGAGCACACGTCTGAACTCCA": 61062, "AGATCGGAAGAGCACACGTCTGAACTCCAG": 60379, "AGATCGGAAGAGCACACGTCTGAACTCCAGT": 59840, "AGATCGGAAGAGCACACGTCTGAACTCCAGTC": 59812, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA": 58678, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC": 57696, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACA": 57286, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAC": 54458, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACA": 54085, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAG": 54010, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGC": 52981, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCT": 52298, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTC": 52242, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCA": 51257, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAA": 50078, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAAT": 49354, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAATC": 46717, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAATCT": 45129, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAATCTG": 40685, "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCTCAATCTGG": 38598, "others": 847121 }, "read2_adapter_counts": { "A": 63343, "AG": 63886, "AGA": 62933, "AGAT": 62873, "AGATC": 71965, "AGATCG": 64573, "AGATCGG": 63824, "AGATCGGA": 65138, "AGATCGGAA": 64403, "AGATCGGAAG": 64909, "AGATCGGAAGA": 65961, "AGATCGGAAGAG": 64325, "AGATCGGAAGAGC": 64273, "AGATCGGAAGAGCG": 64737, "AGATCGGAAGAGCGT": 63534, "AGATCGGAAGAGCGTC": 63040, "AGATCGGAAGAGCGTCG": 64873, "AGATCGGAAGAGCGTCGT": 63482, "AGATCGGAAGAGCGTCGTG": 64019, "AGATCGGAAGAGCGTCGTGT": 64221, "AGATCGGAAGAGCGTCGTGTA": 62239, "AGATCGGAAGAGCGTCGTGTAG": 62910, "AGATCGGAAGAGCGTCGTGTAGG": 63182, "AGATCGGAAGAGCGTCGTGTAGGG": 61090, "AGATCGGAAGAGCGTCGTGTAGGGA": 60491, "AGATCGGAAGAGCGTCGTGTAGGGAA": 60444, "AGATCGGAAGAGCGTCGTGTAGGGAAA": 59336, "AGATCGGAAGAGCGTCGTGTAGGGAAAG": 59006, "AGATCGGAAGAGCGTCGTGTAGGGAAAGA": 59589, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAG": 58563, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT": 58045, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG": 57709, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT": 56712, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTT": 55596, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTA": 51724, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAC": 49184, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACT": 48306, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTG": 47992, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGC": 46437, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCT": 45778, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTC": 44926, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTCG": 43770, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTCGT": 42555, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTCGTG": 41855, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTCGTGT": 39594, "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTACTGCTCGTGTA": 37376, "others": 1014662 } }, "read1_before_filtering": { "total_reads": 10000000, "total_bases": 1500000000, "q20_bases": 1485872334, "q30_bases": 1464758265, "total_cycles": 150, "quality_curves": { "A": [ 38.2172, 38.4131, 39.1333, 39.3769, 39.3103, 39.3623, 39.3525, 39.4406, 39.4074, 39.473, 39.4606, 39.4901, 39.5348, 39.5085, 39.4444, 39.5604, 39.6958, 39.612, 39.6733, 39.7041, 39.6315, 39.6926, 39.7152, 39.7167, 39.7198, 39.5711, 39.5746, 39.5852, 39.5666, 39.5846, 39.575, 39.602, 39.6076, 39.5616, 39.6061, 39.5689, 39.6243, 39.5874, 39.6284, 39.6329, 39.6304, 39.629, 39.6331, 39.635, 39.6358, 39.6428, 39.6393, 39.5707, 39.6415, 39.5513, 39.6408, 39.6473, 39.6447, 39.6408, 39.5947, 39.6458, 39.6424, 39.6332, 39.647, 39.6088, 39.6314, 39.648, 39.6254, 39.6277, 39.6474, 39.6399, 39.6509, 39.6404, 39.6388, 39.6463, 39.6415, 39.6457, 39.6393, 39.6362, 39.6371, 39.6389, 39.6174, 39.5933, 39.6171, 39.6287, 39.6272, 39.5925, 39.6116, 39.6271, 39.6139, 39.623, 39.6232, 39.5533, 39.6262, 39.6231, 39.6237, 39.6219, 39.6231, 39.6008, 39.6144, 39.6196, 39.6155, 39.6124, 39.5973, 39.6126, 39.6106, 39.6124, 39.6133, 39.6127, 39.6108, 39.6081, 39.5698, 39.6039, 39.603, 39.6024, 39.5804, 39.6018, 39.5486, 39.5961, 39.5941, 39.5916, 39.5601, 39.5978, 39.5921, 39.5912, 39.585, 39.5862, 39.5824, 39.5773, 39.5624, 39.5405, 39.5604, 39.5309, 39.5577, 39.5538, 39.5003, 39.5369, 39.5376, 39.534, 39.5261, 39.4955, 39.5065, 39.4932, 39.4378, 39.4634, 39.3823, 39.3834, 39.4008, 39.3353, 39.3357, 39.3546, 39.3079, 39.3143, 39.2393, 39.2396 ], "T": [ 39.1711, 39.4528, 39.5638, 39.6453, 39.6528, 39.6633, 39.6487, 39.6864, 39.7031, 39.7168, 39.7403, 39.7517, 39.758, 39.7617, 39.7608, 39.8376, 39.8411, 39.8443, 39.8485, 39.8492, 39.8497, 39.8555, 39.8588, 39.8576, 39.8588, 39.7265, 39.7273, 39.7354, 39.7362, 39.7396, 39.7453, 39.7477, 39.751, 39.7562, 39.7603, 39.7693, 39.7704, 39.7708, 39.7729, 39.7753, 39.7784, 39.7792, 39.7768, 39.7849, 39.7855, 39.7873, 39.7877, 39.7875, 39.7904, 39.7916, 39.7958, 39.7909, 39.7947, 39.7938, 39.7942, 39.7936, 39.7996, 39.7971, 39.7981, 39.797, 39.8, 39.7986, 39.799, 39.7998, 39.7994, 39.8027, 39.7992, 39.8013, 39.7998, 39.7999, 39.7964, 39.7987, 39.7988, 39.7999, 39.8, 39.8019, 39.8001, 39.7991, 39.8008, 39.8002, 39.8004, 39.7976, 39.7967, 39.7994, 39.7951, 39.795, 39.7963, 39.7944, 39.7946, 39.7923, 39.7935, 39.7903, 39.7913, 39.786, 39.785, 39.7838, 39.7799, 39.7772, 39.7747, 39.7697, 39.7655, 39.7634, 39.7576, 39.7582, 39.7546, 39.7494, 39.7463, 39.7404, 39.7365, 39.7272, 39.7223, 39.7108, 39.7029, 39.698, 39.6851, 39.6782, 39.666, 39.648, 39.6388, 39.6198, 39.5951, 39.5749, 39.5404, 39.4929, 39.4454, 39.381, 39.2689, 39.1774, 39.0543, 38.8828, 38.7766, 38.6417, 38.4809, 38.3851, 38.248, 38.0816, 37.9875, 37.8456, 37.6711, 37.5819, 37.474, 37.3194, 37.2742, 37.1838, 37.0648, 37.0454, 36.9353, 36.8211, 36.7655, 36.7218 ], "C": [ 38.413, 39.3493, 39.4486, 39.5786, 39.5674, 39.5456, 39.4987, 39.5288, 39.5175, 39.5695, 39.589, 39.5881, 39.5976, 39.5832, 39.5886, 39.7411, 39.741, 39.7435, 39.7487, 39.7424, 39.7403, 39.7487, 39.7485, 39.7409, 39.7443, 39.5828, 39.5893, 39.5895, 39.5852, 39.5838, 39.5959, 39.6, 39.6057, 39.613, 39.6154, 39.6244, 39.624, 39.6181, 39.6241, 39.6214, 39.6193, 39.6166, 39.6208, 39.6229, 39.6183, 39.6294, 39.6264, 39.6278, 39.6284, 39.6248, 39.6304, 39.6344, 39.6258, 39.6276, 39.6323, 39.6252, 39.6257, 39.6321, 39.6256, 39.623, 39.6278, 39.6284, 39.6189, 39.6235, 39.619, 39.6241, 39.6238, 39.6188, 39.619, 39.622, 39.6136, 39.6148, 39.6163, 39.6138, 39.6158, 39.6141, 39.6063, 39.6115, 39.6072, 39.605, 39.6057, 39.6097, 39.607, 39.6107, 39.6118, 39.6031, 39.6007, 39.6039, 39.596, 39.5978, 39.5985, 39.5903, 39.5974, 39.5927, 39.5885, 39.5917, 39.5993, 39.5909, 39.5834, 39.5902, 39.5835, 39.5816, 39.5865, 39.583, 39.5834, 39.5871, 39.5785, 39.5807, 39.585, 39.5751, 39.5829, 39.5834, 39.5687, 39.5758, 39.572, 39.5702, 39.5694, 39.5696, 39.5646, 39.5572, 39.5588, 39.5506, 39.5403, 39.5462, 39.5421, 39.5421, 39.5436, 39.5309, 39.5364, 39.5279, 39.5117, 39.5115, 39.502, 39.4942, 39.4878, 39.4779, 39.4707, 39.4607, 39.4403, 39.4313, 39.4283, 39.4254, 39.4156, 39.4084, 39.4023, 39.387, 39.3818, 39.379, 39.3584, 39.3471 ], "G": [ 39.2599, 39.3843, 39.3632, 39.5594, 39.5726, 39.5762, 39.592, 39.6106, 39.6227, 39.6199, 39.6415, 39.6597, 39.6675, 39.6698, 39.6655, 39.7437, 39.7535, 39.7542, 39.7593, 39.7655, 39.7605, 39.7685, 39.774, 39.775, 39.7779, 39.6411, 39.6438, 39.6501, 39.6532, 39.6573, 39.6609, 39.6667, 39.6668, 39.6697, 39.6758, 39.6807, 39.6828, 39.6858, 39.6836, 39.6872, 39.6923, 39.6913, 39.697, 39.6974, 39.6971, 39.7009, 39.7026, 39.6959, 39.7027, 39.7024, 39.7065, 39.7074, 39.7077, 39.7112, 39.7036, 39.7103, 39.712, 39.7106, 39.7135, 39.7137, 39.7148, 39.7133, 39.7147, 39.7165, 39.7165, 39.7144, 39.7154, 39.7125, 39.7152, 39.7154, 39.711, 39.7144, 39.7157, 39.7136, 39.7128, 39.7116, 39.7079, 39.7088, 39.7087, 39.7094, 39.7095, 39.7088, 39.7081, 39.7029, 39.7073, 39.7028, 39.7014, 39.701, 39.6918, 39.695, 39.6951, 39.6941, 39.6906, 39.6893, 39.6855, 39.6793, 39.6761, 39.671, 39.6664, 39.6653, 39.6599, 39.6541, 39.6551, 39.6487, 39.6381, 39.6335, 39.6186, 39.6138, 39.6042, 39.5876, 39.5761, 39.5651, 39.5468, 39.5257, 39.507, 39.4792, 39.4532, 39.4244, 39.3885, 39.3511, 39.3131, 39.257, 39.2083, 39.1617, 39.0977, 39.0478, 39.0214, 38.9724, 38.9531, 38.9416, 38.8989, 38.8705, 38.8411, 38.788, 38.7266, 38.6967, 38.6277, 38.5649, 38.5299, 38.4676, 38.4007, 38.3346, 38.2622, 38.1765, 38.1109, 38.0019, 37.9142, 37.8561, 37.7373, 37.6576 ], "mean": [ 38.8374, 39.3348, 39.42, 39.5583, 39.5402, 39.5475, 39.5457, 39.591, 39.5924, 39.6007, 39.6112, 39.6328, 39.6471, 39.6387, 39.6236, 39.7281, 39.7612, 39.7443, 39.7602, 39.7683, 39.7509, 39.7696, 39.7779, 39.7757, 39.7774, 39.6334, 39.6365, 39.6416, 39.6385, 39.6435, 39.6461, 39.6563, 39.6598, 39.6527, 39.6668, 39.6646, 39.6763, 39.6686, 39.6788, 39.68, 39.6822, 39.681, 39.683, 39.6872, 39.6858, 39.6907, 39.6908, 39.6748, 39.6913, 39.6724, 39.6949, 39.6954, 39.6951, 39.6948, 39.6836, 39.6952, 39.6962, 39.6942, 39.6973, 39.6881, 39.6944, 39.6984, 39.6913, 39.6928, 39.6968, 39.6965, 39.697, 39.6946, 39.6942, 39.696, 39.6918, 39.694, 39.6926, 39.6922, 39.6921, 39.6911, 39.6843, 39.6801, 39.684, 39.6871, 39.6866, 39.6785, 39.6825, 39.6858, 39.6824, 39.682, 39.6812, 39.665, 39.6775, 39.6772, 39.677, 39.6747, 39.6758, 39.6669, 39.6687, 39.6683, 39.6667, 39.6626, 39.6553, 39.6579, 39.6543, 39.6519, 39.6513, 39.6498, 39.6455, 39.6425, 39.6277, 39.6331, 39.6298, 39.6215, 39.614, 39.6125, 39.5901, 39.5964, 39.5861, 39.577, 39.5599, 39.5559, 39.5428, 39.5264, 39.5084, 39.4883, 39.4639, 39.4399, 39.4083, 39.3756, 39.3476, 39.3027, 39.2773, 39.2332, 39.1776, 39.147, 39.1022, 39.057, 39.0058, 38.9519, 38.9065, 38.8512, 38.7858, 38.7427, 38.6787, 38.6283, 38.5891, 38.5275, 38.4821, 38.4369, 38.3725, 38.3329, 38.2514, 38.2142 ] }, "content_curves": { "A": [ 0.0741749, 0.067564, 0.102788, 0.144703, 0.203802, 0.220508, 0.229974, 0.177654, 0.162685, 0.2629, 0.226097, 0.198088, 0.216041, 0.226058, 0.221487, 0.219325, 0.220748, 0.217604, 0.221425, 0.223607, 0.216397, 0.21481, 0.216199, 0.212924, 0.214718, 0.219841, 0.213674, 0.215398, 0.218922, 0.211382, 0.216174, 0.218617, 0.212376, 0.215475, 0.217986, 0.21299, 0.213276, 0.21762, 0.211887, 0.212839, 0.21633, 0.210967, 0.212124, 0.216941, 0.209954, 0.212423, 0.215574, 0.210474, 0.213146, 0.217109, 0.20884, 0.212521, 0.216378, 0.21012, 0.211206, 0.21563, 0.209185, 0.211286, 0.215695, 0.210854, 0.212217, 0.215297, 0.209652, 0.211163, 0.215854, 0.209557, 0.213315, 0.216091, 0.211275, 0.213403, 0.216202, 0.211404, 0.213709, 0.217576, 0.2113, 0.215446, 0.217916, 0.214056, 0.214402, 0.217707, 0.212584, 0.214893, 0.219532, 0.214189, 0.215519, 0.220757, 0.214441, 0.217828, 0.223321, 0.217113, 0.219525, 0.223397, 0.217582, 0.219553, 0.223757, 0.219307, 0.220871, 0.226855, 0.22181, 0.223253, 0.226928, 0.223189, 0.226457, 0.230161, 0.225449, 0.227003, 0.231694, 0.226151, 0.229076, 0.234102, 0.228299, 0.232024, 0.234953, 0.230655, 0.232938, 0.236484, 0.232463, 0.233984, 0.2384, 0.233641, 0.23533, 0.239158, 0.234868, 0.237028, 0.240072, 0.2354, 0.237696, 0.240118, 0.236072, 0.238575, 0.241589, 0.237379, 0.237931, 0.239759, 0.236515, 0.238306, 0.240698, 0.237286, 0.238801, 0.240487, 0.237139, 0.237873, 0.240116, 0.235836, 0.235797, 0.237429, 0.233359, 0.23393, 0.235929, 0.231684 ], "T": [ 0.072643, 0.365314, 0.250612, 0.228444, 0.277337, 0.291475, 0.415087, 0.384213, 0.378693, 0.304941, 0.242829, 0.276185, 0.279936, 0.285604, 0.278409, 0.269083, 0.269476, 0.265006, 0.253741, 0.267031, 0.265436, 0.260022, 0.27352, 0.267826, 0.25872, 0.266097, 0.263631, 0.255057, 0.26429, 0.260644, 0.252065, 0.261394, 0.261133, 0.250457, 0.260164, 0.258387, 0.250582, 0.258963, 0.257707, 0.251173, 0.26064, 0.261192, 0.252781, 0.261322, 0.259585, 0.250029, 0.257985, 0.258716, 0.249677, 0.259473, 0.256773, 0.248725, 0.258793, 0.25675, 0.248525, 0.256631, 0.256249, 0.248743, 0.255478, 0.256749, 0.247935, 0.255974, 0.255781, 0.247527, 0.254718, 0.25415, 0.244717, 0.254549, 0.254214, 0.247076, 0.254987, 0.255104, 0.246537, 0.255205, 0.252428, 0.244181, 0.252812, 0.25196, 0.246592, 0.25292, 0.252089, 0.244711, 0.25263, 0.251527, 0.243328, 0.251368, 0.251851, 0.242985, 0.250542, 0.250102, 0.24291, 0.250553, 0.249399, 0.24094, 0.248707, 0.246999, 0.23998, 0.245771, 0.246314, 0.237517, 0.244427, 0.244585, 0.236616, 0.243308, 0.242986, 0.235635, 0.242157, 0.241258, 0.235059, 0.241592, 0.239759, 0.232738, 0.237369, 0.237301, 0.230672, 0.23652, 0.236844, 0.230607, 0.236573, 0.236311, 0.2287, 0.23547, 0.234561, 0.228312, 0.233646, 0.233596, 0.227946, 0.235149, 0.234807, 0.22931, 0.236038, 0.237286, 0.232106, 0.239173, 0.24013, 0.235663, 0.241134, 0.242458, 0.238272, 0.244809, 0.245829, 0.242085, 0.248768, 0.249377, 0.246606, 0.254298, 0.255289, 0.252128, 0.25865, 0.2607 ], "C": [ 0.399877, 0.255014, 0.352975, 0.299492, 0.216623, 0.227473, 0.158045, 0.226672, 0.244812, 0.20041, 0.25473, 0.261093, 0.244406, 0.240747, 0.25275, 0.253023, 0.252052, 0.259247, 0.255498, 0.251921, 0.26267, 0.266563, 0.257801, 0.264766, 0.265782, 0.258026, 0.267236, 0.26891, 0.260588, 0.269867, 0.269415, 0.2617, 0.269385, 0.270931, 0.261533, 0.26953, 0.270707, 0.262227, 0.27082, 0.269911, 0.262348, 0.269327, 0.27007, 0.261987, 0.271394, 0.272717, 0.263727, 0.270902, 0.272306, 0.262022, 0.27313, 0.274214, 0.262536, 0.273655, 0.273459, 0.265304, 0.274226, 0.274304, 0.267054, 0.274097, 0.27404, 0.266976, 0.273726, 0.275119, 0.265703, 0.274328, 0.274896, 0.266159, 0.274238, 0.273129, 0.266532, 0.274738, 0.274784, 0.266236, 0.275949, 0.275824, 0.267527, 0.274571, 0.273768, 0.265257, 0.27267, 0.272498, 0.265272, 0.272956, 0.273543, 0.264672, 0.271591, 0.272947, 0.264941, 0.272617, 0.272308, 0.263358, 0.270793, 0.27213, 0.263947, 0.271179, 0.272385, 0.264786, 0.270548, 0.271943, 0.264617, 0.270691, 0.271003, 0.2628, 0.269941, 0.271029, 0.263307, 0.271718, 0.271673, 0.263011, 0.270545, 0.270477, 0.265537, 0.271404, 0.272014, 0.265132, 0.270441, 0.271459, 0.264317, 0.270338, 0.272083, 0.264763, 0.270578, 0.270688, 0.265079, 0.271096, 0.271257, 0.264943, 0.2704, 0.271273, 0.264793, 0.269323, 0.270835, 0.264133, 0.269278, 0.268531, 0.262894, 0.268373, 0.267741, 0.261997, 0.265652, 0.265821, 0.259465, 0.264028, 0.263542, 0.257825, 0.260978, 0.260462, 0.253578, 0.256882 ], "G": [ 0.453305, 0.312108, 0.293625, 0.32736, 0.302238, 0.260544, 0.196895, 0.211461, 0.21381, 0.231748, 0.276344, 0.264634, 0.259616, 0.247591, 0.247354, 0.258569, 0.257724, 0.258144, 0.269336, 0.257441, 0.255497, 0.258605, 0.252479, 0.254483, 0.260779, 0.256036, 0.255459, 0.260635, 0.2562, 0.258107, 0.262346, 0.258288, 0.257107, 0.263136, 0.260317, 0.259093, 0.265434, 0.26119, 0.259586, 0.266077, 0.260682, 0.258514, 0.265025, 0.259749, 0.259067, 0.264831, 0.262713, 0.259908, 0.264871, 0.261396, 0.261257, 0.264539, 0.262293, 0.259474, 0.26681, 0.262435, 0.260341, 0.265667, 0.261774, 0.2583, 0.265807, 0.261752, 0.260842, 0.266191, 0.263724, 0.261965, 0.267071, 0.263201, 0.260273, 0.266391, 0.262279, 0.258753, 0.26497, 0.260983, 0.260323, 0.264549, 0.261745, 0.259413, 0.265238, 0.264116, 0.262657, 0.267897, 0.262566, 0.261328, 0.26761, 0.263203, 0.262118, 0.26624, 0.261196, 0.260168, 0.265256, 0.262693, 0.262226, 0.267377, 0.263589, 0.262516, 0.266765, 0.262588, 0.261328, 0.267286, 0.264028, 0.261536, 0.265924, 0.26373, 0.261623, 0.266332, 0.262841, 0.260873, 0.264192, 0.261295, 0.261396, 0.264762, 0.262141, 0.26064, 0.264376, 0.261864, 0.260252, 0.263951, 0.260711, 0.259711, 0.263887, 0.260609, 0.259993, 0.263972, 0.261203, 0.259908, 0.263102, 0.25979, 0.258722, 0.260842, 0.25758, 0.256012, 0.259128, 0.256935, 0.254077, 0.257499, 0.255273, 0.251883, 0.255186, 0.252707, 0.251381, 0.254222, 0.251651, 0.250759, 0.254055, 0.250449, 0.250374, 0.25348, 0.251843, 0.250735 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.853182, 0.567122, 0.6466, 0.626852, 0.518861, 0.488017, 0.354939, 0.438133, 0.458622, 0.432159, 0.531073, 0.525727, 0.504022, 0.488338, 0.500104, 0.511592, 0.509776, 0.517391, 0.524833, 0.509362, 0.518167, 0.525168, 0.510281, 0.51925, 0.526561, 0.514062, 0.522695, 0.529546, 0.516787, 0.527974, 0.53176, 0.519989, 0.526491, 0.534067, 0.52185, 0.528623, 0.536141, 0.523417, 0.530406, 0.535988, 0.52303, 0.527841, 0.535095, 0.521737, 0.530461, 0.537548, 0.52644, 0.53081, 0.537177, 0.523418, 0.534387, 0.538753, 0.524829, 0.533129, 0.54027, 0.527739, 0.534566, 0.539971, 0.528827, 0.532397, 0.539848, 0.528729, 0.534567, 0.54131, 0.529428, 0.536293, 0.541967, 0.529361, 0.53451, 0.53952, 0.528811, 0.533492, 0.539754, 0.52722, 0.536272, 0.540373, 0.529272, 0.533984, 0.539006, 0.529373, 0.535327, 0.540395, 0.527838, 0.534284, 0.541153, 0.527875, 0.533708, 0.539187, 0.526138, 0.532785, 0.537565, 0.526051, 0.533019, 0.539508, 0.527536, 0.533694, 0.53915, 0.527374, 0.531876, 0.539229, 0.528645, 0.532227, 0.536927, 0.526531, 0.531564, 0.537361, 0.526148, 0.532591, 0.535865, 0.524305, 0.531941, 0.535239, 0.527678, 0.532045, 0.53639, 0.526996, 0.530694, 0.535409, 0.525028, 0.530048, 0.53597, 0.525371, 0.530571, 0.53466, 0.526282, 0.531004, 0.534358, 0.524733, 0.529122, 0.532115, 0.522373, 0.525335, 0.529963, 0.521068, 0.523355, 0.526031, 0.518168, 0.520255, 0.522927, 0.514704, 0.517032, 0.520043, 0.511116, 0.514787, 0.517597, 0.508273, 0.511352, 0.513942, 0.50542, 0.507616 ] }, "kmer_count": { "AAAAA": 1558964, "AAAAT": 1318159, "AAAAC": 1033442, "AAAAG": 1352496, "AAATA": 955222, "AAATT": 1183003, "AAATC": 1117266, "AAATG": 1149154, "AAACA": 1332951, "AAACT": 1287298, "AAACC": 845704, "AAACG": 363974, "AAAGA": 1453963, "AAAGT": 1241284, "AAAGC": 1303834, "AAAGG": 1358294, "AATAA": 888416, "AATAT": 825083, "AATAC": 622667, "AATAG": 689618, "AATTA": 525151, "AATTT": 1501905, "AATTC": 1252408, "AATTG": 716154, "AATCA": 1083927, "AATCT": 2281135, "AATCC": 1018155, "AATCG": 306144, "AATGA": 1190434, "AATGT": 1139816, "AATGC": 989350, "AATGG": 1205103, "AACAA": 981994, "AACAT": 1175627, "AACAC": 1109352, "AACAG": 1429712, "AACTA": 400864, "AACTT": 1468528, "AACTC": 3113266, "AACTG": 1510962, "AACCA": 1139875, "AACCT": 949885, "AACCC": 581443, "AACCG": 347042, "AACGA": 300647, "AACGT": 335416, "AACGC": 323670, "AACGG": 360299, "AAGAA": 1547493, "AAGAT": 1551566, "AAGAC": 969344, "AAGAG": 4556726, "AAGTA": 816652, "AAGTT": 1288791, "AAGTC": 1262332, "AAGTG": 1025280, "AAGCA": 1352970, "AAGCT": 1392038, "AAGCC": 1305410, "AAGCG": 569771, "AAGGA": 1401930, "AAGGT": 1251052, "AAGGC": 1521667, "AAGGG": 1280814, "ATAAA": 940804, "ATAAT": 800495, "ATAAC": 556235, "ATAAG": 638189, "ATATA": 520106, "ATATT": 936635, "ATATC": 785912, "ATATG": 553023, "ATACA": 761217, "ATACT": 833384, "ATACC": 543079, "ATACG": 