Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1485872334(99.0582%)
Q30 bases: 1464758265(97.6506%)

Read2 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1482009250(98.8006%)
Q30 bases: 1453828999(96.9219%)

Read1 after filtering:
total reads: 9932006
total bases: 1374926771
Q20 bases: 1369172921(99.5815%)
Q30 bases: 1355291933(98.5719%)

Read2 after filtering:
total reads: 9932006
total bases: 1375146552
Q20 bases: 1367462784(99.4412%)
Q30 bases: 1350487305(98.2068%)

Filtering result:
reads passed filter: 19864012
reads failed due to low quality: 135928
reads failed due to too many N: 0
reads failed due to too short: 60
reads with adapter trimmed: 7366518
bases trimmed due to adapters: 230290481

Duplication rate: 13.9479%

Insert size peak (evaluated by paired-end reads): 140

JSON report: rna_s1221_S42.fastp.json
HTML report: rna_s1221_S42.fastp.html

fastp --in1 rna_s1221_S42_1.fastq.gz --in2 rna_s1221_S42_2.fastq.gz --out1 rna_s1221_S42_1.fastp.fastq.gz --out2 rna_s1221_S42_2.fastp.fastq.gz --json rna_s1221_S42.fastp.json --html rna_s1221_S42.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 10000000 
fastp v0.23.4, time used: 22 seconds