Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1485888211(99.0592%)
Q30 bases: 1464789723(97.6526%)

Read2 before filtering:
total reads: 10000000
total bases: 1500000000
Q20 bases: 1481970083(98.798%)
Q30 bases: 1453768839(96.9179%)

Read1 after filtering:
total reads: 9928008
total bases: 1374329157
Q20 bases: 1368589956(99.5824%)
Q30 bases: 1354726987(98.5737%)

Read2 after filtering:
total reads: 9928008
total bases: 1374534174
Q20 bases: 1366930980(99.4469%)
Q30 bases: 1349974933(98.2133%)

Filtering result:
reads passed filter: 19856016
reads failed due to low quality: 136492
reads failed due to too many N: 7406
reads failed due to too short: 86
reads with adapter trimmed: 7364301
bases trimmed due to adapters: 230358751

Duplication rate: 13.8514%

Insert size peak (evaluated by paired-end reads): 142

JSON report: rna_s1221_S42.fastp.json
HTML report: rna_s1221_S42.fastp.html

fastp --in1 rna_s1221_S42_1.fastq.gz --in2 rna_s1221_S42_2.fastq.gz --out1 rna_s1221_S42_1.fastp.fastq.gz --out2 rna_s1221_S42_2.fastp.fastq.gz --json rna_s1221_S42.fastp.json --html rna_s1221_S42.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 22 seconds