218858, "ATAGA": 826921, "ATAGT": 720211, "ATAGC": 774026, "ATAGG": 672601, "ATTAA": 654170, "ATTAT": 602174, "ATTAC": 444456, "ATTAG": 484712, "ATTTA": 762403, "ATTTT": 2112897, "ATTTC": 1863899, "ATTTG": 1306083, "ATTCA": 1301829, "ATTCT": 1723855, "ATTCC": 1232795, "ATTCG": 432159, "ATTGA": 830167, "ATTGT": 932592, "ATTGC": 803067, "ATTGG": 956785, "ATCAA": 1236454, "ATCAT": 1707089, "ATCAC": 1210269, "ATCAG": 1540884, "ATCTA": 577312, "ATCTT": 2533424, "ATCTC": 1824542, "ATCTG": 2877965, "ATCCA": 1838764, "ATCCT": 1626435, "ATCCC": 938306, "ATCCG": 494517, "ATCGA": 379947, "ATCGT": 419225, "ATCGC": 352902, "ATCGG": 3659320, "ATGAA": 1288323, "ATGAT": 1366393, "ATGAC": 1083389, "ATGAG": 1409040, "ATGTA": 834078, "ATGTT": 1444346, "ATGTC": 1375685, "ATGTG": 1030190, "ATGCA": 1002993, "ATGCT": 1279015, "ATGCC": 1320047, "ATGCG": 540764, "ATGGA": 1291169, "ATGGT": 1543329, "ATGGC": 1829493, "ATGGG": 1211542, "ACAAA": 1279168, "ACAAT": 931638, "ACAAC": 714756, "ACAAG": 949461, "ACATA": 742738, "ACATT": 1237509, "ACATC": 1421778, "ACATG": 1127929, "ACACA": 2797882, "ACACT": 1107170, "ACACC": 1205288, "ACACG": 3217925, "ACAGA": 1673192, "ACAGT": 1229446, "ACAGC": 3274796, "ACAGG": 1782100, "ACTAA": 388347, "ACTAT": 409534, "ACTAC": 392340, "ACTAG": 425014, "ACTTA": 476085, "ACTTT": 1576961, "ACTTC": 1816410, "ACTTG": 1655724, "ACTCA": 1020071, "ACTCT": 1274902, "ACTCC": 3338611, "ACTCG": 739413, "ACTGA": 1316513, "ACTGT": 1438754, "ACTGC": 1671458, "ACTGG": 1822022, "ACCAA": 1077753, "ACCAT": 1162750, "ACCAC": 1701342, "ACCAG": 2001956, "ACCTA": 276606, "ACCTT": 1472700, "ACCTC": 1463709, "ACCTG": 1496453, "ACCCA": 1021322, "ACCCT": 831639, "ACCCC": 812480, "ACCCG": 565926, "ACCGA": 401323, "ACCGT": 428580, "ACCGC": 673926, "ACCGG": 488721, "ACGAA": 522959, "ACGAT": 528899, "ACGAC": 383087, "ACGAG": 556917, "ACGTA": 338247, "ACGTT": 533515, "ACGTC": 2990026, "ACGTG": 538146, "ACGCA": 455918, "ACGCT": 589963, "ACGCC": 630631, "ACGCG": 311336, "ACGGA": 535532, "ACGGT": 563797, "ACGGC": 874143, "ACGGG": 670724, "AGAAA": 1511756, "AGAAT": 1096390, "AGAAC": 1128818, "AGAAG": 2074703, "AGATA": 698859, "AGATT": 1004151, "AGATC": 4511733, "AGATG": 1730980, "AGACA": 1287960, "AGACT": 1006578, "AGACC": 909732, "AGACG": 647974, "AGAGA": 1909058, "AGAGT": 1044997, "AGAGC": 4522091, "AGAGG": 1828636, "AGTAA": 755955, "AGTAT": 570417, "AGTAC": 675750, "AGTAG": 1030778, "AGTTA": 513256, "AGTTT": 1566424, "AGTTC": 1412869, "AGTTG": 1320758, "AGTCA": 2954344, "AGTCT": 1341231, "AGTCC": 1318530, "AGTCG": 528808, "AGTGA": 1130070, "AGTGT": 967797, "AGTGC": 1141379, "AGTGG": 1449034, "AGCAA": 1431571, "AGCAT": 1496501, "AGCAC": 4466983, "AGCAG": 3354960, "AGCTA": 503966, "AGCTT": 2128914, "AGCTC": 3522361, "AGCTG": 3094492, "AGCCA": 2217669, "AGCCT": 1750917, "AGCCC": 1589987, "AGCCG": 1153248, "AGCGA": 594687, "AGCGT": 565853, "AGCGC": 942448, "AGCGG": 1036142, "AGGAA": 1960763, "AGGAT": 1522154, "AGGAC": 1385702, "AGGAG": 2536355, "AGGTA": 1073416, "AGGTT": 1379276, "AGGTC": 1720214, "AGGTG": 1981350, "AGGCA": 1890848, "AGGCT": 1924730, "AGGCC": 1963387, "AGGCG": 1185799, "AGGGA": 1564751, "AGGGT": 1461855, "AGGGC": 2116829, "AGGGG": 1852647, "TAAAA": 987054, "TAAAT": 771711, "TAAAC": 602170, "TAAAG": 831232, "TAATA": 569597, "TAATT": 773985, "TAATC": 664741, "TAATG": 712735, "TAACA": 757599, "TAACT": 674064, "TAACC": 459508, "TAACG": 200991, "TAAGA": 701871, "TAAGT": 591907, "TAAGC": 520378, "TAAGG": 646165, "TATAA": 503540, "TATAT": 473027, "TATAC": 381141, "TATAG": 467800, "TATTA": 465304, "TATTT": 1268822, "TATTC": 801245, "TATTG": 658285, "TATCA": 818465, "TATCT": 984039, "TATCC": 689378, "TATCG": 218187, "TATGA": 524916, "TATGT": 526492, "TATGC": 432974, "TATGG": 520843, "TACAA": 667852, "TACAT": 710855, "TACAC": 600398, "TACAG": 1003368, "TACTA": 330495, "TACTT": 1160831, "TACTC": 755390, "TACTG": 1028667, "TACCA": 836600, "TACCT": 645993, "TACCC": 443010, "TACCG": 222432, "TACGA": 232370, "TACGT": 220005, "TACGC": 197354, "TACGG": 290361, "TAGAA": 886790, "TAGAT": 1214249, "TAGAC": 488116, "TAGAG": 836723, "TAGTA": 541962, "TAGTT": 797051, "TAGTC": 664553, "TAGTG": 634399, "TAGCA": 936245, "TAGCT": 970186, "TAGCC": 861999, "TAGCG": 394808, "TAGGA": 836835, "TAGGT": 726084, "TAGGC": 769591, "TAGGG": 753318, "TTAAA": 980857, "TTAAT": 819710, "TTAAC": 558932, "TTAAG": 668718, "TTATA": 593671, "TTATT": 1007301, "TTATC": 855946, "TTATG": 503452, "TTACA": 690925, "TTACT": 731680, "TTACC": 537571, "TTACG": 230811, "TTAGA": 679184, "TTAGT": 539652, "TTAGC": 731392, "TTAGG": 665715, "TTTAA": 1149576, "TTTAT": 1169557, "TTTAC": 818199, "TTTAG": 960109, "TTTTA": 1388018, "TTTTT": 6220205, "TTTTC": 3287067, "TTTTG": 2220727, "TTTCA": 2425417, "TTTCT": 3855839, "TTTCC": 2560110, "TTTCG": 653784, "TTTGA": 1561768, "TTTGT": 1887645, "TTTGC": 1842235, "TTTGG": 2039910, "TTCAA": 1821984, "TTCAT": 2602719, "TTCAC": 1966867, "TTCAG": 2683333, "TTCTA": 969334, "TTCTT": 5162987, "TTCTC": 3342208, "TTCTG": 3348826, "TTCCA": 2809728, "TTCCT": 2968708, "TTCCC": 1770953, "TTCCG": 934062, "TTCGA": 524906, "TTCGT": 529474, "TTCGC": 445787, "TTCGG": 769204, "TTGAA": 1593494, "TTGAT": 1726042, "TTGAC": 1080597, "TTGAG": 1614031, "TTGTA": 1276691, "TTGTT": 2095911, "TTGTC": 1815391, "TTGTG": 1344197, "TTGCA": 1409041, "TTGCT": 2112686, "TTGCC": 1745266, "TTGCG": 798751, "TTGGA": 1679785, "TTGGT": 1913607, "TTGGC": 2346262, "TTGGG": 1782690, "TCAAA": 1839846, "TCAAT": 2454638, "TCAAC": 973093, "TCAAG": 1151829, "TCATA": 1260320, "TCATT": 1788653, "TCATC": 2969361, "TCATG": 1691317, "TCACA": 3156422, "TCACT": 1657511, "TCACC": 1664678, "TCACG": 825288, "TCAGA": 1862211, "TCAGT": 1487067, "TCAGC": 2627013, "TCAGG": 2441438, "TCTAA": 665935, "TCTAT": 632505, "TCTAC": 680555, "TCTAG": 784033, "TCTTA": 925735, "TCTTT": 3411696, "TCTTC": 5158418, "TCTTG": 3198423, "TCTCA": 1887601, "TCTCT": 2634646, "TCTCC": 3272010, "TCTCG": 1223216, "TCTGA": 4337581, "TCTGT": 2287036, "TCTGC": 2891951, "TCTGG": 3674040, "TCCAA": 1802990, "TCCAT": 2255442, "TCCAC": 2758307, "TCCAG": 5682403, "TCCTA": 495954, "TCCTT": 3197110, "TCCTC": 4000344, "TCCTG": 2951072, "TCCCA": 1887662, "TCCCT": 1440501, "TCCCC": 1573361, "TCCCG": 1324534, "TCCGA": 671898, "TCCGT": 683386, "TCCGC": 1068298, "TCCGG": 1078495, "TCGAA": 659851, "TCGAT": 709117, "TCGAC": 373207, "TCGAG": 635699, "TCGTA": 477759, "TCGTT": 672297, "TCGTC": 952237, "TCGTG": 566272, "TCGCA": 483897, "TCGCT": 853275, "TCGCC": 786943, "TCGCG": 394557, "TCGGA": 3892722, "TCGGT": 740241, "TCGGC": 1126816, "TCGGG": 984523, "TGAAA": 1329550, "TGAAT": 1194630, "TGAAC": 3274484, "TGAAG": 2376104, "TGATA": 877226, "TGATT": 1168675, "TGATC": 1399893, "TGATG": 2359322, "TGACA": 1438481, "TGACT": 1242887, "TGACC": 1154404, "TGACG": 737216, "TGAGA": 1683682, "TGAGT": 1129187, "TGAGC": 1780692, "TGAGG": 2180017, "TGTAA": 999280, "TGTAT": 742613, "TGTAC": 915608, "TGTAG": 1610331, "TGTTA": 680244, "TGTTT": 2127764, "TGTTC": 1891071, "TGTTG": 2196818, "TGTCA": 1772359, "TGTCT": 1943450, "TGTCC": 1938768, "TGTCG": 788371, "TGTGA": 1276289, "TGTGT": 1438529, "TGTGC": 1426843, "TGTGG": 1901411, "TGCAA": 1167920, "TGCAT": 1380884, "TGCAC": 1371481, "TGCAG": 2879804, "TGCTA": 662589, "TGCTT": 2393107, "TGCTC": 2274063, "TGCTG": 3995536, "TGCCA": 2341262, "TGCCT": 1785395, "TGCCC": 1796378, "TGCCG": 1210946, "TGCGA": 458955, "TGCGT": 541466, "TGCGC": 864529, "TGCGG": 1173515, "TGGAA": 1947101, "TGGAT": 1664907, "TGGAC": 1342239, "TGGAG": 2673112, "TGGTA": 1191923, "TGGTT": 1701465, "TGGTC": 1905528, "TGGTG": 2946620, "TGGCA": 2435518, "TGGCT": 2565799, "TGGCC": 2659199, "TGGCG": 1345246, "TGGGA": 1794094, "TGGGT": 1646519, "TGGGC": 2412404, "TGGGG": 3072634, "CAAAA": 1502297, "CAAAT": 1288183, "CAAAC": 1259894, "CAAAG": 1949106, "CAATA": 814731, "CAATT": 1048310, "CAATC": 1958954, "CAATG": 1610700, "CAACA": 1350070, "CAACT": 1128659, "CAACC": 804608, "CAACG": 348369, "CAAGA": 1361040, "CAAGT": 1031145, "CAAGC": 990371, "CAAGG": 1305183, "CATAA": 884354, "CATAT": 878389, "CATAC": 792213, "CATAG": 1198788, "CATTA": 784255, "CATTT": 1914438, "CATTC": 1562057, "CATTG": 1490688, "CATCA": 2600155, "CATCT": 2779106, "CATCC": 2061693, "CATCG": 674081, "CATGA": 1455015, "CATGT": 1400693, "CATGC": 1211384, "CATGG": 2015150, "CACAA": 1334848, "CACAT": 1595462, "CACAC": 5649659, "CACAG": 3951773, "CACTA": 573217, "CACTT": 1650011, "CACTC": 1447802, "CACTG": 2432456, "CACCA": 2773861, "CACCT": 2078032, "CACCC": 1249681, "CACCG": 943221, "CACGA": 839208, "CACGT": 3414732, "CACGC": 820783, "CACGG": 1243472, "CAGAA": 1904178, "CAGAT": 2747210, "CAGAC": 1323471, "CAGAG": 2348070, "CAGTA": 1020446, "CAGTT": 1664329, "CAGTC": 3148507, "CAGTG": 1961267, "CAGCA": 3998343, "CAGCT": 4961450, "CAGCC": 2799744, "CAGCG": 1353162, "CAGGA": 2962830, "CAGGT": 2545566, "CAGGC": 2646018, "CAGGG": 3008156, "CTAAA": 563381, "CTAAT": 414953, "CTAAC": 340845, "CTAAG": 487555, "CTATA": 345979, "CTATT": 514349, "CTATC": 493041, "CTATG": 470442, "CTACA": 588515, "CTACT": 634643, "CTACC": 488970, "CTACG": 229298, "CTAGA": 724787, "CTAGT": 387423, "CTAGC": 461142, "CTAGG": 567896, "CTTAA": 746608, "CTTAT": 712105, "CTTAC": 509022, "CTTAG": 752122, "CTTTA": 1291934, "CTTTT": 2874507, "CTTTC": 2576630, "CTTTG": 2478650, "CTTCA": 3823358, "CTTCT": 5177124, "CTTCC": 3122774, "CTTCG": 836676, "CTTGA": 2208411, "CTTGT": 2276194, "CTTGC": 2156838, "CTTGG": 3077540, "CTCAA": 2369806, "CTCAT": 1937533, "CTCAC": 1289549, "CTCAG": 2446719, "CTCTA": 775277, "CTCTT": 2895722, "CTCTC": 2201392, "CTCTG": 2942355, "CTCCA": 5752848, "CTCCT": 4108288, "CTCCC": 2072696, "CTCCG": 1358591, "CTCGA": 892373, "CTCGT": 1056847, "CTCGC": 1055857, "CTCGG": 1611081, "CTGAA": 4203076, "CTGAT": 1520630, "CTGAC": 1287945, "CTGAG": 2364156, "CTGTA": 1412628, "CTGTT": 2019347, "CTGTC": 2009968, "CTGTG": 2362279, "CTGCA": 3094905, "CTGCT": 4157349, "CTGCC": 2683245, "CTGCG": 1089774, "CTGGA": 2991393, "CTGGT": 2501354, "CTGGC": 2747782, "CTGGG": 4055551, "CCAAA": 1639502, "CCAAT": 1098402, "CCAAC": 1103252, "CCAAG": 1512260, "CCATA": 990788, "CCATT": 1522489, "CCATC": 2051455, "CCATG": 1999722, "CCACA": 2508317, "CCACT": 1946873, "CCACC": 2599969, "CCACG": 1408114, "CCAGA": 2605648, "CCAGT": 3560044, "CCAGC": 3482692, "CCAGG": 3727855, "CCTAA": 315847, "CCTAT": 330203, "CCTAC": 356710, "CCTAG": 440844, "CCTTA": 743008, "CCTTT": 2077052, "CCTTC": 2991954, "CCTTG": 2595138, "CCTCA": 2180520, "CCTCT": 2486891, "CCTCC": 3452927, "CCTCG": 1501671, "CCTGA": 1612433, "CCTGT": 1628512, "CCTGC": 2446331, "CCTGG": 2968400, "CCCAA": 1113429, "CCCAT": 1340494, "CCCAC": 1715960, "CCCAG": 2643298, "CCCTA": 317432, "CCCTT": 1481249, "CCCTC": 1681235, "CCCTG": 1834293, "CCCCA": 1840104, "CCCCT": 1253632, "CCCCC": 1370258, "CCCCG": 1301699, "CCCGA": 862965, "CCCGT": 740190, "CCCGC": 1453307, "CCCGG": 1523238, "CCGAA": 578540, "CCGAT": 481120, "CCGAC": 633852, "CCGAG": 1039295, "CCGTA": 403905, "CCGTT": 587799, "CCGTC": 877722, "CCGTG": 915186, "CCGCA": 1046684, "CCGCT": 1265194, "CCGCC": 2569945, "CCGCG": 946474, "CCGGA": 957504, "CCGGT": 803446, "CCGGC": 1436190, "CCGGG": 1579604, "CGAAA": 324912, "CGAAT": 411407, "CGAAC": 506635, "CGAAG": 949886, "CGATA": 254129, "CGATT": 331716, "CGATC": 615350, "CGATG": 1097837, "CGACA": 480413, "CGACT": 497249, "CGACC": 503732, "CGACG": 395393, "CGAGA": 800043, "CGAGT": 495710, "CGAGC": 744488, "CGAGG": 1005176, "CGTAA": 258502, "CGTAT": 234341, "CGTAC": 408688, "CGTAG": 665568, "CGTTA": 149191, "CGTTT": 609134, "CGTTC": 766587, "CGTTG": 778315, "CGTCA": 704531, "CGTCT": 3213254, "CGTCC": 1021125, "CGTCG": 582665, "CGTGA": 528858, "CGTGT": 556466, "CGTGC": 693155, "CGTGG": 1046246, "CGCAA": 321201, "CGCAT": 444069, "CGCAC": 725801, "CGCAG": 1329066, "CGCTA": 146010, "CGCTT": 960762, "CGCTC": 1224898, "CGCTG": 1485193, "CGCCA": 1108309, "CGCCT": 1033337, "CGCCC": 1168008, "CGCCG": 1940573, "CGCGA": 305566, "CGCGT": 348634, "CGCGC": 785086, "CGCGG": 1022242, "CGGAA": 3805609, "CGGAT": 760027, "CGGAC": 628372, "CGGAG": 1111801, "CGGTA": 465289, "CGGTT": 563695, "CGGTC": 931860, "CGGTG": 1109853, "CGGCA": 988519, "CGGCT": 1182034, "CGGCC": 1811119, "CGGCG": 1462380, "CGGGA": 934918, "CGGGT": 754329, "CGGGC": 1454176, "CGGGG": 1652804, "GAAAA": 1238068, "GAAAT": 1043872, "GAAAC": 950607, "GAAAG": 1252948, "GAATA": 697937, "GAATT": 1005662, "GAATC": 1011900, "GAATG": 1069224, "GAACA": 1277059, "GAACT": 3485301, "GAACC": 919961, "GAACG": 410516, "GAAGA": 5204510, "GAAGT": 1547588, "GAAGC": 1823479, "GAAGG": 2168675, "GATAA": 664887, "GATAT": 627505, "GATAC": 567727, "GATAG": 648514, "GATTA": 413870, "GATTT": 1367078, "GATTC": 1084092, "GATTG": 663355, "GATCA": 1200896, "GATCT": 1829709, "GATCC": 1125123, "GATCG": 3670822, "GATGA": 1990018, "GATGT": 1632328, "GATGC": 1516624, "GATGG": 2141325, "GACAA": 907398, "GACAT": 1068292, "GACAC": 1107384, "GACAG": 1657023, "GACTA": 316089, "GACTT": 1264679, "GACTC": 1130230, "GACTG": 1289686, "GACCA": 1205247, "GACCT": 1038643, "GACCC": 952960, "GACCG": 474097, "GACGA": 627151, "GACGT": 501834, "GACGC": 649577, "GACGG": 747527, "GAGAA": 1489422, "GAGAT": 2509182, "GAGAC": 1082918, "GAGAG": 1654002, "GAGTA": 659896, "GAGTT": 1072929, "GAGTC": 1139928, "GAGTG": 1073093, "GAGCA": 4548998, "GAGCT": 1994114, "GAGCC": 1745664, "GAGCG": 817674, "GAGGA": 2215610, "GAGGT": 1642605, "GAGGC": 2029310, "GAGGG": 1934840, "GTAAA": 722592, "GTAAT": 696470, "GTAAC": 644102, "GTAAG": 677001, "GTATA": 372766, "GTATT": 745886, "GTATC": 585555, "GTATG": 484941, "GTACA": 954816, "GTACT": 1089238, "GTACC": 586314, "GTACG": 265173, "GTAGA": 1217488, "GTAGT": 1004068, "GTAGC": 1209150, "GTAGG": 1192233, "GTTAA": 492915, "GTTAT": 484825, "GTTAC": 426656, "GTTAG": 431153, "GTTTA": 673738, "GTTTT": 2274536, "GTTTC": 1795445, "GTTTG": 1352207, "GTTCA": 1554016, "GTTCT": 2101252, "GTTCC": 1580948, "GTTCG": 350452, "GTTGA": 1439188, "GTTGT": 1462475, "GTTGC": 1283159, "GTTGG": 1669330, "GTCAA": 1067475, "GTCAT": 1492233, "GTCAC": 2919538, "GTCAG": 1784223, "GTCTA": 452146, "GTCTT": 2142384, "GTCTC": 1667218, "GTCTG": 4147608, "GTCCA": 2197053, "GTCCT": 1963927, "GTCCC": 1454470, "GTCCG": 722654, "GTCGA": 592518, "GTCGT": 672039, "GTCGC": 674368, "GTCGG": 776397, "GTGAA": 1171921, "GTGAT": 1207597, "GTGAC": 1137383, "GTGAG": 1405948, "GTGTA": 753732, "GTGTT": 1367762, "GTGTC": 1259903, "GTGTG": 1315490, "GTGCA": 1319911, "GTGCT": 1800520, "GTGCC": 1399168, "GTGCG": 615594, "GTGGA": 1682612, "GTGGT": 1802895, "GTGGC": 2092385, "GTGGG": 1887007, "GCAAA": 1262161, "GCAAT": 1011604, "GCAAC": 851898, "GCAAG": 1090177, "GCATA": 765771, "GCATT": 1212250, "GCATC": 1680673, "GCATG": 1269628, "GCACA": 4265339, "GCACT": 1396640, "GCACC": 1569227, "GCACG": 927263, "GCAGA": 2226248, "GCAGT": 1589107, "GCAGC": 3808857, "GCAGG": 3192902, "GCTAA": 429627, "GCTAT": 441791, "GCTAC": 502937, "GCTAG": 485203, "GCTTA": 555759, "GCTTT": 2057224, "GCTTC": 2841546, "GCTTG": 2155582, "GCTCA": 2937544, "GCTCT": 2236996, "GCTCC": 2996829, "GCTCG": 1046733, "GCTGA": 2147491, "GCTGT": 2373848, "GCTGC": 3948922, "GCTGG": 3652016, "GCCAA": 1367039, "GCCAT": 1796007, "GCCAC": 2264752, "GCCAG": 3094511, "GCCTA": 341739, "GCCTT": 2190011, "GCCTC": 2354474, "GCCTG": 2274935, "GCCCA": 1998556, "GCCCT": 1695582, "GCCCC": 1898326, "GCCCG": 1318835, "GCCGA": 800931, "GCCGT": 921239, "GCCGC": 2631697, "GCCGG": 1644868, "GCGAA": 435926, "GCGAT": 579474, "GCGAC": 487289, "GCGAG": 815776, "GCGTA": 346743, "GCGTT": 503024, "GCGTC": 751922, "GCGTG": 791331, "GCGCA": 841093, "GCGCT": 1103950, "GCGCC": 1250790, "GCGCG": 810526, "GCGGA": 984000, "GCGGT": 941083, "GCGGC": 1973610, "GCGGG": 1461295, "GGAAA": 1333302, "GGAAT": 1093576, "GGAAC": 1259706, "GGAAG": 5433883, "GGATA": 685050, "GGATT": 1030781, "GGATC": 1371868, "GGATG": 2106797, "GGACA": 1544519, "GGACT": 1262951, "GGACC": 1101183, "GGACG": 743069, "GGAGA": 2381219, "GGAGT": 1287192, "GGAGC": 2138726, "GGAGG": 2812609, "GGTAA": 718929, "GGTAT": 633888, "GGTAC": 885058, "GGTAG": 1299167, "GGTTA": 481928, "GGTTT": 1778218, "GGTTC": 1457017, "GGTTG": 1496561, "GGTCA": 1818449, "GGTCT": 1871309, "GGTCC": 1886465, "GGTCG": 739140, "GGTGA": 1945935, "GGTGT": 1705538, "GGTGC": 1814155, "GGTGG": 2915620, "GGCAA": 1308008, "GGCAT": 1607997, "GGCAC": 1651553, "GGCAG": 3256298, "GGCTA": 544164, "GGCTT": 2103169, "GGCTC": 2204870, "GGCTG": 3479753, "GGCCA": 2789243, "GGCCT": 2489714, "GGCCC": 2244250, "GGCCG": 1633042, "GGCGA": 960308, "GGCGT": 929972, "GGCGC": 1412592, "GGCGG": 2090201, "GGGAA": 1464085, "GGGAT": 1228816, "GGGAC": 1276386, "GGGAG": 2260383, "GGGTA": 776627, "GGGTT": 1540825, "GGGTC": 1682628, "GGGTG": 2238272, "GGGCA": 2409390, "GGGCT": 2534934, "GGGCC": 2576366, "GGGCG": 1301571, "GGGGA": 1837804, "GGGGT": 2307947, "GGGGC": 2680687, "GGGGG": 3873313 }, "overrepresented_sequences": {} }, "read2_before_filtering": { "total_reads": 10000000, "total_bases": 1500000000, "q20_bases": 1482009250, "q30_bases": 1453828999, "total_cycles": 150, "quality_curves": { "A": [ 38.0776, 38.9394, 39.1105, 39.4012, 39.3947, 39.4488, 39.4275, 39.4527, 39.4939, 39.5301, 39.5384, 39.5597, 39.5807, 39.5662, 39.5221, 39.5619, 39.5835, 39.6083, 39.6003, 39.6267, 39.6137, 39.6315, 39.637, 39.6405, 39.6315, 39.4974, 39.503, 39.5027, 39.4854, 39.5139, 39.4531, 39.4987, 39.5363, 39.5413, 39.5209, 39.4917, 39.514, 39.537, 39.5158, 39.5357, 39.5443, 39.5407, 39.51, 39.5376, 39.5456, 39.3704, 39.5433, 39.552, 39.5249, 39.5497, 39.5511, 39.5452, 39.5514, 39.5526, 39.5346, 39.5499, 39.5064, 39.5522, 39.56, 39.5212, 39.5534, 39.5228, 39.5381, 39.5356, 39.5358, 39.5509, 39.5476, 39.5513, 39.5549, 39.4828, 39.5202, 39.5237, 39.5439, 39.5269, 39.5286, 39.5406, 39.5441, 39.5416, 39.5339, 39.5334, 39.4934, 39.4308, 39.5263, 39.5035, 39.5194, 39.5034, 39.439, 39.5084, 39.5054, 39.4999, 39.4959, 39.4781, 39.4865, 39.4587, 39.4707, 39.4491, 39.4443, 39.4327, 39.4308, 39.3839, 39.4057, 39.3873, 39.364, 39.3665, 39.3378, 39.3283, 39.3044, 39.3073, 39.2782, 39.2637, 39.2496, 39.2039, 39.213, 39.1542, 39.1564, 39.1467, 39.1392, 39.1063, 39.0966, 39.0735, 39.0422, 39.0172, 39.0095, 38.9647, 38.9598, 38.8906, 38.892, 38.8993, 38.8992, 38.8458, 38.7933, 38.83, 38.8163, 38.7982, 38.7917, 38.7633, 38.7548, 38.7506, 38.702, 38.6907, 38.69, 38.6242, 38.6799, 38.6364, 38.6286, 38.6289, 38.5886, 38.5766, 38.573, 38.543 ], "T": [ 38.7595, 39.4593, 39.5894, 39.6433, 39.6807, 39.7011, 39.7367, 39.7256, 39.7407, 39.7399, 39.7455, 39.7569, 39.7626, 39.7602, 39.7697, 39.7741, 39.7719, 39.782, 39.789, 39.784, 39.7863, 39.7925, 39.7952, 39.7957, 39.8007, 39.6322, 39.6422, 39.6458, 39.6441, 39.6541, 39.6597, 39.6618, 39.6635, 39.6712, 39.6695, 39.672, 39.679, 39.6757, 39.6802, 39.682, 39.6831, 39.6843, 39.6872, 39.6923, 39.6934, 39.6948, 39.695, 39.7011, 39.7009, 39.6958, 39.702, 39.7058, 39.7044, 39.7065, 39.7064, 39.7061, 39.7115, 39.7104, 39.7053, 39.7106, 39.7112, 39.7089, 39.7107, 39.7114, 39.7079, 39.7076, 39.7094, 39.7108, 39.715, 39.7126, 