File Info

Filename
tih_rna_sample_00338_23KMKGLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/tih_rna_sample_00338_23KMKGLT4_1.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:22 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 113617216
total bases: 17156199616
Q20 bases: 16656144463(97.0853%)
Q30 bases: 15888378253(92.6101%)

Read2 before filtering:
total reads: 113617216
total bases: 17156199616
Q20 bases: 16745717309(97.6074%)
Q30 bases: 15927230483(92.8366%)

Read1 after filtering:
total reads: 110759071
total bases: 12565976984
Q20 bases: 12510793751(99.5609%)
Q30 bases: 12255973456(97.533%)

Read2 after filtering:
total reads: 110759071
total bases: 12586455517
Q20 bases: 12486284571(99.2041%)
Q30 bases: 12163080016(96.6363%)

Filtering result:
reads passed filter: 221518142
reads failed due to low quality: 3423260
reads failed due to too many N: 34576
reads failed due to too short: 2258454
reads with adapter trimmed: 179445209
bases trimmed due to adapters: 8418674506

Duplication rate: 45.7891%

Insert size peak (evaluated by paired-end reads): 97

JSON report: tih_rna_sample_00338_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00338_23KMKGLT4_1.fastp.html

fastp --in1 tih_rna_sample_00338_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00338_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00338_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00338_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00338_23KMKGLT4_1.fastp.json --html tih_rna_sample_00338_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 275 seconds