Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1488646967(99.2431%)
Q30 bases: 1469875906(97.9917%)

Read2 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1484512451(98.9675%)
Q30 bases: 1458809565(97.254%)

Read1 after filtering:
total reads: 9937706
total bases: 1396572795
Q20 bases: 1391108252(99.6087%)
Q30 bases: 1377664520(98.6461%)

Read2 after filtering:
total reads: 9937706
total bases: 1396684695
Q20 bases: 1389391946(99.4779%)
Q30 bases: 1372670092(98.2806%)

Filtering result:
reads passed filter: 19875412
reads failed due to low quality: 124550
reads failed due to too many N: 0
reads failed due to too short: 38
reads with adapter trimmed: 6547787
bases trimmed due to adapters: 188610493

Duplication rate: 13.3191%

Insert size peak (evaluated by paired-end reads): 139

JSON report: rna_s1200_S21.fastp.json
HTML report: rna_s1200_S21.fastp.html

fastp --in1 rna_s1200_S21_1.fastq.gz --in2 rna_s1200_S21_2.fastq.gz --out1 rna_s1200_S21_1.fastp.fastq.gz --out2 rna_s1200_S21_2.fastp.fastq.gz --json rna_s1200_S21.fastp.json --html rna_s1200_S21.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 10000000 
fastp v0.23.4, time used: 22 seconds