39.7115, 39.7131, 39.7065, 39.7039, 39.7084, 39.7085, 39.7048, 39.7101, 39.7033, 39.6984, 39.7026, 39.6953, 39.6934, 39.6962, 39.6906, 39.6852, 39.6863, 39.6804, 39.6709, 39.6745, 39.6683, 39.6602, 39.6573, 39.6458, 39.6381, 39.6389, 39.6292, 39.6211, 39.6145, 39.6097, 39.5977, 39.5942, 39.5888, 39.5704, 39.5745, 39.5472, 39.5439, 39.541, 39.5255, 39.5089, 39.4944, 39.4932, 39.4784, 39.4548, 39.4514, 39.4371, 39.4122, 39.3929, 39.3713, 39.3736, 39.3539, 39.3327, 39.3271, 39.2969, 39.3029, 39.2926, 39.2814, 39.2446, 39.2553, 39.2407, 39.2087, 39.2201, 39.2129, 39.1885, 39.1697, 39.1698, 39.1478, 39.1608, 39.1395, 39.1262, 39.1271, 39.1433, 39.0926, 39.1324, 39.1081, 39.1, 39.1165, 39.1026, 39.0991, 39.1093 ], "C": [ 37.5663, 39.025, 39.2338, 39.3938, 39.5228, 39.5251, 39.5611, 39.5871, 39.6112, 39.6504, 39.6861, 39.6804, 39.6841, 39.6813, 39.6919, 39.7018, 39.708, 39.7008, 39.7173, 39.7174, 39.7111, 39.7208, 39.7189, 39.713, 39.7164, 39.5328, 39.5293, 39.5387, 39.5317, 39.5225, 39.5362, 39.5413, 39.5361, 39.5443, 39.546, 39.5367, 39.5436, 39.538, 39.5244, 39.538, 39.5313, 39.5233, 39.538, 39.5313, 39.5247, 39.53, 39.5284, 39.5293, 39.534, 39.5307, 39.5229, 39.5355, 39.5295, 39.5233, 39.5319, 39.5255, 39.5253, 39.5346, 39.5293, 39.5243, 39.5266, 39.5293, 39.5222, 39.5266, 39.5285, 39.5184, 39.5252, 39.5267, 39.5157, 39.5231, 39.5244, 39.5122, 39.5227, 39.5187, 39.5124, 39.5141, 39.5154, 39.5085, 39.5133, 39.5114, 39.5012, 39.5082, 39.5097, 39.4961, 39.504, 39.4996, 39.4955, 39.497, 39.499, 39.4865, 39.4937, 39.4943, 39.482, 39.4975, 39.4891, 39.4761, 39.4888, 39.4793, 39.4704, 39.4736, 39.4678, 39.4666, 39.4658, 39.4554, 39.447, 39.4523, 39.4439, 39.4216, 39.4282, 39.42, 39.4018, 39.3963, 39.388, 39.3673, 39.3828, 39.3594, 39.337, 39.3462, 39.3248, 39.3009, 39.2911, 39.2865, 39.2587, 39.2643, 39.2429, 39.2171, 39.2104, 39.1882, 39.1563, 39.1507, 39.1267, 39.0818, 39.0777, 39.0441, 39.0148, 38.9925, 38.9581, 38.92, 38.9174, 38.8637, 38.8221, 38.8161, 38.7627, 38.7273, 38.7167, 38.6855, 38.6366, 38.6194, 38.5844, 38.5299 ], "G": [ 39.3398, 39.3324, 39.1531, 39.354, 39.3624, 39.2846, 39.3674, 39.3417, 39.3708, 39.3973, 39.4674, 39.4532, 39.4687, 39.4597, 39.4532, 39.4814, 39.4825, 39.4817, 39.5154, 39.5034, 39.4943, 39.5054, 39.5134, 39.5035, 39.5189, 39.2572, 39.2414, 39.2713, 39.2757, 39.2614, 39.2844, 39.2918, 39.2749, 39.3053, 39.3049, 39.2868, 39.315, 39.3175, 39.3043, 39.3268, 39.3339, 39.317, 39.3348, 39.3389, 39.3247, 39.3351, 39.3504, 39.3348, 39.3542, 39.3586, 39.3435, 39.3691, 39.3716, 39.3543, 39.3726, 39.3755, 39.3639, 39.3809, 39.3823, 39.3692, 39.3884, 39.3936, 39.3754, 39.3925, 39.3964, 39.3829, 39.3966, 39.3995, 39.3797, 39.3975, 39.3979, 39.3877, 39.4054, 39.4042, 39.3904, 39.4056, 39.4001, 39.3883, 39.4029, 39.4029, 39.3878, 39.4001, 39.3988, 39.3837, 39.3998, 39.405, 39.3844, 39.3966, 39.3957, 39.3749, 39.3879, 39.3819, 39.3618, 39.3686, 39.3614, 39.3402, 39.3482, 39.3411, 39.3121, 39.3225, 39.3051, 39.2755, 39.2817, 39.2658, 39.2387, 39.2316, 39.2133, 39.1888, 39.1758, 39.1685, 39.1228, 39.1179, 39.1014, 39.0498, 39.0625, 39.0141, 38.9886, 38.9763, 38.9534, 38.9301, 38.9237, 38.8959, 38.8535, 38.8347, 38.8384, 38.7722, 38.7952, 38.7707, 38.7299, 38.7421, 38.7465, 38.7022, 38.7202, 38.7265, 38.6939, 38.7087, 38.7116, 38.6927, 38.7048, 38.7282, 38.7008, 38.7341, 38.7379, 38.7257, 38.747, 38.7662, 38.7316, 38.7588, 38.7749, 38.7601 ], "mean": [ 38.4185, 39.2229, 39.2835, 39.4314, 39.4671, 39.4764, 39.5327, 39.5338, 39.5603, 39.5685, 39.5972, 39.6059, 39.617, 39.6093, 39.6031, 39.6217, 39.6267, 39.6344, 39.6436, 39.6471, 39.6439, 39.6544, 39.6577, 39.6568, 39.6585, 39.4681, 39.4712, 39.4782, 39.4725, 39.4797, 39.472, 39.486, 39.4947, 39.5032, 39.4975, 39.4878, 39.5007, 39.5043, 39.497, 39.5085, 39.5103, 39.5072, 39.5055, 39.5122, 39.5132, 39.4713, 39.5167, 39.5199, 39.5164, 39.5213, 39.5208, 39.5267, 39.5266, 39.5249, 39.5242, 39.5264, 39.5172, 39.5324, 39.5319, 39.5221, 39.5327, 39.5263, 39.5274, 39.5297, 39.5298, 39.5308, 39.533, 39.5347, 39.5323, 39.5174, 39.5261, 39.5247, 39.5333, 39.5265, 39.5258, 39.5308, 39.529, 39.5277, 39.5271, 39.5248, 39.5116, 39.4976, 39.5201, 39.5104, 39.5172, 39.5119, 39.4915, 39.5095, 39.5066, 39.4997, 39.5005, 39.4921, 39.4878, 39.482, 39.4784, 39.4662, 39.4666, 39.4567, 39.4471, 39.436, 39.4315, 39.42, 39.4127, 39.4012, 39.387, 39.3765, 39.3611, 39.3518, 39.3369, 39.3243, 39.3026, 39.2861, 39.2771, 39.2392, 39.2453, 39.2185, 39.2012, 39.1855, 39.165, 39.1498, 39.1317, 39.1094, 39.0901, 39.0667, 39.0609, 39.0176, 39.0199, 38.9997, 38.9853, 38.9695, 38.9427, 38.9342, 38.9322, 38.915, 38.8956, 38.8865, 38.8715, 38.8614, 38.8465, 38.8345, 38.8193, 38.8139, 38.8055, 38.7932, 38.7896, 38.786, 38.76, 38.7582, 38.7529, 38.733 ] }, "content_curves": { "A": [ 0.146048, 0.158573, 0.237537, 0.261531, 0.298147, 0.336474, 0.214675, 0.219111, 0.212689, 0.291406, 0.233213, 0.218521, 0.231202, 0.243342, 0.253986, 0.241481, 0.251419, 0.265869, 0.254586, 0.257671, 0.26184, 0.245143, 0.248473, 0.256219, 0.243673, 0.25116, 0.25634, 0.241696, 0.248253, 0.254219, 0.241828, 0.248639, 0.25549, 0.243024, 0.248797, 0.255372, 0.242966, 0.250128, 0.255971, 0.242602, 0.249728, 0.254651, 0.242664, 0.247486, 0.254153, 0.242669, 0.247688, 0.253802, 0.241619, 0.248036, 0.254002, 0.241995, 0.248321, 0.254447, 0.242149, 0.249002, 0.253685, 0.24214, 0.248616, 0.254171, 0.24283, 0.248774, 0.254523, 0.243017, 0.248818, 0.255115, 0.242959, 0.250132, 0.25564, 0.244279, 0.250931, 0.256713, 0.245497, 0.252271, 0.257581, 0.246152, 0.252646, 0.258552, 0.24637, 0.253082, 0.259752, 0.2487, 0.255187, 0.261415, 0.249544, 0.25523, 0.260905, 0.250207, 0.257294, 0.26171, 0.250924, 0.257309, 0.263051, 0.253511, 0.259643, 0.265319, 0.253697, 0.260433, 0.264983, 0.254385, 0.260587, 0.265521, 0.256143, 0.261957, 0.267047, 0.25718, 0.263111, 0.266832, 0.257896, 0.263258, 0.267495, 0.258582, 0.263319, 0.267777, 0.258073, 0.26308, 0.267788, 0.259209, 0.264485, 0.268199, 0.258332, 0.264149, 0.2681, 0.258309, 0.263341, 0.267499, 0.257909, 0.263133, 0.267376, 0.257812, 0.262619, 0.26566, 0.257273, 0.261096, 0.263939, 0.25611, 0.259539, 0.262991, 0.255161, 0.258725, 0.261666, 0.254751, 0.258209, 0.261595, 0.25362, 0.257949, 0.260187, 0.252416, 0.256435, 0.259246 ], "T": [ 0.100072, 0.249911, 0.273619, 0.188696, 0.183083, 0.19045, 0.286416, 0.25023, 0.256543, 0.220137, 0.181401, 0.212555, 0.217567, 0.2145, 0.221689, 0.212433, 0.204688, 0.211295, 0.202659, 0.202023, 0.213712, 0.210343, 0.209535, 0.219311, 0.211501, 0.20768, 0.219064, 0.21224, 0.208326, 0.218467, 0.211117, 0.20645, 0.218075, 0.209446, 0.205372, 0.216187, 0.208092, 0.204601, 0.215205, 0.20952, 0.204973, 0.216279, 0.208979, 0.20639, 0.216924, 0.208899, 0.206418, 0.215491, 0.208743, 0.205454, 0.215816, 0.207545, 0.204919, 0.214977, 0.207154, 0.203962, 0.214603, 0.207615, 0.204565, 0.214957, 0.207353, 0.203825, 0.214567, 0.207626, 0.203831, 0.21397, 0.207694, 0.203368, 0.214611, 0.207184, 0.203588, 0.213571, 0.206827, 0.203611, 0.213411, 0.2071, 0.203248, 0.212719, 0.207862, 0.20431, 0.213236, 0.2072, 0.203559, 0.212459, 0.206118, 0.204005, 0.212907, 0.205804, 0.203163, 0.21209, 0.206077, 0.202413, 0.21183, 0.205711, 0.20208, 0.210605, 0.205329, 0.202154, 0.211609, 0.20597, 0.202288, 0.211482, 0.205449, 0.202627, 0.210642, 0.20503, 0.20229, 0.211138, 0.205401, 0.203229, 0.210556, 0.205791, 0.202702, 0.210669, 0.206338, 0.20367, 0.212017, 0.206779, 0.204326, 0.212843, 0.208279, 0.205425, 0.212879, 0.208631, 0.20703, 0.213755, 0.210013, 0.208919, 0.215105, 0.21206, 0.209689, 0.216715, 0.212629, 0.21143, 0.218063, 0.214398, 0.213642, 0.219685, 0.216726, 0.215568, 0.221776, 0.21865, 0.217425, 0.222615, 0.219871, 0.218585, 0.224224, 0.221897, 0.219861, 0.225514 ], "C": [ 0.382773, 0.256587, 0.262451, 0.264143, 0.229534, 0.237738, 0.240861, 0.292272, 0.284481, 0.225493, 0.287094, 0.285641, 0.271208, 0.267206, 0.260891, 0.266371, 0.264098, 0.253802, 0.253128, 0.258369, 0.258173, 0.268014, 0.265147, 0.258499, 0.266099, 0.263494, 0.260167, 0.267107, 0.265561, 0.261526, 0.268446, 0.266152, 0.261268, 0.26758, 0.265599, 0.261547, 0.269454, 0.266, 0.261826, 0.2683, 0.2651, 0.261007, 0.268279, 0.266263, 0.261784, 0.269437, 0.266041, 0.262552, 0.270332, 0.267353, 0.263014, 0.270681, 0.267048, 0.262913, 0.271294, 0.266818, 0.263649, 0.270777, 0.267944, 0.263695, 0.26958, 0.26726, 0.263568, 0.270026, 0.266598, 0.262552, 0.270591, 0.266844, 0.263316, 0.268791, 0.265996, 0.261782, 0.269192, 0.265223, 0.261853, 0.269177, 0.264735, 0.260296, 0.267429, 0.262767, 0.258186, 0.265565, 0.260244, 0.257672, 0.265075, 0.26039, 0.25749, 0.264203, 0.259397, 0.256029, 0.262193, 0.258801, 0.254751, 0.260186, 0.256248, 0.252045, 0.258109, 0.254099, 0.249466, 0.256544, 0.252041, 0.24824, 0.254433, 0.249604, 0.245552, 0.250871, 0.24689, 0.24475, 0.248961, 0.244833, 0.242398, 0.246897, 0.243698, 0.239607, 0.24453, 0.241512, 0.236702, 0.241553, 0.237962, 0.234116, 0.238929, 0.23492, 0.23204, 0.237448, 0.233356, 0.230427, 0.23504, 0.2303, 0.22772, 0.232428, 0.228767, 0.225991, 0.230891, 0.227108, 0.224787, 0.228724, 0.225036, 0.222913, 0.226593, 0.223183, 0.220743, 0.223979, 0.221289, 0.219302, 0.22289, 0.220363, 0.217845, 0.221464, 0.217868, 0.215306 ], "G": [ 0.371108, 0.334929, 0.226393, 0.285629, 0.289235, 0.235339, 0.258048, 0.238388, 0.246287, 0.262965, 0.298292, 0.283283, 0.280023, 0.274952, 0.263435, 0.279715, 0.279795, 0.269034, 0.289627, 0.281937, 0.266276, 0.2765, 0.276846, 0.265971, 0.278727, 0.277666, 0.264429, 0.278957, 0.27786, 0.265788, 0.278608, 0.27876, 0.265167, 0.27995, 0.280233, 0.266893, 0.279489, 0.279271, 0.266998, 0.279578, 0.280198, 0.268062, 0.280079, 0.279861, 0.267139, 0.278995, 0.279853, 0.268155, 0.279306, 0.279158, 0.267168, 0.27978, 0.279712, 0.267664, 0.279404, 0.280218, 0.268062, 0.279468, 0.278875, 0.267177, 0.280237, 0.280142, 0.267342, 0.27933, 0.280754, 0.268363, 0.278757, 0.279656, 0.266434, 0.279745, 0.279485, 0.267933, 0.278483, 0.278895, 0.267155, 0.277571, 0.279371, 0.268433, 0.278339, 0.279841, 0.268825, 0.278535, 0.28101, 0.268454, 0.279263, 0.280375, 0.268697, 0.279787, 0.280146, 0.270171, 0.280806, 0.281477, 0.270368, 0.280592, 0.282029, 0.272031, 0.282865, 0.283314, 0.273941, 0.283101, 0.285083, 0.274757, 0.283975, 0.285812, 0.276759, 0.286919, 0.28771, 0.27728, 0.287742, 0.288681, 0.279551, 0.288731, 0.29028, 0.281947, 0.29106, 0.291739, 0.283493, 0.292459, 0.293228, 0.284842, 0.29446, 0.295506, 0.286981, 0.295613, 0.296273, 0.288319, 0.297038, 0.297648, 0.2898, 0.297701, 0.298924, 0.291634, 0.299207, 0.300366, 0.293211, 0.300767, 0.301783, 0.294411, 0.30152, 0.302524, 0.295815, 0.30262, 0.303077, 0.296489, 0.303618, 0.303103, 0.297744, 0.304223, 0.305835, 0.299934 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.753881, 0.591516, 0.488844, 0.549772, 0.51877, 0.473076, 0.498909, 0.530659, 0.530768, 0.488457, 0.585386, 0.568924, 0.551231, 0.542158, 0.524325, 0.546086, 0.543893, 0.522836, 0.542755, 0.540306, 0.524448, 0.544514, 0.541993, 0.52447, 0.544825, 0.54116, 0.524596, 0.546064, 0.543421, 0.527314, 0.547055, 0.544912, 0.526435, 0.54753, 0.545831, 0.52844, 0.548943, 0.545271, 0.528824, 0.547878, 0.545299, 0.52907, 0.548358, 0.546124, 0.528923, 0.548432, 0.545894, 0.530707, 0.549638, 0.546511, 0.530182, 0.550461, 0.54676, 0.530576, 0.550697, 0.547036, 0.531711, 0.550245, 0.546819, 0.530872, 0.549817, 0.547402, 0.53091, 0.549357, 0.547351, 0.530915, 0.549348, 0.5465, 0.52975, 0.548536, 0.545481, 0.529715, 0.547675, 0.544118, 0.529008, 0.546748, 0.544106, 0.528729, 0.545768, 0.542608, 0.527011, 0.5441, 0.541254, 0.526126, 0.544338, 0.540765, 0.526188, 0.54399, 0.539543, 0.5262, 0.542999, 0.540278, 0.525119, 0.540778, 0.538277, 0.524076, 0.540975, 0.537413, 0.523407, 0.539645, 0.537125, 0.522997, 0.538409, 0.535416, 0.522311, 0.53779, 0.5346, 0.52203, 0.536703, 0.533513, 0.521949, 0.535628, 0.533978, 0.521554, 0.53559, 0.53325, 0.520195, 0.534012, 0.531189, 0.518958, 0.533389, 0.530426, 0.519021, 0.53306, 0.529629, 0.518746, 0.532078, 0.527948, 0.517519, 0.530128, 0.527692, 0.517625, 0.530098, 0.527474, 0.517998, 0.529492, 0.52682, 0.517324, 0.528113, 0.525706, 0.516558, 0.526599, 0.524365, 0.515791, 0.526508, 0.523466, 0.515589, 0.525687, 0.523704, 0.51524 ] }, "kmer_count": { "AAAAA": 3198532, "AAAAT": 1989651, "AAAAC": 1719980, "AAAAG": 2737805, "AAATA": 1144194, "AAATT": 1424204, "AAATC": 1310944, "AAATG": 1821898, "AAACA": 1841322, "AAACT": 1489075, "AAACC": 1402941, "AAACG": 565496, "AAAGA": 4991415, "AAAGT": 1566180, "AAAGC": 1973663, "AAAGG": 2031897, "AATAA": 884109, "AATAT": 876421, "AATAC": 685638, "AATAG": 494365, "AATTA": 717431, "AATTT": 1137026, "AATTC": 976852, "AATTG": 998376, "AATCA": 1120784, "AATCT": 976662, "AATCC": 965213, "AATCG": 331561, "AATGA": 1711941, "AATGT": 1214304, "AATGC": 1186929, "AATGG": 1480779, "AACAA": 1969414, "AACAT": 1416168, "AACAC": 1127721, "AACAG": 2026334, "AACTA": 766067, "AACTT": 1251563, "AACTC": 1055380, "AACTG": 1597353, "AACCA": 1625854, "AACCT": 1336103, "AACCC": 1191735, "AACCG": 564043, "AACGA": 653566, "AACGT": 529559, "AACGC": 499633, "AACGG": 570958, "AAGAA": 4856935, "AAGAT": 2712763, "AAGAC": 1979196, "AAGAG": 7567682, "AAGTA": 1086033, "AAGTT": 1447497, "AAGTC": 1277344, "AAGTG": 1650516, "AAGCA": 2345601, "AAGCT": 2134800, "AAGCC": 2029963, "AAGCG": 988048, "AAGGA": 3111972, "AAGGT": 1476699, "AAGGC": 2173346, "AAGGG": 1456030, "ATAAA": 1029091, "ATAAT": 564548, "ATAAC": 459637, "ATAAG": 674466, "ATATA": 432473, "ATATT": 772184, "ATATC": 615469, "ATATG": 833408, "ATACA": 702699, "ATACT": 543638, "ATACC": 592738, "ATACG": 222796, "ATAGA": 660861, "ATAGT": 388310, "ATAGC": 434484, "ATAGG": 302230, "ATTAA": 854907, "ATTAT": 748406, "ATTAC": 675629, "ATTAG": 394051, "ATTTA": 717540, "ATTTT": 1263631, "ATTTC": 1038343, "ATTTG": 1249605, "ATTCA": 1168485, "ATTCT": 1078460, "ATTCC": 1053155, "ATTCG": 420376, "ATTGA": 1407684, "ATTGT": 915111, "ATTGC": 998713, "ATTGG": 1082249, "ATCAA": 1681812, "ATCAT": 1487832, "ATCAC": 1170582, "ATCAG": 1498612, "ATCTA": 692222, "ATCTT": 1215964, "ATCTC": 1798865, "ATCTG": 1423940, "ATCCA": 1646391, "ATCCT": 1498337, "ATCCC": 1159882, "ATCCG": 756105, "ATCGA": 715897, "ATCGT": 548919, "ATCGC": 598418, "ATCGG": 3748092, "ATGAA": 2487301, "ATGAT": 1671949, "ATGAC": 1439925, "ATGAG": 1898369, "ATGTA": 686055, "ATGTT": 1167088, "ATGTC": 1111874, "ATGTG": 1553365, "ATGCA": 1339846, "ATGCT": 1497489, "ATGCC": 1577404, "ATGCG": 452094, "ATGGA": 2208431, "ATGGT": 1181401, "ATGGC": 1843433, "ATGGG": 1283902, "ACAAA": 1766834, "ACAAT": 916526, "ACAAC": 1400375, "ACAAG": 2205096, "ACATA": 495308, "ACATT": 1110081, "ACATC": 1612475, "ACATG": 1377657, "ACACA": 1383980, "ACACT": 942998, "ACACC": 1435487, "ACACG": 551705, "ACAGA": 2680500, "ACAGT": 1424661, "ACAGC": 2333016, "ACAGG": 1563897, "ACTAA": 511715, "ACTAT": 704246, "ACTAC": 974206, "ACTAG": 370178, "ACTTA": 553820, "ACTTT": 1211769, "ACTTC": 1561280, "ACTTG": 1010244, "ACTCA": 1097224, "ACTCT": 1041577, "ACTCC": 1281865, "ACTCG": 487566, "ACTGA": 1435989, "ACTGT": 1201693, "ACTGC": 2561333, "ACTGG": 1780638, "ACCAA": 1857246, "ACCAT": 1537188, "ACCAC": 1725245, "ACCAG": 2511885, "ACCTA": 700684, "ACCTT": 1244728, "ACCTC": 1636579, "ACCTG": 2505980, "ACCCA": 1605435, "ACCCT": 1431634, "ACCCC": 1718560, "ACCCG": 758750, "ACCGA": 732921, "ACCGT": 570893, "ACCGC": 977152, "ACCGG": 823199, "ACGAA": 516459, "ACGAT": 423020, "ACGAC": 658712, "ACGAG": 1061741, "ACGTA": 216058, "ACGTT": 338975, "ACGTC": 512810, "ACGTG": 911469, "ACGCA": 550822, "ACGCT": 574982, "ACGCC": 903730, "ACGCG": 360209, "ACGGA": 678025, "ACGGT": 431945, "ACGGC": 942751, "ACGGG": 724557, "AGAAA": 3590565, "AGAAT": 1670655, "AGAAC": 2017589, "AGAAG": 5007225, "AGATA": 947909, "AGATT": 1373834, "AGATC": 5850581, "AGATG": 2720541, "AGACA": 1900327, "AGACT": 1328373, "AGACC": 1799287, "AGACG": 827196, "AGAGA": 3263758, "AGAGT": 2915943, "AGAGC": 5102285, "AGAGG": 2374669, "AGTAA": 670802, "AGTAT": 816293, "AGTAC": 1054703, "AGTAG": 611387, "AGTTA": 635779, "AGTTT": 1285284, "AGTTC": 1454630, "AGTTG": 1103524, "AGTCA": 1221132, "AGTCT": 1010653, "AGTCC": 1267065, "AGTCG": 519364, "AGTGA": 1626050, "AGTGT": 2663941, "AGTGC": 1392203, "AGTGG": 1926334, "AGCAA": 2060348, "AGCAT": 1266926, "AGCAC": 1726932, "AGCAG": 4197176, "AGCTA": 952415, "AGCTT": 1392081, "AGCTC": 2007725, "AGCTG": 3777458, "AGCCA": 2608429, "AGCCT": 1930148, "AGCCC": 2458575, "AGCCG": 1240296, "AGCGA": 856739, "AGCGT": 3361872, "AGCGC": 1170231, "AGCGG": 1333144, "AGGAA": 2875473, "AGGAT": 1613881, "AGGAC": 1904493, "AGGAG": 4107445, "AGGTA": 628739, "AGGTT": 939565, "AGGTC": 1045273, "AGGTG": 2096334, "AGGCA": 1835892, "AGGCT": 1762626, "AGGCC": 2465829, "AGGCG": 1080853, "AGGGA": 3454456, "AGGGT": 824712, "AGGGC": 1657769, "AGGGG": 1243535, "TAAAA": 1276442, "TAAAT": 680195, "TAAAC": 609403, "TAAAG": 1202662, "TAATA": 409270, "TAATT": 484482, "TAATC": 395524, "TAATG": 742500, "TAACA": 646104, "TAACT": 487342, "TAACC": 452684, "TAACG": 142468, "TAAGA": 884200, "TAAGT": 447815, "TAAGC": 534847, "TAAGG": 711562, "TATAA": 543139, "TATAT": 480108, "TATAC": 341721, "TATAG": 328416, "TATTA": 521177, "TATTT": 884493, "TATTC": 665832, "TATTG": 775788, "TATCA": 1001166, "TATCT": 677108, "TATCC": 660047, "TATCG": 255094, "TATGA": 1197875, "TATGT": 727513, "TATGC": 739723, "TATGG": 958511, "TACAA": 1213163, "TACAT": 793388, "TACAC": 716048, "TACAG": 1368098, "TACTA": 519857, "TACTT": 807375, "TACTC": 649737, "TACTG": 2013105, "TACCA": 1158545, "TACCT": 1043655, "TACCC": 735237, "TACCG": 469566, "TACGA": 468559, "TACGT": 337082, "TACGC": 339929, "TACGG": 391742, "TAGAA": 869816, "TAGAT": 1411050, "TAGAC": 418838, "TAGAG": 736295, "TAGTA": 297623, "TAGTT": 365505, "TAGTC": 298551, "TAGTG": 553628, "TAGCA": 636106, "TAGCT": 482934, "TAGCC": 518335, "TAGCG": 147101, "TAGGA": 454042, "TAGGT": 259337, "TAGGC": 319827, "TAGGG": 2387447, "TTAAA": 1104195, "TTAAT": 602815, "TTAAC": 461768, "TTAAG": 710256, "TTATA": 463147, "TTATT": 831327, "TTATC": 636841, "TTATG": 847306, "TTACA": 947737, "TTACT": 1830039, "TTACC": 701818, "TTACG": 251144, "TTAGA": 652624, "TTAGT": 369241, "TTAGC": 418081, "TTAGG": 299087, "TTTAA": 888667, "TTTAT": 880918, "TTTAC": 697782, "TTTAG": 544377, "TTTTA": 915380, "TTTTT": 1430291, "TTTTC": 1244997, "TTTTG": 1464877, "TTTCA": 1294960, "TTTCT": 1524711, "TTTCC": 1345710, "TTTCG": 342133, "TTTGA": 1790244, "TTTGT": 1263541, "TTTGC": 1271048, "TTTGG": 1614291, "TTCAA": 1557646, "TTCAT": 1271989, "TTCAC": 1141479, "TTCAG": 2024706, "TTCTA": 860612, "TTCTT": 1556130, "TTCTC": 1541606, "TTCTG": 1908391, "TTCCA": 1901237, "TTCCT": 2218400, "TTCCC": 1464227, "TTCCG": 689578, "TTCGA": 686802, "TTCGT": 544257, "TTCGC": 476968, "TTCGG": 592312, "TTGAA": 1730367, "TTGAT": 1210771, "TTGAC": 1029774, "TTGAG": 1279661, "TTGTA": 627380, "TTGTT": 971713, "TTGTC": 906655, "TTGTG": 1312692, "TTGCA": 