Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 15751549
total bases: 2378483899
Q20 bases: 2228165822(93.6801%)
Q30 bases: 2022395234(85.0288%)
Read2 before filtering:
total reads: 15751549
total bases: 2378483899
Q20 bases: 2271833065(95.516%)
Q30 bases: 2062625349(86.7202%)
Read1 after filtering:
total reads: 13073429
total bases: 1323854541
Q20 bases: 1315029059(99.3333%)
Q30 bases: 1281810791(96.8241%)
Read2 after filtering:
total reads: 13073429
total bases: 1330346820
Q20 bases: 1316779397(98.9802%)
Q30 bases: 1277768614(96.0478%)
Filtering result:
reads passed filter: 26146858
reads failed due to low quality: 616436
reads failed due to too many N: 14540
reads failed due to too short: 4725264
reads with adapter trimmed: 26307528
bases trimmed due to adapters: 1387840281
Duplication rate: 32.5293%
Insert size peak (evaluated by paired-end reads): 99
JSON report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html
fastp --in1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html 22Rv1_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe
fastp v0.23.4, time used: 32 seconds