File Info

Filename
tih_rna_sample_00300_23KMKGLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/tih_rna_sample_00300_23KMKGLT4_1.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:23 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 148051492
total bases: 22355775292
Q20 bases: 21755570006(97.3152%)
Q30 bases: 20692665904(92.5607%)

Read2 before filtering:
total reads: 148051492
total bases: 22355775292
Q20 bases: 21641912912(96.8068%)
Q30 bases: 20399829137(91.2508%)

Read1 after filtering:
total reads: 144221899
total bases: 16264906058
Q20 bases: 16174742160(99.4457%)
Q30 bases: 15813837735(97.2267%)

Read2 after filtering:
total reads: 144221899
total bases: 16337361200
Q20 bases: 16124150846(98.695%)
Q30 bases: 15582122293(95.3772%)

Filtering result:
reads passed filter: 288443798
reads failed due to low quality: 6278102
reads failed due to too many N: 44710
reads failed due to too short: 1336374
reads with adapter trimmed: 236186368
bases trimmed due to adapters: 11123765337

Duplication rate: 51.7132%

Insert size peak (evaluated by paired-end reads): 106

JSON report: tih_rna_sample_00300_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00300_23KMKGLT4_1.fastp.html

fastp --in1 tih_rna_sample_00300_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00300_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00300_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00300_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00300_23KMKGLT4_1.fastp.json --html tih_rna_sample_00300_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 340 seconds