1155323, "TTGCT": 1458434, "TTGCC": 1288418, "TTGCG": 322444, "TTGGA": 1752638, "TTGGT": 1079120, "TTGGC": 1357805, "TTGGG": 1064632, "TCAAA": 1470104, "TCAAT": 816157, "TCAAC": 1396695, "TCAAG": 2167689, "TCATA": 496570, "TCATT": 1296596, "TCATC": 1947531, "TCATG": 1446005, "TCACA": 1238414, "TCACT": 1105841, "TCACC": 1854779, "TCACG": 506783, "TCAGA": 2118327, "TCAGT": 1317419, "TCAGC": 2109846, "TCAGG": 1566520, "TCTAA": 581303, "TCTAT": 690391, "TCTAC": 1073549, "TCTAG": 491697, "TCTTA": 635082, "TCTTT": 1362624, "TCTTC": 2106348, "TCTTG": 1155310, "TCTCA": 1377736, "TCTCT": 1504835, "TCTCC": 1936559, "TCTCG": 1199342, "TCTGA": 1616355, "TCTGT": 1394473, "TCTGC": 1899221, "TCTGG": 2049061, "TCCAA": 1616743, "TCCAT": 1269326, "TCCAC": 1618532, "TCCAG": 2971593, "TCCTA": 810213, "TCCTT": 1433639, "TCCTC": 2256562, "TCCTG": 3129039, "TCCCA": 1765625, "TCCCT": 1558560, "TCCCC": 1775592, "TCCCG": 960117, "TCCGA": 673795, "TCCGT": 621260, "TCCGC": 1049726, "TCCGG": 998460, "TCGAA": 513587, "TCGAT": 432397, "TCGAC": 595193, "TCGAG": 894245, "TCGTA": 248567, "TCGTT": 320685, "TCGTC": 644233, "TCGTG": 4286703, "TCGCA": 483159, "TCGCT": 622510, "TCGCC": 1247945, "TCGCG": 351859, "TCGGA": 3869809, "TCGGT": 927096, "TCGGC": 823383, "TCGGG": 920088, "TGAAA": 2305306, "TGAAT": 1252907, "TGAAC": 1516669, "TGAAG": 3716826, "TGATA": 800660, "TGATT": 1057314, "TGATC": 1197168, "TGATG": 2553480, "TGACA": 1776319, "TGACT": 1315261, "TGACC": 1758069, "TGACG": 698329, "TGAGA": 1967477, "TGAGT": 1005299, "TGAGC": 1820724, "TGAGG": 2114789, "TGTAA": 656558, "TGTAT": 739850, "TGTAC": 920607, "TGTAG": 3561035, "TGTTA": 1909430, "TGTTT": 1289313, "TGTTC": 1508317, "TGTTG": 1347530, "TGTCA": 1409541, "TGTCT": 1312959, "TGTCC": 1527594, "TGTCG": 596415, "TGTGA": 1608876, "TGTGT": 1398563, "TGTGC": 1576428, "TGTGG": 2473465, "TGCAA": 1363243, "TGCAT": 973082, "TGCAC": 1276607, "TGCAG": 3096788, "TGCTA": 924825, "TGCTT": 1347084, "TGCTC": 2806523, "TGCTG": 4003263, "TGCCA": 2399419, "TGCCT": 1871090, "TGCCC": 2306095, "TGCCG": 1010857, "TGCGA": 488202, "TGCGT": 450456, "TGCGC": 865744, "TGCGG": 1070044, "TGGAA": 2715196, "TGGAT": 1805909, "TGGAC": 2137793, "TGGAG": 3844612, "TGGTA": 824913, "TGGTT": 1148949, "TGGTC": 1593838, "TGGTG": 2772346, "TGGCA": 2350803, "TGGCT": 2240379, "TGGCC": 2777245, "TGGCG": 1143133, "TGGGA": 1844861, "TGGGT": 997314, "TGGGC": 1995917, "TGGGG": 1751670, "CAAAA": 2084822, "CAAAT": 1251743, "CAAAC": 1288929, "CAAAG": 2401238, "CAATA": 627649, "CAATT": 713307, "CAATC": 657549, "CAATG": 1509208, "CAACA": 2186868, "CAACT": 1315649, "CAACC": 1451976, "CAACG": 780219, "CAAGA": 3294592, "CAAGT": 1644905, "CAAGC": 2148282, "CAAGG": 2574228, "CATAA": 477576, "CATAT": 540420, "CATAC": 464239, "CATAG": 462123, "CATTA": 799859, "CATTT": 1133140, "CATTC": 1049863, "CATTG": 1600172, "CATCA": 2337993, "CATCT": 1744221, "CATCC": 2059641, "CATCG": 1129754, "CATGA": 1675290, "CATGT": 1172805, "CATGC": 1267839, "CATGG": 2041838, "CACAA": 1322060, "CACAT": 1013770, "CACAC": 1256837, "CACAG": 2463076, "CACTA": 623899, "CACTT": 1016007, "CACTC": 1046804, "CACTG": 1947509, "CACCA": 2919831, "CACCT": 1972844, "CACCC": 1956447, "CACCG": 1137452, "CACGA": 584923, "CACGT": 550745, "CACGC": 777286, "CACGG": 917019, "CAGAA": 3259009, "CAGAT": 3687940, "CAGAC": 1804389, "CAGAG": 3074134, "CAGTA": 1017568, "CAGTT": 1517378, "CAGTC": 1303560, "CAGTG": 2437822, "CAGCA": 3971029, "CAGCT": 3111523, "CAGCC": 3457493, "CAGCG": 1554676, "CAGGA": 2979493, "CAGGT": 1508395, "CAGGC": 2281257, "CAGGG": 1785012, "CTAAA": 893283, "CTAAT": 449808, "CTAAC": 399892, "CTAAG": 715513, "CTATA": 435981, "CTATT": 636387, "CTATC": 613522, "CTATG": 1172653, "CTACA": 1556227, "CTACT": 996822, "CTACC": 1247187, "CTACG": 657747, "CTAGA": 736634, "CTAGT": 378927, "CTAGC": 433119, "CTAGG": 384869, "CTTAA": 623441, "CTTAT": 613331, "CTTAC": 655576, "CTTAG": 477650, "CTTTA": 793800, "CTTTT": 1316059, "CTTTC": 1241451, "CTTTG": 1950073, "CTTCA": 2369067, "CTTCT": 2134699, "CTTCC": 2364444, "CTTCG": 1008732, "CTTGA": 1097186, "CTTGT": 922018, "CTTGC": 1087568, "CTTGG": 1471337, "CTCAA": 1539320, "CTCAT": 1356039, "CTCAC": 1314789, "CTCAG": 2298596, "CTCTA": 796348, "CTCTT": 1504151, "CTCTC": 1574884, "CTCTG": 2261269, "CTCCA": 2573293, "CTCCT": 2490831, "CTCCC": 2140835, "CTCCG": 1188600, "CTCGA": 592259, "CTCGT": 1556376, "CTCGC": 809472, "CTCGG": 1598809, "CTGAA": 2591832, "CTGAT": 1512470, "CTGAC": 1711794, "CTGAG": 2423008, "CTGTA": 963879, "CTGTT": 1353117, "CTGTC": 1590571, "CTGTG": 2577451, "CTGCA": 2825753, "CTGCT": 4460857, "CTGCC": 3077527, "CTGCG": 1352013, "CTGGA": 3747323, "CTGGT": 1978388, "CTGGC": 2981836, "CTGGG": 2531542, "CCAAA": 1985111, "CCAAT": 960968, "CCAAC": 1655268, "CCAAG": 3086678, "CCATA": 521404, "CCATT": 1194949, "CCATC": 2141276, "CCATG": 2086661, "CCACA": 1978901, "CCACT": 1452348, "CCACC": 2860562, "CCACG": 1059280, "CCAGA": 3768478, "CCAGT": 1854129, "CCAGC": 3651201, "CCAGG": 2949514, "CCTAA": 646781, "CCTAT": 677044, "CCTAC": 1183245, "CCTAG": 573701, "CCTTA": 638785, "CCTTT": 1341202, "CCTTC": 2209434, "CCTTG": 1327343, "CCTCA": 2189409, "CCTCT": 1867562, "CCTCC": 2908577, "CCTCG": 1065510, "CCTGA": 2477798, "CCTGT": 1821860, "CCTGC": 3398011, "CCTGG": 3770617, "CCCAA": 1803521, "CCCAT": 1209042, "CCCAC": 1872729, "CCCAG": 3702034, "CCCTA": 748014, "CCCTT": 1239795, "CCCTC": 1956706, "CCCTG": 3017279, "CCCCA": 2667181, "CCCCT": 1789988, "CCCCC": 3029156, "CCCCG": 1759562, "CCCGA": 1065681, "CCCGT": 743191, "CCCGC": 1599857, "CCCGG": 1671626, "CCGAA": 760576, "CCGAT": 395483, "CCGAC": 786572, "CCGAG": 1698362, "CCGTA": 529941, "CCGTT": 383838, "CCGTC": 870981, "CCGTG": 1278361, "CCGCA": 1256005, "CCGCT": 1129294, "CCGCC": 2244632, "CCGCG": 1154669, "CCGGA": 1161839, "CCGGT": 541182, "CCGGC": 1791216, "CCGGG": 1576398, "CGAAA": 652366, "CGAAT": 408788, "CGAAC": 356538, "CGAAG": 861099, "CGATA": 226480, "CGATT": 303048, "CGATC": 399750, "CGATG": 709883, "CGACA": 849434, "CGACT": 548558, "CGACC": 767460, "CGACG": 607690, "CGAGA": 1437912, "CGAGT": 749403, "CGAGC": 1119649, "CGAGG": 1505372, "CGTAA": 235835, "CGTAT": 423001, "CGTAC": 279986, "CGTAG": 257258, "CGTTA": 201037, "CGTTT": 388723, "CGTTC": 433056, "CGTTG": 376564, "CGTCA": 761271, "CGTCT": 689837, "CGTCC": 879148, "CGTCG": 3045937, "CGTGA": 853133, "CGTGT": 3988360, "CGTGC": 955729, "CGTGG": 1465157, "CGCAA": 847390, "CGCAT": 557542, "CGCAC": 624109, "CGCAG": 1184834, "CGCTA": 411774, "CGCTT": 591191, "CGCTC": 882393, "CGCTG": 1437236, "CGCCA": 1466768, "CGCCT": 1249726, "CGCCC": 1372768, "CGCCG": 1826268, "CGCGA": 430434, "CGCGT": 359282, "CGCGC": 917978, "CGCGG": 1069914, "CGGAA": 4095456, "CGGAT": 518913, "CGGAC": 741730, "CGGAG": 1462972, "CGGTA": 247106, "CGGTT": 369544, "CGGTC": 507442, "CGGTG": 1464457, "CGGCA": 1304819, "CGGCT": 1244949, "CGGCC": 1779917, "CGGCG": 2115750, "CGGGA": 1461594, "CGGGT": 604568, "CGGGC": 1415790, "CGGGG": 1350911, "GAAAA": 3148870, "GAAAT": 1799627, "GAAAC": 1695671, "GAAAG": 4320907, "GAATA": 768583, "GAATT": 1215916, "GAATC": 1036476, "GAATG": 1533056, "GAACA": 1883057, "GAACT": 1393114, "GAACC": 1422893, "GAACG": 769959, "GAAGA": 8123568, "GAAGT": 1823455, "GAAGC": 2864599, "GAAGG": 2937054, "GATAA": 829149, "GATAT": 764588, "GATAC": 572374, "GATAG": 506068, "GATTA": 641447, "GATTT": 1092128, "GATTC": 1010028, "GATTG": 1017011, "GATCA": 1393063, "GATCT": 1775961, "GATCC": 1376134, "GATCG": 3954917, "GATGA": 2920622, "GATGT": 1415883, "GATGC": 1684412, "GATGG": 2046442, "GACAA": 1790734, "GACAT": 1382277, "GACAC": 1217453, "GACAG": 2163069, "GACTA": 649794, "GACTT": 1264961, "GACTC": 1155489, "GACTG": 1470264, "GACCA": 1928175, "GACCT": 1739967, "GACCC": 1638705, "GACCG": 931988, "GACGA": 956060, "GACGT": 567398, "GACGC": 778020, "GACGG": 901273, "GAGAA": 3267803, "GAGAT": 3177561, "GAGAC": 1636942, "GAGAG": 2410174, "GAGTA": 743474, "GAGTT": 1142833, "GAGTC": 1128674, "GAGTG": 3014329, "GAGCA": 2300562, "GAGCT": 2402512, "GAGCC": 2227314, "GAGCG": 4093100, "GAGGA": 3953229, "GAGGT": 1473694, "GAGGC": 2377429, "GAGGG": 1621960, "GTAAA": 768992, "GTAAT": 423460, "GTAAC": 413458, "GTAAG": 488777, "GTATA": 365620, "GTATT": 613945, "GTATC": 748662, "GTATG": 778004, "GTACA": 898446, "GTACT": 680885, "GTACC": 876269, "GTACG": 410657, "GTAGA": 1441877, "GTAGT": 385236, "GTAGC": 504926, "GTAGG": 2503719, "GTTAA": 533364, "GTTAT": 546041, "GTTAC": 1761373, "GTTAG": 329407, "GTTTA": 587274, "GTTTT": 1047039, "GTTTC": 978257, "GTTTG": 1273100, "GTTCA": 1180163, "GTTCT": 1147133, "GTTCC": 1531397, "GTTCG": 534309, "GTTGA": 970279, "GTTGT": 732709, "GTTGC": 881676, "GTTGG": 1101449, "GTCAA": 1091474, "GTCAT": 1105047, "GTCAC": 1094907, "GTCAG": 1314084, "GTCTA": 487982, "GTCTT": 994542, "GTCTC": 1145745, "GTCTG": 1366378, "GTCCA": 1378363, "GTCCT": 1450635, "GTCCC": 1313390, "GTCCG": 717288, "GTCGA": 450441, "GTCGT": 2972942, "GTCGC": 853271, "GTCGG": 708949, "GTGAA": 1959967, "GTGAT": 1206962, "GTGAC": 1358151, "GTGAG": 1302620, "GTGTA": 3698946, "GTGTT": 2616038, "GTGTC": 1227748, "GTGTG": 1594720, "GTGCA": 1407175, "GTGCT": 1739144, "GTGCC": 1655517, "GTGCG": 753961, "GTGGA": 2782546, "GTGGT": 2137933, "GTGGC": 2326842, "GTGGG": 1699916, "GCAAA": 1805278, "GCAAT": 809856, "GCAAC": 1270452, "GCAAG": 2193442, "GCATA": 424801, "GCATT": 978340, "GCATC": 1533355, "GCATG": 1214037, "GCACA": 1427349, "GCACT": 1121141, "GCACC": 1795198, "GCACG": 694749, "GCAGA": 3279706, "GCAGT": 1679091, "GCAGC": 3981821, "GCAGG": 2452316, "GCTAA": 709058, "GCTAT": 773796, "GCTAC": 1198747, "GCTAG": 490093, "GCTTA": 509420, "GCTTT": 1301801, "GCTTC": 1874971, "GCTTG": 1009775, "GCTCA": 1779755, "GCTCT": 1674762, "GCTCC": 2198353, "GCTCG": 1861516, "GCTGA": 2657907, "GCTGT": 2043471, "GCTGC": 3894316, "GCTGG": 3555119, "GCCAA": 2358539, "GCCAT": 1901689, "GCCAC": 2094385, "GCCAG": 2979749, "GCCTA": 777060, "GCCTT": 1559499, "GCCTC": 2086730, "GCCTG": 2699391, "GCCCA": 2477382, "GCCCT": 2146508, "GCCCC": 2677665, "GCCCG": 1560451, "GCCGA": 1157678, "GCCGT": 1144797, "GCCGC": 2149409, "GCCGG": 1550076, "GCGAA": 464826, "GCGAT": 370804, "GCGAC": 704426, "GCGAG": 1102878, "GCGTA": 209937, "GCGTT": 342236, "GCGTC": 3376846, "GCGTG": 853252, "GCGCA": 921064, "GCGCT": 991185, "GCGCC": 1521381, "GCGCG": 898172, "GCGGA": 1138349, "GCGGT": 709635, "GCGGC": 2842357, "GCGGG": 1547234, "GGAAA": 4478389, "GGAAT": 1225563, "GGAAC": 1571250, "GGAAG": 6231462, "GGATA": 694654, "GGATT": 1018433, "GGATC": 1145071, "GGATG": 2071845, "GGACA": 2009946, "GGACT": 1339267, "GGACC": 1894617, "GGACG": 1058812, "GGAGA": 3846472, "GGAGT": 1424441, "GGAGC": 3043774, "GGAGG": 3437071, "GGTAA": 525904, "GGTAT": 539591, "GGTAC": 597749, "GGTAG": 509206, "GGTTA": 456800, "GGTTT": 854483, "GGTTC": 944713, "GGTTG": 816411, "GGTCA": 1164710, "GGTCT": 940962, "GGTCC": 1137005, "GGTCG": 894769, "GGTGA": 1694363, "GGTGT": 1244717, "GGTGC": 1621065, "GGTGG": 3068470, "GGCAA": 1780178, "GGCAT": 1344726, "GGCAC": 1394826, "GGCAG": 2890323, "GGCTA": 865318, "GGCTT": 1347007, "GGCTC": 1840714, "GGCTG": 2892174, "GGCCA": 2780568, "GGCCT": 2029274, "GGCCC": 2678999, "GGCCG": 1909658, "GGCGA": 858322, "GGCGT": 673474, "GGCGC": 1376162, "GGCGG": 2749587, "GGGAA": 3836278, "GGGAT": 940737, "GGGAC": 1440959, "GGGAG": 2236348, "GGGTA": 448543, "GGGTT": 582785, "GGGTC": 980106, "GGGTG": 1258483, "GGGCA": 1835379, "GGGCT": 1633096, "GGGCC": 2293015, "GGGCG": 1257652, "GGGGA": 1673006, "GGGGT": 825545, "GGGGC": 1909531, "GGGGG": 8262316 }, "overrepresented_sequences": {} }, "read1_after_filtering": { "total_reads": 9932006, "total_bases": 1374926771, "q20_bases": 1369172921, "q30_bases": 1355291933, "total_cycles": 150, "quality_curves": { "A": [ 38.3296, 38.4765, 39.1819, 39.4121, 39.3434, 39.393, 39.3811, 39.4686, 39.4347, 39.4992, 39.4864, 39.5151, 39.5597, 39.5332, 39.4684, 39.5812, 39.7163, 39.6332, 39.6941, 39.7258, 39.6525, 39.713, 39.7363, 39.7383, 39.742, 39.6223, 39.6269, 39.6374, 39.6184, 39.6381, 39.6277, 39.6557, 39.6596, 39.6141, 39.6588, 39.6213, 39.6779, 39.641, 39.6819, 39.6861, 39.6845, 39.6829, 39.6868, 39.6889, 39.6888, 39.6979, 39.695, 39.6281, 39.6973, 39.6067, 39.6965, 39.7057, 39.7019, 39.6995, 39.6522, 39.7027, 39.7011, 39.6914, 39.7056, 39.6676, 39.6898, 39.7076, 39.6844, 39.6884, 39.7093, 39.7016, 39.7136, 39.7045, 39.7019, 39.709, 39.705, 39.7087, 39.7041, 39.7012, 39.703, 39.7047, 39.6834, 39.659, 39.6839, 39.6953, 39.6971, 39.6614, 39.68, 39.6967, 39.6832, 39.6936, 39.6946, 39.6228, 39.6961, 39.6955, 39.6963, 39.6933, 39.6959, 39.672, 39.6888, 39.6932, 39.6898, 39.6886, 39.6725, 39.688, 39.6874, 39.6924, 39.6906, 39.6913, 39.6886, 39.6861, 39.6463, 39.6868, 39.6852, 39.6861, 39.6647, 39.6873, 39.6324, 39.6823, 39.6808, 39.6822, 39.649, 39.6904, 39.685, 39.6862, 39.6863, 39.6863, 39.686, 39.6818, 39.666, 39.6496, 39.6733, 39.6469, 39.6846, 39.684, 39.6321, 39.6813, 39.6865, 39.6951, 39.697, 39.674, 39.6966, 39.6933, 39.65, 39.6978, 39.6263, 39.6484, 39.6797, 39.642, 39.6554, 39.6974, 39.6795, 39.6973, 39.6423, 39.6522 ], "T": [ 39.2485, 39.496, 39.6028, 39.6772, 39.6813, 39.6912, 39.6734, 39.7105, 39.7271, 39.7403, 39.7638, 39.774, 39.7798, 39.7841, 39.7832, 39.8579, 39.8614, 39.8641, 39.868, 39.8691, 39.8689, 39.8756, 39.8777, 39.8772, 39.8786, 39.7759, 39.7773, 39.7841, 39.7853, 39.7885, 39.7947, 39.7973, 39.8009, 39.8061, 39.8099, 39.8171, 39.8194, 39.8202, 39.8216, 39.8247, 39.8272, 39.8278, 39.8272, 39.8335, 39.8345, 39.8366, 39.8352, 39.836, 39.8399, 39.8415, 39.8454, 39.8406, 39.8426, 39.8425, 39.8447, 39.8442, 39.8509, 39.8488, 39.8494, 39.8482, 39.8502, 39.8497, 39.8503, 39.8511, 39.8514, 39.8529, 39.8491, 39.8522, 39.8506, 39.8524, 39.8491, 39.8509, 39.8524, 39.8524, 39.853, 39.8555, 39.853, 39.8524, 39.8542, 39.8534, 39.8546, 39.8518, 39.8519, 39.8543, 39.8519, 39.853, 39.8536, 39.8526, 39.8527, 39.8524, 39.8532, 39.8521, 39.8544, 39.8514, 39.8507, 39.8511, 39.8519, 39.8503, 39.851, 39.8504, 39.8498, 39.8503, 39.8493, 39.8522, 39.8509, 39.8516, 39.8509, 39.8499, 39.8513, 39.8461, 39.8493, 39.8473, 39.8451, 39.8465, 39.8452, 39.8459, 39.8441, 39.8424, 39.8428, 39.8409, 39.8402, 39.8386, 39.8348, 39.8317, 39.8268, 39.8219, 39.8132, 39.8025, 39.7928, 39.7802, 39.7724, 39.7617, 39.7499, 39.7491, 39.7394, 39.7341, 39.7387, 39.7317, 39.7223, 39.7246, 39.7308, 39.7152, 39.7167, 39.7112, 39.7067, 39.7055, 39.6925, 39.685, 39.6805, 39.6745 ], "C": [ 38.4804, 39.3944, 39.4927, 39.6214, 39.6174, 39.5959, 39.5623, 39.5807, 39.5682, 39.6226, 39.6337, 39.6327, 39.6436, 39.6294, 39.6331, 39.7843, 39.7847, 39.786, 39.7897, 39.7843, 39.7822, 39.7908, 39.7902, 39.7831, 39.787, 39.6726, 39.6765, 39.6766, 39.6744, 39.6724, 39.684, 39.6896, 39.6936, 39.7012, 39.7046, 39.7132, 39.7117, 39.7074, 39.7127, 39.7082, 39.7097, 39.7055, 39.7084, 39.7147, 39.7098, 39.7174, 39.7154, 39.7152, 39.7178, 39.7154, 39.7215, 39.7225, 39.7185, 39.7179, 39.7202, 39.716, 39.7157, 39.7214, 39.7169, 39.714, 39.7192, 39.72, 39.7111, 39.7146, 39.7127, 39.7162, 39.7148, 39.7104, 39.7113, 39.714, 39.7077, 39.7076, 39.7074, 39.7066, 39.7075, 39.7053, 39.7004, 39.7046, 39.7019, 39.7013, 39.6987, 39.7037, 39.7023, 39.7047, 39.7061, 39.6989, 39.6956, 39.6986, 39.6928, 39.6933, 39.6946, 39.6884, 39.6948, 39.6902, 39.6869, 39.6892, 39.6936, 39.6884, 39.6802, 39.6877, 39.6792, 39.6761, 39.6816, 39.6795, 39.6805, 39.6814, 39.6761, 39.6761, 39.6825, 39.6728, 39.682, 39.6823, 39.6691, 39.6767, 39.6736, 39.6735, 39.6743, 39.6749, 39.6758, 39.6693, 39.6726, 39.6683, 39.6614, 39.6719, 39.6741, 39.6745, 39.6818, 39.6752, 39.6878, 39.684, 39.6734, 39.6758, 39.6732, 39.6747, 39.6681, 39.6694, 39.6685, 39.6564, 39.6431, 39.6442, 39.6407, 39.6513, 39.6496, 39.6421, 39.645, 39.6352, 39.6344, 39.6414, 39.6272, 39.6203 ], "G": [ 39.278, 39.4031, 39.3839, 39.5816, 39.5952, 39.5994, 39.6161, 39.634, 39.646, 39.6429, 39.6639, 39.6828, 39.69, 39.6924, 39.6873, 39.7655, 39.7738, 39.776, 39.7805, 39.7868, 39.7819, 39.7892, 39.7945, 39.7965, 39.7983, 39.6847, 39.6882, 39.6941, 39.6968, 39.7011, 39.7055, 39.71, 39.7112, 39.7143, 39.7204, 39.7258, 39.7277, 39.7292, 39.7293, 39.734, 39.7382, 39.7367, 39.7428, 39.7429, 39.743, 39.7486, 39.75, 39.7445, 39.7504, 39.7503, 39.7542, 39.7562, 39.7564, 39.7591, 39.7532, 39.7591, 39.7598, 39.7591, 39.7629, 39.7637, 39.7647, 39.7634, 39.7646, 39.7653, 39.7641, 39.7648, 39.7654, 39.7622, 39.7665, 39.7662, 39.7621, 39.7668, 39.7666, 39.7665, 39.766, 39.7657, 39.7611, 39.7632, 39.7627, 39.7638, 39.7636, 39.7644, 39.7658, 39.763, 39.7678, 39.7647, 39.7648, 39.7663, 39.7601, 39.7646, 39.7668, 39.7668, 39.7672, 39.7673, 39.7667, 39.765, 39.7647, 39.7629, 39.761, 39.7626, 39.7621, 39.7623, 39.7663, 39.7661, 39.7651, 39.7666, 39.7605, 39.7651, 39.764, 39.7586, 39.7603, 39.7593, 39.7561, 39.7554, 39.7539, 39.7495, 39.7527, 39.7513, 39.7532, 39.7535, 39.7473, 39.7423, 39.7426, 39.7394, 39.7273, 39.7323, 39.729, 39.7248, 39.7335, 39.73, 39.7298, 39.7344, 39.7273, 39.7295, 39.7305, 39.7352, 39.7312, 39.7363, 39.7341, 39.7387, 39.7403, 39.7273, 39.7351, 39.7335, 39.7287, 39.7302, 39.7294, 39.7286, 39.7214, 39.727 ], "mean": [ 38.8868, 39.3723, 39.4564, 39.5908, 39.5725, 39.5798, 39.5773, 39.6219, 39.6233, 39.6307, 39.6404, 39.6617, 39.6757, 39.6674, 39.6518, 39.7547, 39.7874, 39.7709, 39.7859, 39.7945, 39.777, 39.7957, 39.8036, 39.8022, 39.804, 39.6921, 39.6954, 39.7002, 39.6972, 39.7028, 39.7054, 39.7156, 39.7189, 39.7122, 39.7261, 39.7237, 39.7358, 39.7279, 39.7386, 39.7396, 39.7423, 39.7408, 39.743, 39.7475, 39.7464, 39.7513, 39.7511, 39.7358, 39.7526, 39.7337, 39.7567, 39.7573, 39.757, 39.7568, 39.7456, 39.7574, 39.7588, 39.7568, 39.7604, 39.7516, 39.7576, 39.7619, 39.7551, 39.7564, 39.7609, 39.7607, 39.761, 39.7589, 39.7592, 39.7611, 39.7576, 39.7598, 39.7583, 39.7584, 39.7587, 39.758, 39.7514, 39.7476, 39.752, 39.7552, 39.755, 39.7475, 39.7523, 39.7563, 39.7536, 39.7543, 39.7539, 39.7384, 39.7518, 39.7528, 39.7533, 39.7519, 39.7546, 39.7467, 39.7501, 39.7509, 39.7508, 39.7489, 39.7431, 39.7477, 39.746, 39.7463, 39.7473, 39.7486, 39.7476, 39.747, 39.7361, 39.7456, 39.7464, 39.7423, 39.7413, 39.7445, 39.7283, 39.7413, 39.7386, 39.739, 39.7325, 39.7399, 39.7406, 39.7387, 39.7367, 39.7351, 39.732, 39.7315, 39.7251, 39.7217, 39.7249, 39.7145, 39.7258, 39.7199, 39.7042, 39.7141, 39.7093, 39.7125, 39.7087, 39.7038, 39.7089, 39.7041, 39.6881, 39.701, 39.6863, 39.6864, 39.6955, 39.6832, 39.6845, 39.6914, 39.6834, 39.6872, 39.6686, 39.6686 ] }, "content_curves": { "A": [ 0.0740154, 0.0674759, 0.102743, 0.144743, 0.203869, 0.220603, 0.230115, 0.177777, 0.162788, 0.263014, 0.226198, 0.198218, 0.216166, 0.226201, 0.221621, 0.219454, 0.220901, 0.217734, 0.221532, 0.223749, 0.216517, 0.214932, 0.216335, 0.213074, 0.214833, 0.219965, 0.213778, 0.21551, 0.219035, 0.21149, 0.216284, 0.218729, 0.212498, 0.215583, 0.21808, 0.213082, 0.213347, 0.21767, 0.211962, 0.212905, 0.216395, 0.211025, 0.212189, 0.216997, 0.21001, 0.212447, 0.215593, 0.210444, 0.213155, 