Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000
total bases: 15000000
Q20 bases: 14861226(99.0748%)
Q30 bases: 14655147(97.701%)

Read2 before filtering:
total reads: 100000
total bases: 15000000
Q20 bases: 14824366(98.8291%)
Q30 bases: 14547373(96.9825%)

Read1 after filtering:
total reads: 99324
total bases: 13751962
Q20 bases: 13696478(99.5965%)
Q30 bases: 13561788(98.6171%)

Read2 after filtering:
total reads: 99324
total bases: 13753321
Q20 bases: 13679148(99.4607%)
Q30 bases: 13512414(98.2484%)

Filtering result:
reads passed filter: 198648
reads failed due to low quality: 1260
reads failed due to too many N: 92
reads failed due to too short: 0
reads with adapter trimmed: 73510
bases trimmed due to adapters: 2300619

Duplication rate: 0.296%

Insert size peak (evaluated by paired-end reads): 122

JSON report: rna_s1221_S42.fastp.json
HTML report: rna_s1221_S42.fastp.html

fastp --in1 rna_s1221_S42_1.fastq.gz --in2 rna_s1221_S42_2.fastq.gz --out1 rna_s1221_S42_1.fastp.fastq.gz --out2 rna_s1221_S42_2.fastp.fastq.gz --json rna_s1221_S42.fastp.json --html rna_s1221_S42.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 3 seconds