File Info

Filename
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008/B23LG7FLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:55 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44413313371(98.0426%)
Q30 bases: 42842080230(94.5741%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44371605248(97.9506%)
Q30 bases: 42452660886(93.7145%)

Read1 after filtering:
total reads: 295379314
total bases: 37836735486
Q20 bases: 37641998736(99.4853%)
Q30 bases: 36805243071(97.2738%)

Read2 after filtering:
total reads: 295379314
total bases: 37880529105
Q20 bases: 37577585624(99.2003%)
Q30 bases: 36549837871(96.4871%)

Filtering result:
reads passed filter: 590758628
reads failed due to low quality: 7782794
reads failed due to too many N: 199022
reads failed due to too short: 1259556
reads with adapter trimmed: 342669977
bases trimmed due to adapters: 13629181154

Duplication rate: 24.7493%

Insert size peak (evaluated by paired-end reads): 118

JSON report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.json
HTML report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.html

fastp --in1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_1.fastq.gz --in2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_2.fastq.gz --out1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_1.fastp.fastq.gz --out2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_2.fastp.fastq.gz --json KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.json --html KG1_FFPE_01_RNA_0003_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 754 seconds