0.217077, 0.208811, 0.212464, 0.216323, 0.210023, 0.211103, 0.215553, 0.209059, 0.211145, 0.215554, 0.21068, 0.212009, 0.215055, 0.209369, 0.210844, 0.215461, 0.20913, 0.212822, 0.215532, 0.21066, 0.212727, 0.21545, 0.210518, 0.212701, 0.216428, 0.209977, 0.213955, 0.216298, 0.212179, 0.212347, 0.21546, 0.210056, 0.212106, 0.216599, 0.210817, 0.211831, 0.216759, 0.209936, 0.213021, 0.218384, 0.21163, 0.213748, 0.217407, 0.210821, 0.212408, 0.216312, 0.211064, 0.21213, 0.218047, 0.212058, 0.213174, 0.216592, 0.212084, 0.215138, 0.21858, 0.21275, 0.213804, 0.218369, 0.211394, 0.213976, 0.2193, 0.211999, 0.215721, 0.218777, 0.213013, 0.215362, 0.218789, 0.213387, 0.214405, 0.219174, 0.212741, 0.214484, 0.219112, 0.21353, 0.215811, 0.21965, 0.21319, 0.21577, 0.218479, 0.212664, 0.216022, 0.219754, 0.21437, 0.215315, 0.218094, 0.213858, 0.216497, 0.220446, 0.215432, 0.217472, 0.22041, 0.215487, 0.217411, 0.221827, 0.215943, 0.21713, 0.220337, 0.215326, 0.216351, 0.221369, 0.215149 ], "T": [ 0.0725997, 0.365372, 0.250676, 0.228545, 0.27744, 0.2916, 0.415291, 0.384404, 0.378903, 0.305116, 0.242948, 0.276314, 0.280073, 0.285709, 0.278548, 0.269214, 0.269584, 0.265149, 0.253885, 0.267165, 0.26557, 0.260148, 0.273639, 0.267963, 0.258835, 0.266255, 0.263764, 0.255186, 0.264442, 0.260796, 0.252205, 0.261549, 0.261267, 0.250594, 0.260319, 0.258567, 0.250747, 0.259139, 0.25787, 0.251342, 0.260833, 0.261366, 0.252915, 0.261507, 0.259777, 0.250225, 0.258212, 0.258948, 0.249872, 0.259721, 0.257015, 0.248967, 0.259071, 0.257041, 0.248791, 0.256928, 0.256545, 0.249023, 0.25581, 0.257118, 0.248299, 0.256374, 0.256209, 0.247961, 0.255205, 0.254674, 0.245266, 0.255175, 0.254905, 0.247747, 0.255772, 0.25598, 0.247432, 0.25628, 0.253595, 0.245428, 0.254261, 0.253577, 0.248301, 0.254908, 0.254264, 0.246994, 0.255263, 0.254474, 0.246322, 0.254876, 0.25575, 0.246936, 0.255019, 0.254937, 0.247901, 0.256165, 0.255438, 0.247016, 0.255544, 0.254253, 0.247266, 0.253872, 0.254984, 0.245985, 0.25395, 0.254701, 0.246569, 0.254237, 0.254591, 0.24706, 0.254794, 0.254487, 0.248139, 0.256069, 0.254657, 0.247212, 0.253093, 0.253639, 0.246377, 0.253719, 0.254811, 0.248131, 0.255578, 0.256099, 0.24733, 0.255973, 0.255409, 0.247924, 0.254523, 0.254745, 0.247194, 0.256061, 0.255141, 0.24719, 0.255004, 0.255984, 0.248583, 0.25664, 0.257033, 0.249445, 0.255441, 0.256101, 0.248681, 0.255985, 0.255816, 0.248778, 0.256267, 0.255488, 0.24936, 0.258043, 0.257255, 0.249308, 0.255992, 0.257492 ], "C": [ 0.399809, 0.254765, 0.352684, 0.299174, 0.216239, 0.227093, 0.1576, 0.226221, 0.244366, 0.199985, 0.254316, 0.260664, 0.243969, 0.240327, 0.252309, 0.252576, 0.251584, 0.258797, 0.255072, 0.251471, 0.262251, 0.266137, 0.257395, 0.264331, 0.265357, 0.257584, 0.266816, 0.268499, 0.26016, 0.269448, 0.269, 0.261258, 0.268975, 0.270514, 0.261139, 0.269107, 0.270305, 0.26182, 0.270434, 0.269541, 0.261975, 0.268956, 0.26971, 0.261601, 0.270998, 0.272377, 0.263385, 0.270591, 0.271985, 0.261696, 0.27281, 0.273928, 0.262212, 0.27333, 0.273182, 0.264978, 0.27393, 0.274049, 0.266778, 0.273826, 0.273793, 0.266753, 0.273503, 0.274892, 0.265502, 0.274183, 0.274766, 0.266043, 0.274176, 0.273127, 0.266519, 0.274833, 0.274974, 0.266465, 0.27632, 0.276307, 0.267998, 0.275237, 0.274508, 0.265962, 0.273613, 0.273584, 0.266394, 0.274361, 0.275173, 0.266231, 0.273467, 0.275002, 0.266855, 0.274813, 0.27463, 0.265444, 0.273339, 0.274893, 0.26654, 0.274219, 0.275768, 0.267676, 0.273797, 0.275302, 0.267404, 0.273928, 0.27433, 0.265544, 0.273255, 0.274624, 0.266163, 0.275338, 0.275152, 0.265116, 0.273385, 0.273258, 0.267234, 0.274075, 0.274764, 0.266645, 0.272773, 0.27399, 0.265332, 0.271964, 0.273942, 0.264779, 0.271689, 0.271822, 0.264906, 0.272613, 0.273274, 0.265006, 0.272331, 0.273252, 0.265014, 0.270677, 0.273086, 0.264608, 0.271937, 0.271464, 0.264404, 0.272827, 0.272985, 0.265257, 0.271488, 0.272524, 0.264154, 0.271805, 0.272249, 0.265566, 0.271505, 0.27264, 0.263716, 0.269568 ], "G": [ 0.453576, 0.312388, 0.293897, 0.327538, 0.302452, 0.260704, 0.196994, 0.211597, 0.213944, 0.231885, 0.276538, 0.264803, 0.259793, 0.247763, 0.247522, 0.258756, 0.25793, 0.25832, 0.269512, 0.257616, 0.255662, 0.258782, 0.252631, 0.254632, 0.260975, 0.256195, 0.255642, 0.260805, 0.256363, 0.258267, 0.262511, 0.258464, 0.257261, 0.26331, 0.260462, 0.259244, 0.2656, 0.261371, 0.259735, 0.266212, 0.260798, 0.258653, 0.265185, 0.259895, 0.259214, 0.264951, 0.26281, 0.260017, 0.264988, 0.261506, 0.261364, 0.264641, 0.262394, 0.259605, 0.266924, 0.262542, 0.260466, 0.265783, 0.261858, 0.258376, 0.265899, 0.261817, 0.260919, 0.266302, 0.263832, 0.262013, 0.267146, 0.26325, 0.260259, 0.266399, 0.262259, 0.25867, 0.264893, 0.260827, 0.260108, 0.26431, 0.261443, 0.259007, 0.264844, 0.26367, 0.262067, 0.267316, 0.261745, 0.260348, 0.266673, 0.262135, 0.260847, 0.265042, 0.259743, 0.25862, 0.263721, 0.260985, 0.260402, 0.265683, 0.261604, 0.260464, 0.264836, 0.260405, 0.259161, 0.265539, 0.262053, 0.259287, 0.263963, 0.261639, 0.259403, 0.264512, 0.260674, 0.258781, 0.262733, 0.259514, 0.259959, 0.263808, 0.260897, 0.259273, 0.263497, 0.260847, 0.259029, 0.263473, 0.259916, 0.259197, 0.264244, 0.260137, 0.259373, 0.264443, 0.260921, 0.259452, 0.263762, 0.260455, 0.259865, 0.263536, 0.260228, 0.258969, 0.263016, 0.260658, 0.257172, 0.262593, 0.25971, 0.25564, 0.260862, 0.258349, 0.257209, 0.261288, 0.257751, 0.256764, 0.261262, 0.256054, 0.255913, 0.261701, 0.258923, 0.25779 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.853385, 0.567152, 0.646581, 0.626712, 0.518691, 0.487797, 0.354594, 0.437818, 0.458309, 0.43187, 0.530855, 0.525468, 0.503762, 0.48809, 0.499831, 0.511332, 0.509515, 0.517117, 0.524584, 0.509086, 0.517913, 0.524919, 0.510026, 0.518963, 0.526332, 0.51378, 0.522458, 0.529304, 0.516523, 0.527715, 0.531511, 0.519722, 0.526235, 0.533823, 0.521601, 0.528351, 0.535906, 0.523191, 0.530168, 0.535753, 0.522772, 0.527609, 0.534895, 0.521496, 0.530212, 0.537328, 0.526195, 0.530608, 0.536974, 0.523202, 0.534174, 0.538569, 0.524606, 0.532936, 0.540106, 0.52752, 0.534396, 0.539832, 0.528636, 0.532202, 0.539692, 0.528571, 0.534422, 0.541194, 0.529334, 0.536197, 0.541912, 0.529293, 0.534435, 0.539526, 0.528778, 0.533503, 0.539867, 0.527292, 0.536428, 0.540617, 0.529441, 0.534244, 0.539351, 0.529632, 0.53568, 0.5409, 0.528139, 0.534708, 0.541847, 0.528365, 0.534314, 0.540043, 0.526598, 0.533432, 0.538352, 0.526429, 0.533741, 0.540576, 0.528144, 0.534683, 0.540604, 0.528082, 0.532958, 0.540841, 0.529457, 0.533215, 0.538293, 0.527183, 0.532659, 0.539136, 0.526837, 0.534119, 0.537885, 0.52463, 0.533344, 0.537067, 0.52813, 0.533348, 0.538261, 0.527492, 0.531802, 0.537464, 0.525248, 0.53116, 0.538186, 0.524915, 0.531061, 0.536265, 0.525827, 0.532065, 0.537036, 0.525461, 0.532196, 0.536788, 0.525242, 0.529646, 0.536102, 0.525266, 0.529109, 0.534057, 0.524114, 0.528467, 0.533847, 0.523605, 0.528697, 0.533811, 0.521906, 0.528569, 0.533511, 0.52162, 0.527419, 0.534341, 0.522639, 0.527359 ] }, "kmer_count": { "AAAAA": 1525011, "AAAAT": 1309369, "AAAAC": 1023295, "AAAAG": 1294390, "AAATA": 934903, "AAATT": 1176048, "AAATC": 1105377, "AAATG": 1142295, "AAACA": 1293088, "AAACT": 1277285, "AAACC": 834091, "AAACG": 359958, "AAAGA": 1344392, "AAAGT": 1234365, "AAAGC": 1292875, "AAAGG": 1317441, "AATAA": 880305, "AATAT": 818483, "AATAC": 618206, "AATAG": 641678, "AATTA": 518022, "AATTT": 1486590, "AATTC": 1243935, "AATTG": 711738, "AATCA": 1066344, "AATCT": 1383649, "AATCC": 1007150, "AATCG": 298737, "AATGA": 1170569, "AATGT": 1132704, "AATGC": 983086, "AATGG": 1197880, "AACAA": 964143, "AACAT": 1167770, "AACAC": 1094445, "AACAG": 1336016, "AACTA": 386788, "AACTT": 1458855, "AACTC": 1118245, "AACTG": 1502036, "AACCA": 1113078, "AACCT": 939863, "AACCC": 562942, "AACCG": 342898, "AACGA": 290810, "AACGT": 331738, "AACGC": 320313, "AACGG": 357218, "AAGAA": 1530877, "AAGAT": 1214292, "AAGAC": 962676, "AAGAG": 1453328, "AAGTA": 805309, "AAGTT": 1281635, "AAGTC": 1253451, "AAGTG": 1019422, "AAGCA": 1328564, "AAGCT": 1382896, "AAGCC": 1295678, "AAGCG": 564554, "AAGGA": 1369399, "AAGGT": 1244017, "AAGGC": 1512948, "AAGGG": 1225489, "ATAAA": 933083, "ATAAT": 795911, "ATAAC": 552094, "ATAAG": 623640, "ATATA": 514098, "ATATT": 931480, "ATATC": 779496, "ATATG": 548697, "ATACA": 750363, "ATACT": 828043, "ATACC": 537202, "ATACG": 216156, "ATAGA": 702836, "ATAGT": 716092, "ATAGC": 768388, "ATAGG": 667139, "ATTAA": 649323, "ATTAT": 598653, "ATTAC": 441260, "ATTAG": 466736, "ATTTA": 753421, "ATTTT": 2096122, "ATTTC": 1852044, "ATTTG": 1294346, "ATTCA": 1286474, "ATTCT": 1712631, "ATTCC": 1221821, "ATTCG": 428539, "ATTGA": 818439, "ATTGT": 927393, "ATTGC": 798162, "ATTGG": 950454, "ATCAA": 1216096, "ATCAT": 1696855, "ATCAC": 1198429, "ATCAG": 1487686, "ATCTA": 494404, "ATCTT": 2513429, "ATCTC": 1809638, "ATCTG": 2085129, "ATCCA": 1797269, "ATCCT": 1613558, "ATCCC": 922764, "ATCCG": 489491, "ATCGA": 363350, "ATCGT": 415333, "ATCGC": 349463, "ATCGG": 377149, "ATGAA": 1278190, "ATGAT": 1359051, "ATGAC": 1076920, "ATGAG": 1336265, "ATGTA": 824404, "ATGTT": 1435447, "ATGTC": 1366501, "ATGTG": 1023702, "ATGCA": 986340, "ATGCT": 1271048, "ATGCC": 1310806, "ATGCG": 537388, "ATGGA": 1262153, "ATGGT": 1534144, "ATGGC": 1819418, "ATGGG": 1202368, "ACAAA": 1266541, "ACAAT": 925057, "ACAAC": 705447, "ACAAG": 894375, "ACATA": 733267, "ACATT": 1229446, "ACATC": 1406572, "ACATG": 1120167, "ACACA": 1386011, "ACACT": 1095642, "ACACC": 1185797, "ACACG": 651349, "ACAGA": 1372236, "ACAGT": 1221313, "ACAGC": 1993343, "ACAGG": 1771421, "ACTAA": 384595, "ACTAT": 406283, "ACTAC": 387399, "ACTAG": 377653, "ACTTA": 470384, "ACTTT": 1566527, "ACTTC": 1800787, "ACTTG": 1646498, "ACTCA": 1004097, "ACTCT": 1263017, "ACTCC": 1397069, "ACTCG": 732977, "ACTGA": 1297887, "ACTGT": 1429722, "ACTGC": 1660215, "ACTGG": 1811529, "ACCAA": 1059068, "ACCAT": 1153447, "ACCAC": 1681982, "ACCAG": 1902777, "ACCTA": 266275, "ACCTT": 1460484, "ACCTC": 1441850, "ACCTG": 1484901, "ACCCA": 990392, "ACCCT": 817593, "ACCCC": 777779, "ACCCG": 555267, "ACCGA": 388594, "ACCGT": 424181, "ACCGC": 663927, "ACCGG": 482976, "ACGAA": 517825, "ACGAT": 525275, "ACGAC": 379402, "ACGAG": 498101, "ACGTA": 333485, "ACGTT": 529329, "ACGTC": 551720, "ACGTG": 534625, "ACGCA": 447134, "ACGCT": 585191, "ACGCC": 622515, "ACGCG": 307939, "ACGGA": 525089, "ACGGT": 560178, "ACGGC": 868016, "ACGGG": 665763, "AGAAA": 1497009, "AGAAT": 1090128, "AGAAC": 1118628, "AGAAG": 2030086, "AGATA": 687686, "AGATT": 997469, "AGATC": 1098279, "AGATG": 1720302, "AGACA": 1258511, "AGACT": 1000586, "AGACC": 901272, "AGACG": 642605, "AGAGA": 1462269, "AGAGT": 1036758, "AGAGC": 1622507, "AGAGG": 1807016, "AGTAA": 749518, "AGTAT": 566731, "AGTAC": 669832, "AGTAG": 995636, "AGTTA": 506973, "AGTTT": 1553102, "AGTTC": 1404067, "AGTTG": 1313188, "AGTCA": 1323346, "AGTCT": 1332030, "AGTCC": 1307150, "AGTCG": 524790, "AGTGA": 1111192, "AGTGT": 956207, "AGTGC": 1133879, "AGTGG": 1439449, "AGCAA": 1415166, "AGCAT": 1486674, "AGCAC": 1696577, "AGCAG": 3254738, "AGCTA": 486032, "AGCTT": 2116707, "AGCTC": 2344162, "AGCTG": 3077133, "AGCCA": 2166353, "AGCCT": 1739461, "AGCCC": 1571278, "AGCCG": 1145108, "AGCGA": 583918, "AGCGT": 562087, "AGCGC": 933157, "AGCGG": 1028257, "AGGAA": 1944728, "AGGAT": 1511938, "AGGAC": 1376747, "AGGAG": 2365688, "AGGTA": 1058179, "AGGTT": 1365154, "AGGTC": 1709066, "AGGTG": 1968721, "AGGCA": 1852866, "AGGCT": 1913665, "AGGCC": 1951152, "AGGCG": 1178204, "AGGGA": 1529226, "AGGGT": 1430181, "AGGGC": 2103790, "AGGGG": 1760239, "TAAAA": 965437, "TAAAT": 766189, "TAAAC": 596721, "TAAAG": 813089, "TAATA": 559898, "TAATT": 769292, "TAATC": 659968, "TAATG": 708460, "TAACA": 740335, "TAACT": 667848, "TAACC": 453621, "TAACG": 199499, "TAAGA": 656317, "TAAGT": 588450, "TAAGC": 516862, "TAAGG": 638250, "TATAA": 497958, "TATAT": 469841, "TATAC": 378305, "TATAG": 454233, "TATTA": 459901, "TATTT": 1258763, "TATTC": 795628, "TATTG": 654482, "TATCA": 807451, "TATCT": 977063, "TATCC": 683082, "TATCG": 215534, "TATGA": 515214, "TATGT": 522868, "TATGC": 429924, "TATGG": 516056, "TACAA": 654842, "TACAT": 706077, "TACAC": 592892, "TACAG": 970769, "TACTA": 318704, "TACTT": 1153213, "TACTC": 748574, "TACTG": 1022432, "TACCA": 816565, "TACCT": 639459, "TACCC": 434287, "TACCG": 219890, "TACGA": 224148, "TACGT": 217349, "TACGC": 195431, "TACGG": 288434, "TAGAA": 874516, "TAGAT": 709749, "TAGAC": 484790, "TAGAG": 787770, "TAGTA": 533125, "TAGTT": 787688, "TAGTC": 659337, "TAGTG": 622844, "TAGCA": 917495, "TAGCT": 963559, "TAGCC": 855764, "TAGCG": 392036, "TAGGA": 809045, "TAGGT": 714213, "TAGGC": 764935, "TAGGG": 710949, "TTAAA": 954105, "TTAAT": 814301, "TTAAC": 553045, "TTAAG": 654578, "TTATA": 585459, "TTATT": 999563, "TTATC": 850126, "TTATG": 499392, "TTACA": 679957, "TTACT": 726456, "TTACC": 531359, "TTACG": 229147, "TTAGA": 599108, "TTAGT": 535721, "TTAGC": 726783, "TTAGG": 657757, "TTTAA": 1111637, "TTTAT": 1157809, "TTTAC": 812067, "TTTAG": 925523, "TTTTA": 1322661, "TTTTT": 3188485, "TTTTC": 3235305, "TTTTG": 2115872, "TTTCA": 2393076, "TTTCT": 3787294, "TTTCC": 2535510, "TTTCG": 647065, "TTTGA": 1511371, "TTTGT": 1851901, "TTTGC": 1829506, "TTTGG": 1981382, "TTCAA": 1786218, "TTCAT": 2587450, "TTCAC": 1950987, "TTCAG": 2614012, "TTCTA": 926621, "TTCTT": 5080452, "TTCTC": 3315666, "TTCTG": 3327305, "TTCCA": 2734402, "TTCCT": 2941557, "TTCCC": 1745578, "TTCCG": 926130, "TTCGA": 508180, "TTCGT": 524417, "TTCGC": 441871, "TTCGG": 762414, "TTGAA": 1561724, "TTGAT": 1716214, "TTGAC": 1073675, "TTGAG": 1544483, "TTGTA": 1254291, "TTGTT": 2046606, "TTGTC": 1799768, "TTGTG": 1330377, "TTGCA": 1378421, "TTGCT": 2098994, "TTGCC": 1732522, "TTGCG": 793478, "TTGGA": 1617086, "TTGGT": 1898266, "TTGGC": 2332830, "TTGGG": 1745509, "TCAAA": 1822176, "TCAAT": 1446012, "TCAAC": 963205, "TCAAG": 1083528, "TCATA": 1241139, "TCATT": 1777505, "TCATC": 2948647, "TCATG": 1681761, "TCACA": 1621027, "TCACT": 1643660, "TCACC": 1644283, "TCACG": 818977, "TCAGA": 1616275, "TCAGT": 1477703, "TCAGC": 2610803, "TCAGG": 2427360, "TCTAA": 657843, "TCTAT": 627659, "TCTAC": 673965, "TCTAG": 633761, "TCTTA": 909788, "TCTTT": 3315988, "TCTTC": 5114888, "TCTTG": 3176534, "TCTCA": 1854184, "TCTCT": 2612788, "TCTCC": 3241456, "TCTCG": 1213991, "TCTGA": 2062830, "TCTGT": 2272531, "TCTGC": 2868536, "TCTGG": 2921565, "TCCAA": 1762412, "TCCAT": 2236152, "TCCAC": 2732020, "TCCAG": 3683269, "TCCTA": 466074, "TCCTT": 3168518, "TCCTC": 3963368, "TCCTG": 2931495, "TCCCA": 1819724, "TCCCT": 1418231, "TCCCC": 1532463, "TCCCG": 1308111, "TCCGA": 644104, "TCCGT": 676899, "TCCGC": 1056754, "TCCGG": 1069318, "TCGAA": 650053, "TCGAT": 703768, "TCGAC": 369588, "TCGAG": 565451, "TCGTA": 469565, "TCGTT": 662743, "TCGTC": 944096, "TCGTG": 562428, "TCGCA": 471269, "TCGCT": 846529, "TCGCC": 778950, "TCGCG": 390345, "TCGGA": 663389, "TCGGT": 734448, "TCGGC": 1114736, "TCGGG": 974054, "TGAAA": 1303691, "TGAAT": 1187373, "TGAAC": 1159166, "TGAAG": 2342646, "TGATA": 861232, "TGATT": 1162124, "TGATC": 1391636, "TGATG": 2346350, "TGACA": 1404758, "TGACT": 1234847, "TGACC": 1143997, "TGACG": 732478, "TGAGA": 1370769, "TGAGT": 1122763, "TGAGC": 1770137, "TGAGG": 2162923, "TGTAA": 988153, "TGTAT": 737222, "TGTAC": 909896, "TGTAG": 1568314, "TGTTA": 669828, "TGTTT": 1911524, "TGTTC": 1877203, "TGTTG": 2177109, "TGTCA": 1743148, "TGTCT": 1905236, "TGTCC": 1923699, "TGTCG": 781138, "TGTGA": 1247191, "TGTGT": 1411922, "TGTGC": 1417953, "TGTGG": 1885114, "TGCAA": 1155192, "TGCAT": 1371655, "TGCAC": 1359113, "TGCAG": 2786003, "TGCTA": 641564, "TGCTT": 2376743, "TGCTC": 2258850, "TGCTG": 3971420, "TGCCA": 2282124, "TGCCT": 1771742, "TGCCC": 1779770, "TGCCG": 1201178, "TGCGA": 449431, "TGCGT": 537145, "TGCGC": 858494, "TGCGG": 1166204, "TGGAA": 1917982, "TGGAT": 1653870, "TGGAC": 1333925, "TGGAG": 2524137, "TGGTA": 1170452, "TGGTT": 1660452, "TGGTC": 1892532, "TGGTG": 2890693, "TGGCA": 2374909, "TGGCT": 2549775, "TGGCC": 2642892, "TGGCG": 1335737, "TGGGA": 1730812, "TGGGT": 1580413, "TGGGC": 2397386, "TGGGG": 2476034, "CAAAA": 1479530, "CAAAT": 1278025, "CAAAC": 1245791, "CAAAG": 1924577, "CAATA": 795801, "CAATT": 1033728, "CAATC": 1009184, "CAATG": 1600610, "CAACA": 1317427, "CAACT": 1117383, "CAACC": 788319, "CAACG": 344373, "CAAGA": 1131405, "CAAGT": 1023107, "CAAGC": 982424, "CAAGG": 1296815, "CATAA": 874759, "CATAT": 872138, "CATAC": 784167, "CATAG": 1163709, "CATTA": 774082, "CATTT": 1901356, "CATTC": 1549150, "CATTG": 1482337, "CATCA": 2565777, "CATCT": 2753962, "CATCC": 2039031, "CATCG": 668779, "CATGA": 1424250, "CATGT": 1391574, "CATGC": 1202692, "CATGG": 2003821, "CACAA": 1301227, "CACAT": 1577770, "CACAC": 1561160, "CACAG": 2527815, "CACTA": 552506, "CACTT": 1635606, "CACTC": 1426149, "CACTG": 2416421, "CACCA": 2711180, "CACCT": 2054454, "CACCC": 1209499, "CACCG": 930610, "CACGA": 808218, "CACGT": 910340, "CACGC": 810504, "CACGG": 1235356, "CAGAA": 1879275, "CAGAT": 1436509, "CAGAC": 1312586, "CAGAG": 2209789, "CAGTA": 1002648, "CAGTT": 1654178, "CAGTC": 1463291, "CAGTG": 1950497, "CAGCA": 3939080, "CAGCT": 3723613, "CAGCC": 2775566, "CAGCG": 1343903, "CAGGA": 2883162, "CAGGT": 2530542, "CAGGC": 2629861, "CAGGG": 2989348, "CTAAA": 555930, "CTAAT": 411298, "CTAAC": 335629, "CTAAG": 480402, "CTATA": 341346, "CTATT": 510317, "CTATC": 487599, "CTATG": 467045, "CTACA": 576877, "CTACT": 628321, "CTACC": 480058, "CTACG": 227184, "CTAGA": 486451, "CTAGT": 370969, "CTAGC": 456728, "CTAGG": 520569, "CTTAA": 738149, "CTTAT": 707009, "CTTAC": 502909, "CTTAG": 729825, "CTTTA": 1278378, "CTTTT": 2780623, "CTTTC": 2552920, "CTTTG": 2462964, "CTTCA": 3777344, "CTTCT": 5133138, "CTTCC": 3088459, "CTTCG": 830583, "CTTGA": 2175636, "CTTGT": 2261664, "CTTGC": 2142501, "CTTGG": 3058979, "CTCAA": 1291905, "CTCAT": 1922608, "CTCAC": 1272293, "CTCAG": 2378842, "CTCTA": 748952, "CTCTT": 2869948, "CTCTC": 2177697, "CTCTG": 2922074, "CTCCA": 3796877, "CTCCT": 4070732, "CTCCC": 2026153, "CTCCG": 1343899, "CTCGA": 855271, "CTCGT": 1049047, "CTCGC": 1046172, "CTCGG": 1597017, "CTGAA": 2013419, "CTGAT": 1511610, "CTGAC": 1275889, "CTGAG": 2267966, "CTGTA": 1393679, "CTGTT": 2006350, "CTGTC": 1995513, "CTGTG": 2348756, "CTGCA": 3041205, "CTGCT": 4130356, "CTGCC": 2660118, "CTGCG": 1082333, "CTGGA": 2927577, "CTGGT": 2433931, "CTGGC": 2730455, "CTGGG": 3393406, "CCAAA": 1619082, "CCAAT": 1086717, "CCAAC": 1085516, "CCAAG": 1439379, "CCATA": 974063, "CCATT": 1509699, "CCATC": 2027783, "CCATG": 1986996, "CCACA": 2447496, "CCACT": 1927048, "CCACC": 2554792, "CCACG": 1393968, "CCAGA": 2007064, "CCAGT": 1812177, "CCAGC": 3453428, "CCAGG": 3704676, "CCTAA": 309456, "CCTAT": 325566, "CCTAC": 348250, "CCTAG": 388110, "CCTTA": 731591, "CCTTT": 2054785, "CCTTC": 2960010, "CCTTG": 2578048, "CCTCA": 2144604, "CCTCT": 2458725, "CCTCC": 3397143, "CCTCG": 1489141, "CCTGA": 1576560, "CCTGT": 1616765, "CCTGC": 2425788, "CCTGG": 2949276, "CCCAA": 1076925, "CCCAT": 1322424, "CCCAC": 1672658, "CCCAG": 2498820, "CCCTA": 299911, "CCCTT": 1458374, "CCCTC": 1641536, "CCCTG": 1816936, "CCCCA": 1758984, "CCCCT": 1217649, "CCCCC": 1269336, "CCCCG": 1278552, "CCCGA": 819591, "CCCGT": 725907, "CCCGC": 1431320, "CCCGG": 1508251, "CCGAA": 569418, "CCGAT": 475257, "CCGAC": 625818, "CCGAG": 944182, "CCGTA": 396921, "CCGTT": 582421, "CCGTC": 861742, "CCGTG": 908791, "CCGCA": 1019750, "CCGCT": 1251950, "CCGCC": 2530084, "CCGCG": 937706, "CCGGA": 929118, "CCGGT": 796763, "CCGGC": 1423128, "CCGGG": 1565465, "CGAAA": 317801, "CGAAT": 408564, "CGAAC": 500349, "CGAAG": 936588, "CGATA": 246906, "CGATT": 329380, "CGATC": 606505, "CGATG": 1091544, "CGACA": 463723, "CGACT": 492823, "CGACC": 496730, "CGACG": 391660, "CGAGA": 538457, "CGAGT": 491605, "CGAGC": 736944, "CGAGG": 998058, "CGTAA": 254817, "CGTAT": 231684, "CGTAC": 405310, "CGTAG": 650149, "CGTTA": 145755, "CGTTT": 593474, "CGTTC": 760400, "CGTTG": 773430, "CGTCA": 686404, "CGTCT": 835038, "CGTCC": 1008883, "CGTCG": 577861, "CGTGA": 514076, "CGTGT": 552025, "CGTGC": 688096, "CGTGG": 1038886, "CGCAA": 314955, "CGCAT": 440132, "CGCAC": 715040, "CGCAG": 1284639, "CGCTA": 135709, "CGCTT": 953724, "CGCTC": 1212115, "CGCTG": 1475073, "CGCCA": 1062260, "CGCCT": 1022047, "CGCCC": 1148984, "CGCCG": 1915434, "CGCGA": 293936, "CGCGT": 345352, "CGCGC": 776503, "CGCGG": 1012783, "CGGAA": 653457, "CGGAT": 754477, "CGGAC": 621344, "CGGAG": 1054008, "CGGTA": 456262, "CGGTT": 556763, "CGGTC": 923924, "CGGTG": 1103179, "CGGCA": 954247, "CGGCT": 1172932, "CGGCC": 1795372, "CGGCG": 1449671, "CGGGA": 901824, "CGGGT": 746585, "CGGGC": 1443796, "CGGGG": 1634806, "GAAAA": 1210391, "GAAAT": 1036154, "GAAAC": 943954, "GAAAG": 1216890, "GAATA": 681294, "GAATT": 999619, "GAATC": 1005357, "GAATG": 1063177, "GAACA": 1240586, "GAACT": 1432269, "GAACC": 910389, "GAACG": 407342, "GAAGA": 2054727, "GAAGT": 1539229, "GAAGC": 1811354, "GAAGG": 2140681, "GATAA": 658331, "GATAT": 623719, "GATAC": 564208, "GATAG": 613086, "GATTA": 407559, "GATTT": 1358669, "GATTC": 1076572, "GATTG": 658829, "GATCA": 1178931, "GATCT": 1816726, "GATCC": 1116787, "GATCG": 325705, "GATGA": 1954732, "GATGT": 1622784, "GATGC": 1507837, "GATGG": 2127761, "GACAA": 889062, "GACAT": 1061776, "GACAC": 1099480, "GACAG": 1564704, "GACTA": 303030, "GACTT": 1257322, "GACTC": 1121079, "GACTG": 1282175, "GACCA": 1175233, "GACCT": 1028862, "GACCC": 942258, "GACCG": 468875, "GACGA": 604632, "GACGT": 498443, "GACGC": 644077, "GACGG": 741451, "GAGAA": 1469967, "GAGAT": 1163493, "GAGAC": 1075734, "GAGAG": 1521610, "GAGTA": 647269, "GAGTT": 1066108, "GAGTC": 1132814, "GAGTG": 1065572, "GAGCA": 1693624, "GAGCT": 1981913, "GAGCC": 1732239, "GAGCG": 810167, "GAGGA": 2150859, "GAGGT": 1632218, "GAGGC": 2017127, "GAGGG": 1894374, "GTAAA": 714882, "GTAAT": 692553, "GTAAC": 638721, "GTAAG": 665083, "GTATA": 367509, "GTATT": 740045, "GTATC": 581713, "GTATG": 480614, "GTACA": 937800, "GTACT": 1082693, "GTACC": 581698, "GTACG": 263166, "GTAGA": 1085335, "GTAGT": 997563, "GTAGC": 1201855, "GTAGG": 1184387, "GTTAA": 488923, "GTTAT": 481107, "GTTAC": 423610, "GTTAG": 414051, "GTTTA": 664771, "GTTTT": 1828211, "GTTTC": 1762290, "GTTTG": 1333189, "GTTCA": 1533527, "GTTCT": 2082713, "GTTCC": 1569028, "GTTCG": 347264, "GTTGA": 1417532, "GTTGT": 1422560, "GTTGC": 1274368, "GTTGG": 1655566, "GTCAA": 1047878, "GTCAT": 1483245, "GTCAC": 1355403, "GTCAG": 1717132, "GTCTA": 430618, "GTCTT": 2094472, "GTCTC": 1654976, "GTCTG": 1831597, "GTCCA": 2142825, "GTCCT": 1948942, "GTCCC": 1437181, "GTCCG": 715755, "GTCGA": 573875, "GTCGT": 662871, "GTCGC": 668077, "GTCGG": 769061, "GTGAA": 1161279, "GTGAT": 1200591, "GTGAC": 1130778, "GTGAG": 1325703, "GTGTA": 741957, "GTGTT": 1166870, "GTGTC": 1226449, "GTGTG": 1287120, "GTGCA": 1296294, "GTGCT": 1788684, "GTGCC": 1389563, "GTGCG": 610650, "GTGGA": 1643197, "GTGGT": 1771621, "GTGGC": 2077178, "GTGGG": 1860729, "GCAAA": 1250067, "GCAAT": 1005504, "GCAAC": 844979, "GCAAG": 1061243, "GCATA": 755015, "GCATT": 1204735, "GCATC": 1669354, "GCATG": 1262270, "GCACA": 1547932, "GCACT": 1383993, "GCACC": 1551855, "GCACG": 920230, "GCAGA": 1872170, "GCAGT": 1580047, "GCAGC": 3784634, "GCAGG": 3173873, "GCTAA": 425115, "GCTAT": 438803, "GCTAC": 498947, "GCTAG": 428425, "GCTTA": 547491, "GCTTT": 2039065, "GCTTC": 2823132, "GCTTG": 2143839, "GCTCA": 1805763, "GCTCT": 2222132, "GCTCC": 2971363, "GCTCG": 1036833, "GCTGA": 2107163, "GCTGT": 2359571, "GCTGC": 3923959, "GCTGG": 3631221, "GCCAA": 1342387, "GCCAT": 1784727, "GCCAC": 2245403, "GCCAG": 2916425, "GCCTA": 327010, "GCCTT": 2174702, "GCCTC": 2335800, "GCCTG": 2260180, "GCCCA": 1949833, "GCCCT": 1679944, "GCCCC": 1871031, "GCCCG": 1307590, "GCCGA": 766819, "GCCGT": 914959, "GCCGC": 2601984, "GCCGG": 1631447, "GCGAA": 431873, "GCGAT": 574789, "GCGAC": 483310, "GCGAG": 772234, "GCGTA": 342148, "GCGTT": 494117, "GCGTC": 744702, "GCGTG": 785012, "GCGCA": 825927, "GCGCT": 1096958, "GCGCC": 1239945, "GCGCG": 802652, "GCGGA": 964814, "GCGGT": 932745, "GCGGC": 1957358, "GCGGG": 1446417, "GGAAA": 1310175, "GGAAT": 1086762, "GGAAC": 1252137, "GGAAG": 2316425, "GGATA": 672160, "GGATT": 1023349, "GGATC": 1356446, "GGATG": 2094445, "GGACA": 1510186, "GGACT": 1255047, "GGACC": 1092550, "GGACG": 735754, "GGAGA": 1878903, "GGAGT": 1278792, "GGAGC": 2124359, "GGAGG": 2777145, "GGTAA": 712857, "GGTAT": 629089, "GGTAC": 879936, "GGTAG": 1254760, "GGTTA": 474753, "GGTTT": 1483242, "GGTTC": 1443401, "GGTTG": 1455806, "GGTCA": 1788773, "GGTCT": 1851580, "GGTCC": 1873163, "GGTCG": 728541, "GGTGA": 1906406, "GGTGT": 1462009, "GGTGC": 1801033, "GGTGG": 2864331, "GGCAA": 1290830, "GGCAT": 1598636, "GGCAC": 1639743, "GGCAG": 3106534, "GGCTA": 525071, "GGCTT": 2086695, "GGCTC": 2189738, "GGCTG": 3459409, "GGCCA": 2725075, "GGCCT": 2474326, "GGCCC": 2225708, "GGCCG": 1620886, "GGCGA": 936387, "GGCGT": 916416, "GGCGC": 1402710, "GGCGG": 2069000, "GGGAA": 1445107, "GGGAT": 1216463, "GGGAC": 1268103, "GGGAG": 2107997, "GGGTA": 763303, "GGGTT": 1226903, "GGGTC": 1660009, "GGGTG": 1978282, "GGGCA": 2361345, "GGGCT": 2516387, "GGGCC": 2559138, "GGGCG": 1280130, "GGGGA": 1779552, "GGGGT": 1775646, "GGGGC": 2647539, "GGGGG": 2495019 }, "overrepresented_sequences": {} }, "read2_after_filtering": { "total_reads": 9932006, "total_bases": 1375146552, "q20_bases": 1367462784, "q30_bases": 1350487305, "total_cycles": 150, "quality_curves": { "A": [ 38.1239, 38.9862, 39.1519, 39.4448, 39.4365, 39.489, 39.4826, 39.5028, 39.5463, 39.5743, 39.5864, 39.6105, 39.6316, 39.6155, 39.5719, 39.6125, 39.6338, 39.6572, 39.652, 39.6784, 39.665, 39.6841, 39.6912, 39.6943, 39.6846, 39.5805, 39.5824, 39.586, 39.5688, 39.5974, 39.5384, 39.5845, 39.6201, 39.6278, 39.6079, 39.578, 39.6039, 39.6263, 39.6059, 39.6269, 39.6342, 39.6319, 39.6033, 39.6321, 39.6369, 39.4665, 39.6385, 39.6448, 39.6232, 39.6468, 39.6457, 39.6459, 39.6505, 39.6515, 39.6351, 39.6509, 39.6066, 39.6555, 39.6613, 39.6258, 39.6584, 39.6297, 39.6446, 39.6445, 39.6454, 39.6588, 39.657, 39.6635, 39.666, 39.597, 39.6348, 39.6383, 39.6637, 39.6465, 39.6464, 39.663, 39.6658, 39.6631, 39.6603, 39.6609, 39.6164, 39.5608, 39.6568, 39.6371, 39.6598, 39.6448, 39.5806, 39.6596, 39.6583, 39.6576, 39.6605, 39.6459, 39.6545, 39.6434, 39.6594, 39.6406, 39.6504, 39.6508, 39.6527, 39.6271, 39.6483, 39.6476, 39.6418, 39.6462, 39.6351, 39.6446, 39.6405, 39.6433, 39.6387, 39.6394, 39.6374, 39.6192, 39.6384, 39.5827, 39.6346, 39.6262, 39.6219, 39.6342, 39.6384, 39.6302, 39.6283, 39.616, 39.6262, 39.6114, 39.6205, 39.5551, 39.5942, 39.6045, 39.6057, 39.6001, 39.5373, 39.5875, 39.5918, 39.5824, 39.5693, 39.5645, 39.5648, 39.5531, 39.5213, 39.5321, 39.5126, 39.4794, 39.5096, 39.4832, 39.4816, 39.4802, 39.4408, 39.4394, 39.4313, 39.4066 ], "T": [ 38.811, 39.4993, 39.6274, 39.685, 39.7243, 39.744, 39.7736, 39.7654, 39.7792, 39.7818, 39.7902, 39.7971, 39.8038, 39.8018, 39.8111, 39.8161, 39.8145, 39.8248, 39.8315, 39.8273, 39.8277, 39.8342, 39.8367, 39.8363, 39.8429, 39.7046, 39.7129, 39.7165, 39.7177, 39.7255, 39.731, 39.7344, 39.7361, 39.7433, 39.7433, 39.7465, 39.7537, 39.7496, 39.7532, 39.7583, 39.7579, 39.761, 39.7626, 39.7685, 39.7696, 39.773, 39.7731, 39.7781, 39.7792, 39.7776, 39.7811, 39.786, 39.7847, 39.7851, 39.7879, 39.7893, 39.7934, 39.7945, 39.7923, 39.7957, 39.7969, 39.7955, 39.7955, 39.7997, 39.7982, 39.7976, 39.8018, 39.8015, 39.804, 39.8038, 39.8057, 39.8064, 39.8044, 39.8021, 39.8059, 39.8085, 39.807, 39.8117, 39.8089, 39.8063, 39.8112, 39.8077, 39.8081, 39.8103, 39.8105, 39.8094, 39.8101, 39.8106, 39.8086, 39.8092, 39.8121, 39.8098, 39.8108, 39.8077, 39.8079, 39.809, 39.8117, 39.8073, 39.8058, 39.8093, 39.8069, 39.8108, 39.8094, 39.8062, 39.8137, 39.8067, 39.8042, 39.806, 39.8065, 39.8029, 39.8052, 39.8103, 39.8112, 39.8081, 39.8085, 39.8108, 39.8042, 39.8082, 39.8052, 39.8097, 39.8095, 39.8091, 39.8134, 39.8062, 39.8086, 39.8163, 39.8093, 39.8102, 39.8093, 39.8074, 39.8072, 39.8066, 39.8076, 39.8036, 39.8047, 39.8006, 39.7968, 39.7912, 39.7895, 39.7828, 39.7777, 39.776, 39.7661, 39.763, 39.7615, 39.7562, 39.7506, 39.7451, 39.7413, 39.7337 ], "C": [ 37.6057, 39.0738, 39.2934, 39.4488, 39.5865, 39.5924, 39.6267, 39.6474, 39.674, 39.723, 39.7454, 39.7429, 39.7496, 39.7481, 39.761, 39.7677, 39.7759, 39.7728, 39.7873, 39.787, 39.7823, 39.7902, 39.7888, 39.7869, 39.7874, 39.6568, 39.6553, 39.6629, 39.6555, 39.6504, 39.6609, 39.6682, 39.6656, 39.6702, 39.6728, 39.6653, 39.6704, 39.6669, 39.6539, 39.6656, 39.6633, 39.6561, 39.6673, 39.6622, 39.6593, 39.6596, 39.6594, 39.664, 39.6658, 39.6628, 39.6596, 39.6683, 39.6654, 39.6621, 39.6663, 39.6604, 39.6646, 39.6706, 39.6665, 39.6616, 39.6645, 39.6681, 39.663, 39.665, 39.6675, 39.6622, 39.6656, 39.6689, 39.6589, 39.665, 39.6682, 39.6582, 39.6647, 39.6635, 39.6588, 39.6595, 39.6621, 39.6598, 39.6615, 39.6612, 39.6537, 39.6581, 39.6635, 39.6525, 39.6582, 39.6583, 39.655, 39.6558, 39.66, 39.6528, 39.6585, 39.6599, 39.6535, 39.6661, 39.6623, 39.6526, 39.6658, 39.6613, 39.6581, 39.6597, 39.6616, 39.6624, 39.666, 39.6611, 39.6591, 39.6663, 39.6637, 39.6536, 39.6641, 39.6625, 39.6525, 39.655, 39.6512, 39.6444, 39.6611, 39.6524, 39.6388, 39.6476, 39.6428, 39.6264, 39.6356, 39.6239, 39.6187, 39.6185, 39.6171, 39.6021, 39.6013, 39.5838, 39.5729, 39.5639, 39.5518, 39.5335, 39.5355, 39.5147, 39.4966, 39.4881, 39.4594, 39.4407, 39.4272, 39.3992, 39.3626, 39.3527, 39.3193, 39.296, 39.2782, 39.2553, 39.2119, 39.1883, 39.1525, 39.1009 ], "G": [ 39.4892, 39.5018, 39.3852, 39.5311, 39.5326, 39.4927, 39.5525, 39.5398, 39.5638, 39.577, 39.6231, 39.6192, 39.6342, 39.627, 39.6283, 39.6451, 39.6448, 39.6485, 39.6706, 39.6611, 39.6611, 39.6663, 39.6746, 39.6699, 39.679, 39.4959, 39.4923, 39.5111, 39.517, 39.5114, 39.5252, 39.5326, 39.5264, 39.5461, 39.5455, 39.5357, 39.5538, 39.5577, 39.554, 39.5652, 39.5722, 39.5643, 39.5754, 39.578, 39.5727, 39.5743, 39.5896, 39.5819, 39.5926, 39.5955, 39.5892, 39.6047, 39.6071, 39.6001, 39.6094, 39.611, 39.6072, 39.6164, 39.6196, 39.613, 39.6218, 39.6279, 39.6189, 39.6275, 39.6306, 39.6243, 39.6318, 39.6352, 39.6257, 39.6332, 39.6349, 39.6321, 39.6418, 39.6421, 39.6388, 39.6456, 39.6402, 39.6355, 39.643, 39.6422, 39.6379, 39.6456, 39.6435, 39.6367, 39.6469, 39.6507, 39.6408, 39.6478, 39.649, 39.6409, 39.6461, 39.6467, 39.6381, 39.6425, 39.6419, 39.6369, 39.6419, 39.641, 39.631, 39.6401, 39.6412, 39.6285, 39.6374, 39.6394, 39.6315, 39.6367, 39.6378, 39.6325, 39.6381, 39.6403, 39.632, 39.639, 39.6425, 39.6352, 39.6401, 39.6408, 39.634, 39.6391, 39.6453, 39.6428, 39.6443, 39.6494, 39.6347, 39.6372, 39.6423, 39.6343, 39.637, 39.639, 39.6258, 39.6396, 39.6327, 39.6178, 39.6334, 39.6259, 39.6125, 39.6263, 39.6204, 39.617, 39.6188, 39.6216, 39.6064, 39.6209, 39.616, 39.6051, 39.6191, 39.6159, 39.6076, 39.6056, 39.6056, 39.5836 ], "mean": [ 38.4989, 39.3091, 39.3719, 39.5158, 39.5515, 39.5632, 39.6189, 39.6198, 39.6469, 39.6544, 39.6801, 39.6906, 39.7019, 39.6942, 39.6892, 39.7063, 39.7115, 39.7198, 39.7281, 39.7318, 39.7292, 39.7393, 39.7431, 39.743, 39.744, 39.6031, 39.6064, 39.6135, 39.6086, 39.6166, 39.6084, 39.6234, 39.6326, 39.6406, 39.6356, 39.6262, 39.6391, 39.6433, 39.6365, 39.6477, 39.6501, 39.6482, 39.6461, 39.6533, 39.6546, 39.6127, 39.6583, 39.6619, 39.6589, 39.6638, 39.6637, 39.6697, 39.67, 39.6694, 39.6682, 39.6706, 39.6623, 39.6777, 39.678, 39.6685, 39.6787, 39.6734, 39.6751, 39.6776, 39.6784, 39.6803, 39.6825, 39.6852, 39.6832, 39.6684, 39.6787, 39.6779, 39.6871, 39.6816, 39.6819, 39.6876, 39.6866, 39.6867, 39.6869, 39.6857, 39.6736, 39.6618, 39.6859, 39.6782, 39.6872, 39.6839, 39.6653, 39.6867, 39.6871, 39.6845, 39.6876, 39.6834, 39.6835, 39.6835, 39.6858, 39.6788, 39.6858, 39.683, 39.6814, 39.6776, 39.6825, 39.6816, 39.6821, 39.6813, 39.6788, 39.6821, 39.6796, 39.6784, 39.6804, 39.6795, 39.6761, 39.6742, 39.6785, 39.661, 39.6797, 39.6752, 39.6689, 39.6756, 39.6759, 39.6715, 39.6728, 39.6672, 39.667, 39.6613, 39.6646, 39.6443, 39.653, 39.6515, 39.6466, 39.6452, 39.6231, 39.6292, 39.6338, 39.6228, 39.613, 39.6111, 39.6013, 39.5928, 39.5798, 39.5746, 39.5566, 39.5477, 39.5433, 39.5282, 39.5252, 39.5168, 39.4934, 39.4839, 39.4716, 39.447 ] }, "content_curves": { "A": [ 0.146387, 0.159113, 0.238381, 0.262396, 0.299099, 0.337603, 0.215314, 0.219802, 0.213338, 0.29232, 0.23392, 0.219168, 0.23188, 0.244078, 0.25475, 0.242202, 0.252165, 0.266682, 0.255321, 0.258416, 0.262599, 0.245842, 0.249153, 0.256935, 0.244354, 0.251841, 0.257064, 0.242346, 0.248922, 0.254907, 0.242456, 0.249294, 0.256182, 0.243642, 0.249423, 0.25603, 0.243557, 0.250743, 0.256579, 0.24316, 0.250333, 0.255247, 0.243205, 0.248034, 0.254755, 0.243185, 0.24821, 0.25436, 0.242103, 0.248531, 0.254547, 0.242441, 0.248806, 0.254941, 0.242582, 0.249452, 0.254168, 0.242556, 0.249065, 0.254593, 0.243189, 0.24911, 0.254875, 0.243285, 0.249057, 0.255395, 0.243129, 0.250271, 0.255805, 0.24431, 0.250948, 0.256708, 0.2453, 0.252047, 0.257329, 0.245649, 0.252129, 0.258019, 0.245554, 0.252237, 0.258993, 0.247544, 0.254085, 0.260266, 0.247923, 0.253538, 0.259296, 0.248096, 0.255337, 0.259874, 0.248567, 0.255075, 0.260898, 0.250617, 0.256946, 0.262676, 0.250155, 0.25726, 0.261998, 0.25052, 0.257188, 0.262406, 0.251966, 0.258138, 0.263559, 0.252389, 0.258956, 0.263101, 0.253024, 0.259187, 0.263949, 0.253684, 0.259261, 0.264278, 0.253054, 0.258973, 0.264695, 0.254392, 0.261154, 0.265664, 0.253912, 0.261325, 0.266464, 0.254281, 0.261176, 0.266557, 0.254658, 0.261857, 0.2678, 0.25561, 0.262303, 0.267254, 0.256405, 0.262337, 0.26691, 0.256332, 0.262467, 0.267725, 0.257107, 0.263038, 0.267434, 0.257555, 0.263848, 0.269233, 0.257888, 0.264805, 0.269748, 0.257209, 0.265753, 0.270065 ], "T": [ 0.100177, 0.25063, 0.274483, 0.18927, 0.183608, 0.191033, 0.287313, 0.251002, 0.25737, 0.220811, 0.181924, 0.213218, 0.218241, 0.215158, 0.222368, 0.213081, 0.205306, 0.211931, 0.203265, 0.202618, 0.214382, 0.21098, 0.210176, 0.219994, 0.212122, 0.208285, 0.219722, 0.212886, 0.208929, 0.21913, 0.211758, 0.20706, 0.218737, 0.210081, 0.205979, 0.216826, 0.208711, 0.205219, 0.215875, 0.210132, 0.205594, 0.216934, 0.209605, 0.20702, 0.217595, 0.209537, 0.20705, 0.21617, 0.209388, 0.206064, 0.216496, 0.208192, 0.205568, 0.215677, 0.207804, 0.204595, 0.215291, 0.208266, 0.205197, 0.215663, 0.208035, 0.204501, 0.215326, 0.208348, 0.204549, 0.21475, 0.208446, 0.204123, 0.215466, 0.208006, 0.204403, 0.214513, 0.207722, 0.204543, 0.214524, 0.208205, 0.204357, 0.214055, 0.20917, 0.205636, 0.214803, 0.208751, 0.205148, 0.214394, 0.208013, 0.205982, 0.215261, 0.208077, 0.20539, 0.214818, 0.208698, 0.204987, 0.215005, 0.208753, 0.205103, 0.214268, 0.208849, 0.205603, 0.215835, 0.209807, 0.205999, 0.216118, 0.209569, 0.206591, 0.215512, 0.209435, 0.206377, 0.21636, 0.209827, 0.207288, 0.215677, 0.210022, 0.206396, 0.21562, 0.210234, 0.206906, 0.216822, 0.210213, 0.206785, 0.217011, 0.211084, 0.207129, 0.216146, 0.210337, 0.207789, 0.216097, 0.21083, 0.208669, 0.216467, 0.211719, 0.207934, 0.216981, 0.210903, 0.208282, 0.216838, 0.210956, 0.208827, 0.217219, 0.212045, 0.209305, 0.218079, 0.212866, 0.209826, 0.217826, 0.212549, 0.209664, 0.21867, 0.213765, 0.208575, 0.218953 ], "C": [ 0.383598, 0.257059, 0.262781, 0.264528, 0.229735, 0.237865, 0.241052, 0.292564, 0.284719, 0.225534, 0.287351, 0.285846, 0.271367, 0.26733, 0.26098, 0.266481, 0.264174, 0.253823, 0.253176, 0.258415, 0.258193, 0.268091, 0.265215, 0.258504, 0.266164, 0.263538, 0.26019, 0.267165, 0.265623, 0.261547, 0.26851, 0.266196, 0.26128, 0.26764, 0.265655, 0.261595, 0.269513, 0.26603, 0.261862, 0.268383, 0.265133, 0.261044, 0.268382, 0.26633, 0.261811, 0.269541, 0.266138, 0.26261, 0.270447, 0.267469, 0.263084, 0.270799, 0.267156, 0.263008, 0.27145, 0.266972, 0.263769, 0.270973, 0.268132, 0.263894, 0.269824, 0.26753, 0.263831, 0.270362, 0.266962, 0.262913, 0.271034, 0.267342, 0.263843, 0.269402, 0.266681, 0.262497, 0.270101, 0.266204, 0.262901, 0.27044, 0.266095, 0.261687, 0.269119, 0.264534, 0.260062, 0.267819, 0.262579, 0.260199, 0.268098, 0.263554, 0.260864, 0.26809, 0.263437, 0.260173, 0.266954, 0.263866, 0.26005, 0.266294, 0.262661, 0.258793, 0.265762, 0.261959, 0.257558, 0.265723, 0.261296, 0.257899, 0.265362, 0.2608, 0.257079, 0.263835, 0.26017, 0.25839, 0.263884, 0.259905, 0.257791, 0.26377, 0.260834, 0.256965, 0.263763, 0.260991, 0.25621, 0.263085, 0.259518, 0.255579, 0.262113, 0.258115, 0.25541, 0.262988, 0.258777, 0.255939, 0.263007, 0.257708, 0.255196, 0.262375, 0.258168, 0.254913, 0.262216, 0.257909, 0.255326, 0.26154, 0.257059, 0.254987, 0.26145, 0.257095, 0.254377, 0.260099, 0.256484, 0.253746, 0.260257, 0.256841, 0.25382, 0.260758, 0.25593, 0.251951 ], "G": [ 0.369838, 0.333198, 0.224356, 0.283806, 0.287558, 0.2335, 0.256321, 0.236633, 0.244574, 0.261335, 0.296805, 0.281768, 0.278512, 0.273433, 0.261902, 0.278236, 0.278355, 0.267564, 0.288238, 0.280551, 0.264826, 0.275086, 0.275456, 0.264568, 0.277361, 0.276336, 0.263024, 0.277604, 0.276526, 0.264415, 0.277277, 0.27745, 0.263801, 0.278638, 0.278944, 0.265549, 0.278219, 0.278009, 0.265684, 0.278325, 0.27894, 0.266776, 0.278808, 0.278616, 0.265839, 0.277738, 0.278602, 0.266859, 0.278062, 0.277936, 0.265873, 0.278568, 0.27847, 0.266374, 0.278164, 0.278981, 0.266771, 0.278204, 0.277605, 0.265849, 0.278952, 0.27886, 0.265968, 0.278005, 0.279432, 0.266941, 0.277391, 0.278265, 0.264887, 0.278283, 0.277968, 0.266281, 0.276876, 0.277207, 0.265246, 0.275705, 0.277418, 0.266239, 0.276157, 0.277594, 0.266141, 0.275886, 0.278189, 0.265142, 0.275966, 0.276925, 0.264579, 0.275737, 0.275836, 0.265136, 0.275781, 0.276072, 0.264047, 0.274336, 0.27529, 0.264263, 0.275235, 0.275179, 0.26461, 0.27395, 0.275518, 0.263576, 0.273103, 0.274471, 0.26385, 0.27434, 0.274497, 0.262149, 0.273265, 0.273621, 0.262583, 0.272524, 0.273509, 0.263137, 0.27295, 0.27313, 0.262274, 0.27231, 0.272542, 0.261746, 0.272891, 0.273432, 0.261981, 0.272395, 0.272258, 0.261408, 0.271505, 0.271766, 0.260536, 0.270295, 0.271595, 0.260852, 0.270475, 0.271472, 0.260927, 0.271172, 0.271648, 0.260069, 0.269397, 0.270562, 0.26011, 0.26948, 0.269841, 0.259195, 0.269306, 0.268689, 0.257761, 0.268267, 0.269743, 0.259031 ], "N": [ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ], "GC": [ 0.753436, 0.590258, 0.487137, 0.548335, 0.517293, 0.471365, 0.497373, 0.529196, 0.529292, 0.486869, 0.584156, 0.567614, 0.549879, 0.540763, 0.522882, 0.544717, 0.542529, 0.521387, 0.541414, 0.538966, 0.523019, 0.543177, 0.540671, 0.523071, 0.543525, 0.539874, 0.523214, 0.544769, 0.542149, 0.525963, 0.545786, 0.543646, 0.525081, 0.546278, 0.544598, 0.527144, 0.547732, 0.544039, 0.527546, 0.546708, 0.544073, 0.52782, 0.54719, 0.544946, 0.527651, 0.547278, 0.54474, 0.52947, 0.548509, 0.545404, 0.528957, 0.549367, 0.545626, 0.529382, 0.549615, 0.545953, 0.530541, 0.549178, 0.545738, 0.529744, 0.548775, 0.546389, 0.529799, 0.548367, 0.546394, 0.529854, 0.548425, 0.545606, 0.52873, 0.547685, 0.544648, 0.528779, 0.546977, 0.543411, 0.528147, 0.546146, 0.543513, 0.527927, 0.545276, 0.542127, 0.526203, 0.543705, 0.540768, 0.525341, 0.544064, 0.54048, 0.525443, 0.543827, 0.539273, 0.525308, 0.542735, 0.539938, 0.524097, 0.540629, 0.537951, 0.523056, 0.540996, 0.537138, 0.522168, 0.539673, 0.536814, 0.521475, 0.538465, 0.535271, 0.520929, 0.538175, 0.534667, 0.520539, 0.53715, 0.533525, 0.520374, 0.536294, 0.534343, 0.520102, 0.536712, 0.53412, 0.518484, 0.535395, 0.53206, 0.517324, 0.535004, 0.531546, 0.51739, 0.535382, 0.531035, 0.517347, 0.534512, 0.529475, 0.515732, 0.532671, 0.529762, 0.515765, 0.532692, 0.529381, 0.516253, 0.532711, 0.528706, 0.515056, 0.530847, 0.527657, 0.514488, 0.529579, 0.526326, 0.512942, 0.529563, 0.52553, 0.511582, 0.529026, 0.525673, 0.510982 ] }, "kmer_count": { "AAAAA": 2901814, "AAAAT": 1973473, "AAAAC": 1692346, "AAAAG": 2584266, "AAATA": 1131773, "AAATT": 1416756, "AAATC": 1299573, "AAATG": 1812158, "AAACA": 1798808, "AAACT": 1481653, "AAACC": 1378237, "AAACG": 558923, "AAAGA": 3079331, "AAAGT": 1516546, "AAAGC": 1960510, "AAAGG": 1956959, "AATAA": 877450, "AATAT": 872750, "AATAC": 681613, "AATAG": 476073, "AATTA": 713832, "AATTT": 1129162, "AATTC": 972870, "AATTG": 995577, "AATCA": 1113335, "AATCT": 967206, "AATCC": 957989, "AATCG": 327599, "AATGA": 1700621, "AATGT": 1197374, "AATGC": 1180678, "AATGG": 1475895, "AACAA": 1945220, "AACAT": 1409175, "AACAC": 1114500, "AACAG": 1929151, "AACTA": 758073, "AACTT": 1245959, "AACTC": 1047716, "AACTG": 1592141, "AACCA": 1585603, "AACCT": 1325201, "AACCC": 1161444, "AACCG": 558075, "AACGA": 641252, "AACGT": 524642, "AACGC": 494084, "AACGG": 566457, "AAGAA": 4814508, "AAGAT": 2466784, "AAGAC": 1970293, "AAGAG": 2704569, "AAGTA": 1078991, "AAGTT": 1437096, "AAGTC": 1272819, "AAGTG": 1608048, "AAGCA": 2314934, "AAGCT": 2127949, "AAGCC": 2020630, "AAGCG": 978505, "AAGGA": 3052534, "AAGGT": 1470711, "AAGGC": 2165623, "AAGGG": 1387351, "ATAAA": 1021557, "ATAAT": 561947, "ATAAC": 456446, "ATAAG": 667831, "ATATA": 428623, "ATATT": 769486, "ATATC": 607248, "ATATG": 830778, "ATACA": 693376, "ATACT": 540940, "ATACC": 587351, "ATACG": 221429, "ATAGA": 586904, "ATAGT": 386345, "ATAGC": 431548, "ATAGG": 298304, "ATTAA": 748372, "ATTAT": 745947, "ATTAC": 671885, "ATTAG": 388333, "ATTTA": 713930, "ATTTT": 1254771, "ATTTC": 1032480, "ATTTG": 1246287, "ATTCA": 1158043, "ATTCT": 1074294, "ATTCC": 1046360, "ATTCG": 418292, "ATTGA": 1400846, "ATTGT": 912130, "ATTGC": 994976, "ATTGG": 1078150, "ATCAA": 1671271, "ATCAT": 1337374, "ATCAC": 1161595, "ATCAG": 1476357, "ATCTA": 686688, "ATCTT": 1210102, "ATCTC": 1170509, "ATCTG": 1418876, "ATCCA": 1622984, "ATCCT": 1487793, "ATCCC": 1143487, "ATCCG": 752066, "ATCGA": 704171, "ATCGT": 541792, "ATCGC": 594623, "ATCGG": 478257, "ATGAA": 2478217, "ATGAT": 1667615, "ATGAC": 1435321, "ATGAG": 1863962, "ATGTA": 678114, "ATGTT": 1150585, "ATGTC": 1105995, "ATGTG": 1548812, "ATGCA": 1326826, "ATGCT": 1490305, "ATGCC": 1570943, "ATGCG": 449939, "ATGGA": 2186764, "ATGGT": 1177274, "ATGGC": 1837644, "ATGGG": 1278540, "ACAAA": 1744700, "ACAAT": 911905, "ACAAC": 1387318, "ACAAG": 2175033, "ACATA": 488857, "ACATT": 1106184, "ACATC": 1603741, "ACATG": 1373098, "ACACA": 1347840, "ACACT": 937136, "ACACC": 1416960, "ACACG": 547403, "ACAGA": 2184779, "ACAGT": 1420005, "ACAGC": 2322863, "ACAGG": 1558475, "ACTAA": 506240, "ACTAT": 701502, "ACTAC": 967600, "ACTAG": 350864, "ACTTA": 550539, "ACTTT": 1206389, "ACTTC": 1538148, "ACTTG": 1007061, "ACTCA": 1088286, "ACTCT": 1035019, "ACTCC": 1269273, "ACTCG": 484037, "ACTGA": 1424106, "ACTGT": 1197165, "ACTGC": 1576582, "ACTGG": 1775149, "ACCAA": 1832930, "ACCAT": 1527833, "ACCAC": 1706203, "ACCAG": 2363277, "ACCTA": 689204, "ACCTT": 1237018, "ACCTC": 1613646, "ACCTG": 2497771, "ACCCA": 1539136, "ACCCT": 1416930, "ACCCC": 1664289, "ACCCG": 749758, "ACCGA": 713066, "ACCGT": 566354, "ACCGC": 957782, "ACCGG": 817066, "ACGAA": 510786, "ACGAT": 420261, "ACGAC": 654170, "ACGAG": 1024540, "ACGTA": 212289, "ACGTT": 336277, "ACGTC": 508147, "ACGTG": 907791, "ACGCA": 539462, "ACGCT": 571002, "ACGCC": 895881, "ACGCG": 357086, "ACGGA": 664742, "ACGGT": 429676, "ACGGC": 937721, "ACGGG": 720561, "AGAAA": 3559538, "AGAAT": 1654209, "AGAAC": 2007004, "AGAAG": 4959421, "AGATA": 936151, "AGATT": 1367804, "AGATC": 1798354, "AGATG": 2712610, "AGACA": 1844671, "AGACT": 1324302, "AGACC": 1785277, "AGACG": 823179, "AGAGA": 2503487, "AGAGT": 1239346, "AGAGC": 2214522, "AGAGG": 2359317, "AGTAA": 667159, "AGTAT": 810442, "AGTAC": 1051225, "AGTAG": 593612, "AGTTA": 632979, "AGTTT": 1262746, "AGTTC": 1450192, "AGTTG": 1099711, "AGTCA": 1214070, "AGTCT": 1006991, "AGTCC": 1261638, "AGTCG": 514357, "AGTGA": 1612613, "AGTGT": 1081657, "AGTGC": 1386787, "AGTGG": 1914558, "AGCAA": 2046216, "AGCAT": 1260556, "AGCAC": 1718758, "AGCAG": 4082400, "AGCTA": 940172, "AGCTT": 1386851, "AGCTC": 1997111, "AGCTG": 3767756, "AGCCA": 2537127, "AGCCT": 1923378, "AGCCC": 2443536, "AGCCG": 1234117, "AGCGA": 843308, "AGCGT": 607172, "AGCGC": 1161222, "AGCGG": 1326546, "AGGAA": 2839283, "AGGAT": 1608436, "AGGAC": 1898078, "AGGAG": 3930956, "AGGTA": 618544, "AGGTT": 935100, "AGGTC": 1040329, "AGGTG": 2087974, "AGGCA": 1777563, "AGGCT": 1757545, "AGGCC": 2457416, "AGGCG": 1075264, "AGGGA": 1361664, "AGGGT": 816916, "AGGGC": 1650015, "AGGGG": 1155803, "TAAAA": 1182178, "TAAAT": 674192, "TAAAC": 604867, "TAAAG": 1193362, "TAATA": 405040, "TAATT": 482709, "TAATC": 393361, "TAATG": 737901, "TAACA": 636268, "TAACT": 484797, "TAACC": 448345, "TAACG": 140711, "TAAGA": 858068, "TAAGT": 446048, "TAAGC": 532387, "TAAGG": 700840, "TATAA": 539957, "TATAT": 477266, "TATAC": 339611, "TATAG": 319733, "TATTA": 517329, "TATTT": 881499, "TATTC": 662751, "TATTG": 773198, "TATCA": 832297, "TATCT": 673158, "TATCC": 650907, "TATCG": 252444, "TATGA": 1190824, "TATGT": 725099, "TATGC": 736764, "TATGG": 954542, "TACAA": 1203696, "TACAT": 790266, "TACAC": 711275, "TACAG": 1330862, "TACTA": 513793, "TACTT": 788390, "TACTC": 644263, "TACTG": 979707, "TACCA": 1134771, "TACCT": 1036979, "TACCC": 725347, "TACCG": 455106, "TACGA": 463538, "TACGT": 335704, "TACGC": 337666, "TACGG": 389945, "TAGAA": 864109, "TAGAT": 476519, "TAGAC": 412928, "TAGAG": 709395, "TAGTA": 295159, "TAGTT": 363967, "TAGTC": 296947, "TAGTG": 544911, "TAGCA": 629284, "TAGCT": 480080, "TAGCC": 514863, "TAGCG": 144980, "TAGGA": 442619, "TAGGT": 257283, "TAGGC": 318163, "TAGGG": 282868, "TTAAA": 1004699, "TTAAT": 598688, "TTAAC": 458701, "TTAAG": 705355, "TTATA": 459015, "TTATT": 828222, "TTATC": 633612, "TTATG": 844510, "TTACA": 937477, "TTACT": 730280, "TTACC": 683543, "TTACG": 249670, "TTAGA": 621552, "TTAGT": 367706, "TTAGC": 415973, "TTAGG": 296999, "TTTAA": 883934, "TTTAT": 877745, "TTTAC": 689217, "TTTAG": 531532, "TTTTA": 903952, "TTTTT": 1397149, "TTTTC": 1211220, "TTTTG": 1455973, "TTTCA": 1282938, "TTTCT": 1512427, "TTTCC": 1312035, "TTTCG": 328229, "TTTGA": 1782339, "TTTGT": 1257588, "TTTGC": 1264539, "TTTGG": 1607198, "TTCAA": 1539322, "TTCAT": 1266843, "TTCAC": 1134928, "TTCAG": 2009019, "TTCTA": 853173, "TTCTT": 1543746, "TTCTC": 1486868, "TTCTG": 1901085, "TTCCA": 1879494, "TTCCT": 1966344, "TTCCC": 1420555, "TTCCG": 684232, "TTCGA": 672371, "TTCGT": 539610, "TTCGC": 473319, "TTCGG": 588068, "TTGAA": 1724439, "TTGAT": 1207154, "TTGAC": 1025702, "TTGAG": 1264616, "TTGTA": 618627, "TTGTT": 965224, "TTGTC": 894898, "TTGTG": 1306838, "TTGCA": 1147592, "TTGCT": 1445381, "TTGCC": 1276249, "TTGCG": 320340, "TTGGA": 1739757, "TTGGT": 1074417, "TTGGC": 1352521, "TTGGG": 1058295, "TCAAA": 1455031, "TCAAT": 810061, "TCAAC": 1386889, "TCAAG": 2145837, "TCATA": 489801, "TCATT": 1158205, "TCATC": 1939843, "TCATG": 1435268, "TCACA": 1210336, "TCACT": 1097212, "TCACC": 1841573, "TCACG": 503165, "TCAGA": 2018084, "TCAGT": 1309057, "TCAGC": 2102707, "TCAGG": 1560227, "TCTAA": 577742, "TCTAT": 687202, "TCTAC": 1068189, "TCTAG": 476494, "TCTTA": 630135, "TCTTT": 1347778, "TCTTC": 2092787, "TCTTG": 1140485, "TCTCA": 1358839, "TCTCT": 1486129, "TCTCC": 1912934, "TCTCG": 581173, "TCTGA": 1605632, "TCTGT": 1385168, "TCTGC": 1891356, "TCTGG": 2042460, "TCCAA": 1599074, "TCCAT": 1262536, "TCCAC": 1604775, "TCCAG": 2889967, "TCCTA": 795686, "TCCTT": 1385551, "TCCTC": 2236501, "TCCTG": 2915296, "TCCCA": 1702254, "TCCCT": 1532624, "TCCCC": 1723631, "TCCCG": 939341, "TCCGA": 662428, "TCCGT": 613849, "TCCGC": 1041676, "TCCGG": 993267, "TCGAA": 505474, "TCGAT": 367625, "TCGAC": 587010, "TCGAG": 875542, "TCGTA": 242117, "TCGTT": 302937, "TCGTC": 638657, "TCGTG": 840661, "TCGCA": 472425, "TCGCT": 618177, "TCGCC": 952126, "TCGCG": 347831, "TCGGA": 660733, "TCGGT": 420221, "TCGGC": 814982, "TCGGG": 882477, "TGAAA": 2293642, "TGAAT": 1249585, "TGAAC": 1511549, "TGAAG": 3699114, "TGATA": 792432, "TGATT": 1054389, "TGATC": 1191549, "TGATG": 2547035, "TGACA": 1736924, "TGACT": 1310419, "TGACC": 1750622, "TGACG": 694877, "TGAGA": 1807567, "TGAGT": 1002455, "TGAGC": 1815627, "TGAGG": 2106885, "TGTAA": 641528, "TGTAT": 735684, "TGTAC": 917283, "TGTAG": 559059, "TGTTA": 695374, "TGTTT": 1281450, "TGTTC": 1253804, "TGTTG": 1332318, "TGTCA": 1395049, "TGTCT": 1306702, "TGTCC": 1519745, "TGTCG": 494694, "TGTGA": 1598004, "TGTGT": 1390018, "TGTGC": 1571289, "TGTGG": 2451387, "TGCAA": 1355683, "TGCAT": 969224, "TGCAC": 1270628, "TGCAG": 3045648, "TGCTA": 914749, "TGCTT": 1339992, "TGCTC": 1725983, "TGCTG": 3986129, "TGCCA": 2341894, "TGCCT": 1863616, "TGCCC": 2287378, "TGCCG": 1000743, "TGCGA": 483432, "TGCGT": 448241, "TGCGC": 861962, "TGCGG": 1065479, "TGGAA": 2697786, "TGGAT": 1800619, "TGGAC": 2131479, "TGGAG": 3751769, "TGGTA": 814532, "TGGTT": 1138571, "TGGTC": 1212876, "TGGTG": 2761285, "TGGCA": 2304468, "TGGCT": 2233913, "TGGCC": 2767328, "TGGCG": 1135449, "TGGGA": 1798407, "TGGGT": 992439, "TGGGC": 1989512, "TGGGG": 1720080, "CAAAA": 2046824, "CAAAT": 1244494, "CAAAC": 1272512, "CAAAG": 2377675, "CAATA": 620503, "CAATT": 709916, "CAATC": 649285, "CAATG": 1504022, "CAACA": 2140619, "CAACT": 1308124, "CAACC": 1427906, "CAACG": 774447, "CAAGA": 3122494, "CAAGT": 1639775, "CAAGC": 2138641, "CAAGG": 2566231, "CATAA": 473185, "CATAT": 532903, "CATAC": 459307, "CATAG": 440950, "CATTA": 680000, "CATTT": 1127348, "CATTC": 1038895, "CATTG": 1595207, "CATCA": 2321937, "CATCT": 1735451, "CATCC": 2044699, "CATCG": 1123602, "CATGA": 1662308, "CATGT": 1162201, "CATGC": 1261447, "CATGG": 2035865, "CACAA": 1301615, "CACAT": 1007099, "CACAC": 1240382, "CACAG": 2308516, "CACTA": 611022, "CACTT": 1009746, "CACTC": 1035446, "CACTG": 1940001, "CACCA": 2837594, "CACCT": 1958809, "CACCC": 1913123, "CACCG": 1127778, "CACGA": 570135, "CACGT": 546862, "CACGC": 770051, "CACGG": 912034, "CAGAA": 3234032, "CAGAT": 2068162, "CAGAC": 1795599, "CAGAG": 2865959, "CAGTA": 1005011, "CAGTT": 1512573, "CAGTC": 1298614, "CAGTG": 2426326, "CAGCA": 3910620, "CAGCT": 3099996, "CAGCC": 3442091, "CAGCG": 1547392, "CAGGA": 2916505, "CAGGT": 1503301, "CAGGC": 2273412, "CAGGG": 1777432, "CTAAA": 885376, "CTAAT": 447556, "CTAAC": 395788, "CTAAG": 708604, "CTATA": 432400, "CTATT": 633623, "CTATC": 609088, "CTATG": 1169032, "CTACA": 1535464, "CTACT": 990410, "CTACC": 1236456, "CTACG": 654821, "CTAGA": 611432, "CTAGT": 376650, "CTAGC": 430032, "CTAGG": 382991, "CTTAA": 617124, "CTTAT": 609845, "CTTAC": 650652, "CTTAG": 469391, "CTTTA": 789050, "CTTTT": 1297968, "CTTTC": 1226516, "CTTTG": 1942784, "CTTCA": 2355128, "CTTCT": 2077024, "CTTCC": 2340497, "CTTCG": 1003303, "CTTGA": 1089805, "CTTGT": 907926, "CTTGC": 1081550, "CTTGG": 1465889, "CTCAA": 1524487, "CTCAT": 1341838, "CTCAC": 1303984, "CTCAG": 2260046, "CTCTA": 787266, "CTCTT": 1480199, "CTCTC": 1552573, "CTCTG": 2248272, "CTCCA": 2525258, "CTCCT": 2467976, "CTCCC": 2095320, "CTCCG": 1176715, "CTCGA": 582361, "CTCGT": 538140, "CTCGC": 802543, "CTCGG": 1051603, "CTGAA": 2581126, "CTGAT": 1506760, "CTGAC": 1703710, "CTGAG": 2370809, "CTGTA": 956530, "CTGTT": 1346222, "CTGTC": 1583097, "CTGTG": 2566811, "CTGCA": 2797051, "CTGCT": 3325829, "CTGCC": 3057258, "CTGCG": 1346442, "CTGGA": 3708726, "CTGGT": 1972042, "CTGGC": 2971824, "CTGGG": 2524190, "CCAAA": 1951728, "CCAAT": 954252, "CCAAC": 1632119, "CCAAG": 3022154, "CCATA": 504437, "CCATT": 1187324, "CCATC": 2126021, "CCATG": 2078080, "CCACA": 1886363, "CCACT": 1439769, "CCACC": 2814535, "CCACG": 1050118, "CCAGA": 2900682, "CCAGT": 1847153, "CCAGC": 3633993, "CCAGG": 2939290, "CCTAA": 639102, "CCTAT": 672512, "CCTAC": 1172764, "CCTAG": 517931, "CCTTA": 628382, "CCTTT": 1322684, "CCTTC": 2158454, "CCTTG": 1319311, "CCTCA": 2160547, "CCTCT": 1843855, "CCTCC": 2861125, "CCTCG": 1052263, "CCTGA": 2443562, "CCTGT": 1812352, "CCTGC": 3184999, "CCTGG": 3759292, "CCCAA": 1745065, "CCCAT": 1195029, "CCCAC": 1828926, "CCCAG": 3356751, "CCCTA": 713966, "CCCTT": 1215837, "CCCTC": 1910345, "CCCTG": 3000284, "CCCCA": 2447577, "CCCCT": 1744995, "CCCCC": 2709893, "CCCCG": 1730200, "CCCGA": 1005558, "CCCGT": 727437, "CCCGC": 1570486, "CCCGG": 1656241, "CCGAA": 749509, "CCGAT": 390881, "CCGAC": 778510, "CCGAG": 1600700, "CCGTA": 303941, "CCGTT": 377226, "CCGTC": 859952, "CCGTG": 1264611, "CCGCA": 1219357, "CCGCT": 1102737, "CCGCC": 2219534, "CCGCG": 1146049, "CCGGA": 1128791, "CCGGT": 534890, "CCGGC": 1779787, "CCGGG": 1567560, "CGAAA": 640644, "CGAAT": 406355, "CGAAC": 351735, "CGAAG": 849328, "CGATA": 220276, "CGATT": 301029, "CGATC": 333575, "CGATG": 706637, "CGACA": 809020, "CGACT": 545428, "CGACC": 755620, "CGACG": 602654, "CGAGA": 1221796, "CGAGT": 745447, "CGAGC": 1112250, "CGAGG": 1498900, "CGTAA": 232325, "CGTAT": 222046, "CGTAC": 276081, "CGTAG": 238573, "CGTTA": 197343, "CGTTT": 369745, "CGTTC": 428362, "CGTTG": 371611, "CGTCA": 750560, "CGTCT": 681653, "CGTCC": 870826, "CGTCG": 424870, "CGTGA": 841361, "CGTGT": 667640, "CGTGC": 950441, "CGTGG": 1441255, "CGCAA": 838605, "CGCAT": 553416, "CGCAC": 617078, "CGCAG": 1129254, "CGCTA": 401735, "CGCTT": 586445, "CGCTC": 856853, "CGCTG": 1431003, "CGCCA": 1399961, "CGCCT": 1241751, "CGCCC": 1351389, "CGCCG": 1555147, "CGCGA": 421058, "CGCGT": 352714, "CGCGC": 909897, "CGCGG": 1063885, "CGGAA": 951994, "CGGAT": 516208, "CGGAC": 735529, "CGGAG": 1405327, "CGGTA": 238922, "CGGTT": 364293, "CGGTC": 503909, "CGGTG": 990523, "CGGCA": 1258940, "CGGCT": 1239888, "CGGCC": 1768923, "CGGCG": 2096689, "CGGGA": 1386797, "CGGGT": 600987, "CGGGC": 1408606, "CGGGG": 1336814, "GAAAA": 3060589, "GAAAT": 1793526, "GAAAC": 1686232, "GAAAG": 2431986, "GAATA": 760567, "GAATT": 1211233, "GAATC": 1032451, "GAATG": 1518929, "GAACA": 1844432, "GAACT": 1388387, "GAACC": 1414100, "GAACG": 763332, "GAAGA": 4945058, "GAAGT": 1817797, "GAAGC": 2854264, "GAAGG": 2920372, "GATAA": 824868, "GATAT": 762104, "GATAC": 569912, "GATAG": 475570, "GATTA": 638561, "GATTT": 1087849, "GATTC": 1006078, "GATTG": 1012821, "GATCA": 1381697, "GATCT": 1115668, "GATCC": 1367698, "GATCG": 614715, "GATGA": 2901232, "GATGT": 1411532, "GATGC": 1678845, "GATGG": 2038881, "GACAA": 1777143, "GACAT": 1377797, "GACAC": 1210835, "GACAG": 1965190, "GACTA": 642633, "GACTT": 1261073, "GACTC": 1150685, "GACTG": 1465915, "GACCA": 1879378, "GACCT": 1727546, "GACCC": 1625114, "GACCG": 925868, "GACGA": 938188, "GACGT": 563694, "GACGC": 773410, "GACGG": 896866, "GAGAA": 3242883, "GAGAT": 1802982, "GAGAC": 1630691, "GAGAG": 2107581, "GAGTA": 734745, "GAGTT": 1126321, "GAGTC": 1122114, "GAGTG": 1411644, "GAGCA": 2258952, "GAGCT": 2394832, "GAGCC": 2218611, "GAGCG": 1272019, "GAGGA": 3868828, "GAGGT": 1466228, "GAGGC": 2368283, "GAGGG": 1583894, "GTAAA": 760692, "GTAAT": 421416, "GTAAC": 411135, "GTAAG": 474715, "GTATA": 360712, "GTATT": 610668, "GTATC": 564085, "GTATG": 774245, "GTACA": 886994, "GTACT": 678124, "GTACC": 871018, "GTACG": 408797, "GTAGA": 654362, "GTAGT": 377111, "GTAGC": 501452, "GTAGG": 333712, "GTTAA": 528561, "GTTAT": 543970, "GTTAC": 603362, "GTTAG": 323462, "GTTTA": 577983, "GTTTT": 1020346, "GTTTC": 962357, "GTTTG": 1267825, "GTTCA": 1173641, "GTTCT": 1142157, "GTTCC": 1280245, "GTTCG": 530712, "GTTGA": 964136, "GTTGT": 722842, "GTTGC": 865054, "GTTGG": 1095300, "GTCAA": 1082488, "GTCAT": 1100171, "GTCAC": 1088913, "GTCAG": 1287394, "GTCTA": 483124, "GTCTT": 989251, "GTCTC": 1135106, "GTCTG": 1361315, "GTCCA": 1357360, "GTCCT": 1443711, "GTCCC": 1301967, "GTCCG": 713130, "GTCGA": 384331, "GTCGT": 412950, "GTCGC": 530618, "GTCGG": 670557, "GTGAA": 1951080, "GTGAT": 1203178, "GTGAC": 1353442, "GTGAG": 1259947, "GTGTA": 590942, "GTGTT": 1096120, "GTGTC": 1123654, "GTGTG": 1574494, "GTGCA": 1389155, "GTGCT": 1732940, "GTGCC": 1648381, "GTGCG": 750842, "GTGGA": 2737994, "GTGGT": 1716877, "GTGGC": 2315677, "GTGGG": 1666640, "GCAAA": 1793493, "GCAAT": 806331, "GCAAC": 1263353, "GCAAG": 2167237, "GCATA": 417086, "GCATT": 974562, "GCATC": 1525372, "GCATG": 1209615, "GCACA": 1389965, "GCACT": 1116164, "GCACC": 1783812, "GCACG": 690696, "GCAGA": 2859389, "GCAGT": 1670903, "GCAGC": 3967756, "GCAGG": 2442819, "GCTAA": 705587, "GCTAT": 771297, "GCTAC": 1193775, "GCTAG": 452647, "GCTTA": 505224, "GCTTT": 1296322, "GCTTC": 1865169, "GCTTG": 1005839, "GCTCA": 1762343, "GCTCT": 1659097, "GCTCC": 2184872, "GCTCG": 830333, "GCTGA": 2639712, "GCTGT": 2037419, "GCTGC": 3876483, "GCTGG": 3545139, "GCCAA": 2336024, "GCCAT": 1890503, "GCCAC": 2082391, "GCCAG": 2737109, "GCCTA": 759878, "GCCTT": 1552727, "GCCTC": 2076043, "GCCTG": 2691657, "GCCCA": 2383471, "GCCCT": 2134455, "GCCCC": 2648404, "GCCCG": 1546409, "GCCGA": 1128538, "GCCGT": 898929, "GCCGC": 2135083, "GCCGG": 1541646, "GCGAA": 460877, "GCGAT": 367921, "GCGAC": 699734, "GCGAG": 1066703, "GCGTA": 198402, "GCGTT": 337448, "GCGTC": 691575, "GCGTG": 848309, "GCGCA": 906125, "GCGCT": 986536, "GCGCC": 1510474, "GCGCG": 889408, "GCGGA": 1120695, "GCGGT": 705476, "GCGGC": 2822065, "GCGGG": 1536292, "GGAAA": 2483158, "GGAAT": 1220819, "GGAAC": 1562966, "GGAAG": 3103949, "GGATA": 681486, "GGATT": 1014892, "GGATC": 1139575, "GGATG": 2064441, "GGACA": 1924886, "GGACT": 1335340, "GGACC": 1886585, "GGACG": 1052021, "GGAGA": 3253804, "GGAGT": 1417450, "GGAGC": 3032728, "GGAGG": 3393186, "GGTAA": 521650, "GGTAT": 536897, "GGTAC": 595119, "GGTAG": 475970, "GGTTA": 453081, "GGTTT": 846697, "GGTTC": 939851, "GGTTG": 803074, "GGTCA": 1152542, "GGTCT": 935272, "GGTCC": 1130555, "GGTCG": 543577, "GGTGA": 1671812, "GGTGT": 1234013, "GGTGC": 1614727, "GGTGG": 2608198, "GGCAA": 1764187, "GGCAT": 1339674, "GGCAC": 1388553, "GGCAG": 2695418, "GGCTA": 849609, "GGCTT": 1342316, "GGCTC": 1833890, "GGCTG": 2883981, "GGCCA": 2696287, "GGCCT": 2022614, "GGCCC": 2664850, "GGCCG": 1899703, "GGCGA": 838551, "GGCGT": 668332, "GGCGC": 1367839, "GGCGG": 2725137, "GGGAA": 1779562, "GGGAT": 934680, "GGGAC": 1432701, "GGGAG": 2031827, "GGGTA": 434807, "GGGTT": 574154, "GGGTC": 973366, "GGGTG": 1234435, "GGGCA": 1768398, "GGGCT": 1627341, "GGGCC": 2282725, "GGGCG": 1247156, "GGGGA": 1553622, "GGGGT": 796851, "GGGGC": 1896406, "GGGGG": 5412416 }, "overrepresented_sequences": {} }, "command": "fastp --in1 rna_s1221_S42_1.fastq.gz --in2 rna_s1221_S42_2.fastq.gz --out1 rna_s1221_S42_1.fastp.fastq.gz --out2 rna_s1221_S42_2.fastp.fastq.gz --json rna_s1221_S42.fastp.json --html rna_s1221_S42.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 10000000 " } }, "multiqc_fastqc": { "rna_s1221_S42_trimmed_1": { "Filename": "rna_s1221_S42_trimmed_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9932006.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "15-150", "%GC": 53.0, "total_deduplicated_percentage": 41.73382342652548, "avg_sequence_length": 138.4228959386452, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "pass" }, "rna_s1200_S21_trimmed_2": { "Filename": "rna_s1200_S21_trimmed_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9937706.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "16-150", "%GC": 53.0, "total_deduplicated_percentage": 48.69173720058066, "avg_sequence_length": 140.53251514987463, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "pass" }, "rna_s1221_S42_1": { "Filename": "rna_s1221_S42_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 10000000.0, "Total Bases": "1.5 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": 150.0, "%GC": 52.0, "total_deduplicated_percentage": 41.83692132885549, "avg_sequence_length": 150.0, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "pass", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "fail" }, "rna_s1200_S21_1": { "Filename": "rna_s1200_S21_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 10000000.0, "Total Bases": "1.5 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": 150.0, "%GC": 53.0, "total_deduplicated_percentage": 44.74997847936139, "avg_sequence_length": 150.0, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "pass", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "fail" }, "rna_s1221_S42_trimmed_2": { "Filename": "rna_s1221_S42_trimmed_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9932006.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "15-150", "%GC": 53.0, "total_deduplicated_percentage": 47.22846551251808, "avg_sequence_length": 138.44541374622608, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "pass" }, "rna_s1221_S42_2": { "Filename": "rna_s1221_S42_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 10000000.0, "Total Bases": "1.5 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": 150.0, "%GC": 53.0, "total_deduplicated_percentage": 47.34930767489769, "avg_sequence_length": 150.0, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "pass", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "fail" }, "rna_s1200_S21_trimmed_1": { "Filename": "rna_s1200_S21_trimmed_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9937706.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "18-150", "%GC": 53.0, "total_deduplicated_percentage": 44.68183581174609, "avg_sequence_length": 140.52089164239715, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "pass" }, "rna_s1200_S21_2": { "Filename": "rna_s1200_S21_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 10000000.0, "Total Bases": "1.5 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": 150.0, "%GC": 53.0, "total_deduplicated_percentage": 48.81417203525965, "avg_sequence_length": 150.0, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "pass", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "fail" } }, "multiqc_fastqc_1": { "rna_s1221_S42_trimmed_1": { "Filename": "rna_s1221_S42_trimmed_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9932006.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "15-150", "%GC": 53.0, "total_deduplicated_percentage": 41.73382342652548, "avg_sequence_length": 138.4228959386452, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "pass" }, "rna_s1200_S21_trimmed_2": { "Filename": "rna_s1200_S21_trimmed_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9937706.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "16-150", "%GC": 53.0, "total_deduplicated_percentage": 48.69173720058066, "avg_sequence_length": 140.53251514987463, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "pass" }, "rna_s1221_S42_trimmed_2": { "Filename": "rna_s1221_S42_trimmed_2.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9932006.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "15-150", "%GC": 53.0, "total_deduplicated_percentage": 47.22846551251808, "avg_sequence_length": 138.44541374622608, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "warn", "per_sequence_gc_content": "pass", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "warn", "adapter_content": "pass" }, "rna_s1200_S21_trimmed_1": { "Filename": "rna_s1200_S21_trimmed_1.gz", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 9937706.0, "Total Bases": "1.3 Gbp", "Sequences flagged as poor quality": 0.0, "Sequence length": "18-150", "%GC": 53.0, "total_deduplicated_percentage": 44.68183581174609, "avg_sequence_length": 140.52089164239715, "median_sequence_length": 150, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "pass", "adapter_content": "pass" } }, "multiqc_general_stats": { "rna_s1221_S42": { "Custom content: Kallisto_mqc-generalstats-custom_content_kallisto-fragment_length_mean": 175.9, "Custom content: Kallisto_mqc-generalstats-custom_content_kallisto-fragment_length_median": 160.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts": 0.01, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts": 4.71, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts": 2.83, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_male_est_counts": 0.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_mito_tpm": 0.01, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm": 11.32, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_hk_tpm": 3.19, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_male_tpm": 0.0, "Custom content: Preseq_mqc-generalstats-custom_content_preseq-total_reads": 9999000000.0, "Custom content: Preseq_mqc-generalstats-custom_content_preseq-expected_distinct": 53000545.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads": 19864012.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped": 0.004391, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes": 0.198705, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-unique_reads": 15916933.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target": 0.936077, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target": 0.962008, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target": 0.058443, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target": 0.037992, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target": 14899481.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target": 7595968.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target": 930229.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target": 299983.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-mean_depth": 32.870035, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-q50_depth": 5.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x": 0.28172, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x": 0.079333, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-n_q30": 0.98502, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-gc_bias": 0.0, "Custom content: RNA contamination_mqc-generalstats-custom_content_rna_contamination-is_contaminated": "Skipped", "Custom content: RNA contamination_mqc-generalstats-custom_content_rna_contamination-contamination_pct": "N/A", "Picard: InsertSizeMetrics_mqc-generalstats-picard_insertsizemetrics-summed_median": 255, "Picard: InsertSizeMetrics_mqc-generalstats-picard_insertsizemetrics-summed_mean": 661.011966, "Picard: Mark Duplicates_mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION": 0.199581, "Picard: RnaSeqMetrics_mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES": 0.0873, "Picard: RnaSeqMetrics_mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES": 95.2555, "RSeQC_mqc-generalstats-rseqc-proper_pairs_percent": 80.25001383886074, "STAR_mqc-generalstats-star-uniquely_mapped_percent": 94.32, "STAR_mqc-generalstats-star-uniquely_mapped": 9368114.0, "fastp_mqc-generalstats-fastp-pct_duplication": 13.947899999999999, "fastp_mqc-generalstats-fastp-after_filtering_q30_rate": 0.983893, "fastp_mqc-generalstats-fastp-after_filtering_q30_bases": 2705779238.0, "fastp_mqc-generalstats-fastp-filtering_result_passed_filter_reads": 19864012.0, "fastp_mqc-generalstats-fastp-after_filtering_gc_content": 0.533166, "fastp_mqc-generalstats-fastp-pct_surviving": 99.32006, "fastp_mqc-generalstats-fastp-pct_adapter": 36.832589999999996 }, "rna_s1200_S21": { "Custom content: Kallisto_mqc-generalstats-custom_content_kallisto-fragment_length_mean": 180.9, "Custom content: Kallisto_mqc-generalstats-custom_content_kallisto-fragment_length_median": 166.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_mito_est_counts": 0.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_ribo_est_counts": 4.58, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_hk_est_counts": 2.97, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_male_est_counts": 0.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_mito_tpm": 0.0, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_ribo_tpm": 10.89, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_hk_tpm": 3.45, "Custom content: Expression QC_mqc-generalstats-custom_content_expression_qc-pct_male_tpm": 0.0, "Custom content: Preseq_mqc-generalstats-custom_content_preseq-total_reads": 9999000000.0, "Custom content: Preseq_mqc-generalstats-custom_content_preseq-expected_distinct": 53979070.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads": 19875412.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_unmapped": 0.003853, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_dupes": 0.183621, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-unique_reads": 16225876.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_on_target": 0.945347, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_on_target": 0.972121, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_reads_off_target": 0.049933, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_pairs_off_target": 0.027879, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads_on_target": 15339088.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-pairs_on_target": 7832369.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-reads_off_target": 810206.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-pairs_off_target": 224622.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-mean_depth": 34.559207, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-q50_depth": 5.0, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt30x": 0.293198, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-frac_bases_gt100x": 0.084685, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-n_q30": 0.985625, "Custom content: SeqTools (general stats)_mqc-generalstats-custom_content_seqtools_general_stats-gc_bias": 0.0, "Custom content: RNA contamination_mqc-generalstats-custom_content_rna_contamination-is_contaminated": "Skipped", "Custom content: RNA contamination_mqc-generalstats-custom_content_rna_contamination-contamination_pct": "N/A", "Picard: InsertSizeMetrics_mqc-generalstats-picard_insertsizemetrics-summed_median": 294, "Picard: InsertSizeMetrics_mqc-generalstats-picard_insertsizemetrics-summed_mean": 762.227728, "Picard: Mark Duplicates_mqc-generalstats-picard_mark_duplicates-PERCENT_DUPLICATION": 0.184331, "Picard: RnaSeqMetrics_mqc-generalstats-picard_rnaseqmetrics-PCT_RIBOSOMAL_BASES": 0.0, "Picard: RnaSeqMetrics_mqc-generalstats-picard_rnaseqmetrics-PCT_MRNA_BASES": 96.3936, "RSeQC_mqc-generalstats-rseqc-proper_pairs_percent": 90.33600244662823, "STAR_mqc-generalstats-star-uniquely_mapped_percent": 95.95, "STAR_mqc-generalstats-star-uniquely_mapped": 9534804.0, "fastp_mqc-generalstats-fastp-pct_duplication": 13.3191, "fastp_mqc-generalstats-fastp-after_filtering_q30_rate": 0.984633, "fastp_mqc-generalstats-fastp-after_filtering_q30_bases": 2750334612.0, "fastp_mqc-generalstats-fastp-filtering_result_passed_filter_reads": 19875412.0, "fastp_mqc-generalstats-fastp-after_filtering_gc_content": 0.535761, "fastp_mqc-generalstats-fastp-pct_surviving": 99.37706, "fastp_mqc-generalstats-fastp-pct_adapter": 32.738935000000005 }, "rna_s1221_S42_1": { "Kallisto_mqc-generalstats-kallisto-fragment_length": 175.9, "Kallisto_mqc-generalstats-kallisto-percent_aligned": 96.36796433671103, "Kallisto_mqc-generalstats-kallisto-pseudoaligned_reads": 9571272.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 58.16307867114451, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 52.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 150.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 27.27272727272727, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 10000000.0 }, "rna_s1200_S21_1": { "Kallisto_mqc-generalstats-kallisto-fragment_length": 180.9, "Kallisto_mqc-generalstats-kallisto-percent_aligned": 97.82623877180508, "Kallisto_mqc-generalstats-kallisto-pseudoaligned_reads": 9721684.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 55.25002152063861, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 150.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 27.27272727272727, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 10000000.0 }, "rna_s1221_S42_trimmed_1": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 58.26617657347452, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 138.4228959386452, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 18.181818181818183, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 9932006.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_duplicates": 58.26617657347452, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_gc": 53.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-avg_sequence_length": 138.4228959386452, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-median_sequence_length": 150, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_fails": 18.181818181818183, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-total_sequences": 9932006.0 }, "rna_s1200_S21_trimmed_2": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 51.30826279941934, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 140.53251514987463, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 9.090909090909092, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 9937706.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_duplicates": 51.30826279941934, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_gc": 53.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-avg_sequence_length": 140.53251514987463, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-median_sequence_length": 150, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_fails": 9.090909090909092, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-total_sequences": 9937706.0 }, "rna_s1221_S42_trimmed_2": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 52.77153448748192, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 138.44541374622608, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 9.090909090909092, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 9932006.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_duplicates": 52.77153448748192, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_gc": 53.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-avg_sequence_length": 138.44541374622608, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-median_sequence_length": 150, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_fails": 9.090909090909092, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-total_sequences": 9932006.0 }, "rna_s1221_S42_2": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 52.65069232510231, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 150.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 18.181818181818183, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 10000000.0 }, "rna_s1200_S21_trimmed_1": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 55.31816418825391, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 140.52089164239715, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 18.181818181818183, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 9937706.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_duplicates": 55.31816418825391, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_gc": 53.0, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-avg_sequence_length": 140.52089164239715, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-median_sequence_length": 150, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-percent_fails": 18.181818181818183, "FastQC (trimmed)_mqc-generalstats-fastqc_trimmed-total_sequences": 9937706.0 }, "rna_s1200_S21_2": { "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_duplicates": 51.18582796474035, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_gc": 53.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-avg_sequence_length": 150.0, "FastQC (raw)_mqc-generalstats-fastqc_raw-median_sequence_length": 150, "FastQC (raw)_mqc-generalstats-fastqc_raw-percent_fails": 18.181818181818183, "FastQC (raw)_mqc-generalstats-fastqc_raw-total_sequences": 10000000.0 } } }, "config_analysis_dir_abs": [ "/tmp/nxf.tG4QzmekYC" ], "config_analysis_dir": [ "." ], "config_creation_date": "2026-05-28, 00:25 UTC", "config_git_hash": null, "config_intro_text": null, "config_report_comment": "This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.\n", "config_report_header_info": null, "config_script_path": "/usr/local/lib/python3.11/site-packages/multiqc/utils", "config_short_version": "1.21", "config_subtitle": null, "config_title": null, "config_version": "1.21", "config_output_dir": "/tmp/nxf.tG4QzmekYC" }